CN107858444A - Transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods - Google Patents
Transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods Download PDFInfo
- Publication number
- CN107858444A CN107858444A CN201711031096.8A CN201711031096A CN107858444A CN 107858444 A CN107858444 A CN 107858444A CN 201711031096 A CN201711031096 A CN 201711031096A CN 107858444 A CN107858444 A CN 107858444A
- Authority
- CN
- China
- Prior art keywords
- quantitative pcr
- paddy rice
- transgenic paddy
- detecting methods
- strain specificity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods, comprise the following steps：A1, design synthetic primer and fluorescence probe；The sequence of the primer is as shown in SEQ ID No.1 and SEQ ID No.2, and the sequence of the fluorescence probe is as shown in SEQ ID No.3；A2, the DNA profiling dilution for preparing G6H1 strains；A3, prepare quantitative PCR reaction system；A4, carry out quantitative PCR detection.It is efficient, sensitive, accurate that the method for the present invention has the advantages that, is suitable for the quantitative detection of transgenic pest-resistant herbicide-resistant rice G6H1 and its product.
Description
Technical field
The present invention relates to a kind of Transgenic Plant Lines specific quantification PCR detection method, specifically, is related to a kind of turn
Gene pest-resistant herbicide-resistant rice G6H1 strain specificity quantitative PCR detecting methods.
Background technology
With the fast development of agriculture change gene biology technology, the cultivated area of global genetically modified crops rapidly increases.From
The security of transgenic technology and products thereof is always the focus of global public attention since the nineties in last century, countries in the world phase
It is right in the world at present after formulating and implement a series of evaluation of GMO bio-safeties and laws and regulations on the management and tag control system
4 classes are broadly divided into transgenic labeling management：First, voluntarily identify, such as U.S., Canada, Argentina；It is second, quantitatively comprehensive
Mark is forced, as long as must just be identified more than threshold value to its gm content of all products, as European Union provides transgenosis
Composition must identify more than 0.9%, Brazilian regulation transgene component more than 1%；Third, the mandatory mark of dosing section, i.e., to spy
Must just be identified as long as determining category product its gm content and exceeding threshold value, such as Japan's regulation to bean curd, corn pot foods,
24 kinds of natto etc. food made of soybean or corn carries out transgenic labeling, given threshold 5%；It is fourth, qualitative strong by catalogue
System mark, i.e., every product for being included in catalogue, as long as be either process containing transgene component by genetically modified crops, must
Must mark.China belongs to the 4th kind.The Chinese government pays much attention to the safety management of genetically modified organism, issuing and implementation《Agricultural turns
Gene biological safety management regulations》And its with set of rules, safety evaluation, product mark are carried out to agriculture genetically modified organism and products thereof
The systems such as knowledge, production permit, operation permission, import licensing, processing license, and mandatory identification method is used, turn as long as containing
Gene element must just identify.Therefore establish efficient, accurate transgenic detection method is that these rules and regulations are able to smoothly
The key of implementation.So far, the detection method of multiple transgenic paddy rices has been studied and formulated in China, and is promulgated as country
Standard (such as No. 1193 bulletin -3-2009 genetically modified plants of the Ministry of Agriculture and products thereof composition detection insect-proof rice TT51-1 and its is spread out
No. 2259 bulletin -11-2015 genetically modified plants of health product kind qualitative PCR method and the Ministry of Agriculture and products thereof composition detection is pest-resistant resistance to be removed
Careless agent rice G6H1 and its derived varieties qualitative PCR method).
Transgenic pest-resistant herbicide-resistant rice G6H1 kinds are by killing gene HJC-1 of the codon by optimization and are resisted
Glyphosate gene G6 imported into cultivated rice varieties and " obtained in elegant water 110 ", HJC-1 is melting for Cry1Ab and Vip3II
Gene is closed, the fusion of the two genes has and has broader spectrum of killing ability to lepidoptera pest.G6 is a new 5- enol
Formula pyruvic acid 3- phosphate synthase genes (EPSPS).2014, Xu Junfeng et al. reported transgenic pest-resistant herbicide-resistant rice
(patent publication No. CN103923999A, publication date are 07 year 2014 for G6H1 external sources insertion complete sequence and qualitative PCR method
16)；They disclose 5 ' the end flanking sequences and 3 ' end flanking sequences of the rice strain transformant external source Insert Fragment simultaneously, and
Establishing PCR qualitative checking methods based on this sequence information, (patent publication No. CN103923999A, publication date are 2014 07
Year is 16).But the report or special on quantitative approach detection transgenic pest-resistant herbicide-resistant rice G6H1 is still there is no at present
Profit.A kind of transgenic rice multiple digital pcr quantitative detecting method is disclosed in patent CN106868137A, is used due to it
It is digital pcr technology, it is necessary to which special number PCR instrument device (has three different digital pcr platforms, belong to reality in the market
Property is tested, does not reach the maturity of qualitative PCR and quantitative PCR instruments generally used now), general detection GMOs are real at present
Test room and be still not equipped with digital pcr instrument, therefore hardly possible is standardized to the method.Accordingly, there exist practical application difficulty, cost height etc.
Problem.
It is accurate it is therefore desirable to establish a kind of new transgenic pest-resistant herbicide-resistant rice G6H1 strain specificity quantitative PCRs
Detection technique.
The content of the invention
The present invention is directed to the deficiency of prior art standard adaptation, there is provided a kind of transgenic pest-resistant herbicide-resistant rice G6H1
Strain specificity quantitative PCR detecting method.Specially it is a kind of it is efficient, sensitive, accurately based on 3 ' end flanking sequences (3 ' end external sources
The combination point sequence of gene and rice genome is more clear, the design suitable for primer) detection transgenic pest-resistant herbicide-resistant
Rice G6H1 strain specificity quantitative PCR detecting methods.
The purpose of the present invention is achieved through the following technical solutions：
The invention provides a kind of transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods, it is characterised in that bag
Include following steps：
A1, design synthetic primer and fluorescence probe；The sequence of the primer such as SEQ ID No.1 and SEQ ID No.2 institutes
Show, the sequence of the fluorescence probe is as shown in SEQ ID No.3；
Upstream primer sequence, ES-quan-1F (SEQ ID No.1)：5’-AAGCGTCAATTTGTTTACACC-3’
Downstream primer sequence, ES-quan-2R (SEQ ID No.2)：5’-TCGATCTGCTGCAGCTTG-3’
Fluorescence probe sequence, ES-quan-P (SEQ ID No.3)：
5’-FAM ATGGATGTATCGCCACCAGCACC BHQ1-3’
A2, the DNA profiling dilution for preparing G6H1 strains；
A3, prepare quantitative PCR reaction system；
A4, carry out quantitative PCR detection.
Preferably, in step A1, the primer of the synthesis and the concentration of fluorescence probe are 10 μm of ol/L.
Preferably, in step A2, the concentration of the DNA profiling dilution is 10ng/ μ L.
Preferably, in step A3, the collocation method of the PCR reaction systems is：DNA profiling dilution is added to reaction
In system；
Described reaction system is counted by 25 μ L of cumulative volume, includes each component of volumes below percentage composition：
Preferably, the DNA profiling dilution volume and the volume ratio for accounting for overall reaction system are 1:5.
Preferably, in step A4, the reaction condition of the progress quantitative PCR detection is：95 DEG C of pre-degeneration 5min, 1 is followed
Ring；95 DEG C of denaturation 15s, 58 DEG C of annealing 60s, and fluorescence signal is gathered, 40 circulations.
Compared with the prior art, the present invention has the advantages that：
1st, present invention employs hold to be suitable to real-time quantitative between flanking sequence and foreign gene based on G6H1 transformation events 3 '
Specific forward primer, anti-sense primer and the fluorescence probe that PCR is quantitatively detected are high and efficient with detection specificity and the degree of accuracy
The features such as sensitive.Detection method provided by the invention is suitable for transgenic pest-resistant herbicide-resistant rice G6H1 and its converted products
Quantitative detection, may better secure right to know and right to choose of the consumer to transgenic product.
2nd, the present invention holds the degree of accuracy of binding site sequence by comparing G6H1 transformation events 3 ' and 5 ', selects 3 ' end sides
Sequence and the specific nucleotide sequence of foreign gene land, and transgenic pest-resistant herbicide-resistant rice is established on this basis
The quantitative PCR detecting method of G6H1 strain specificities.
Embodiment
With reference to specific embodiment, the present invention is described in detail.Following examples will be helpful to the technology of this area
Personnel further understand the present invention, but the invention is not limited in any way.It should be pointed out that the ordinary skill to this area
For personnel, without departing from the inventive concept of the premise, some changes and improvements can also be made.These belong to the present invention
Protection domain.
The experimental method of unreceipted actual conditions in the following example, generally according to normal condition, such as Sambrook etc.
Molecular cloning：Laboratory manual (New York：Cold Spring Harbor Laboratory Press, 2001) institute in
The condition stated, or the condition proposed by according to instrument or reagent manufacturer.
Embodiment 1
The present embodiment is related to a kind of transgenic pest-resistant herbicide-resistant rice G6H1 strain specificity quantitative PCR detecting methods,
Mainly include the following steps that：
1. the fluorescence probe that synthesis has the primer of following nucleotide sequence and is used cooperatively with primer,
Upstream primer sequence, ES-quan-1F (SEQ ID No.1)：5’-AAGCGTCAATTTGTTTACACC-3’
Downstream primer sequence, ES-quan-2R (SEQ ID No.2)：5’-TCGATCTGCTGCAGCTTG-3’
Fluorescence probe sequence, ES-quan-P (SEQ ID No.3)：
5’-FAM ATGGATGTATCGCCACCAGCACC BHQ1-3’
The concentration of the present embodiment primer and fluorescence probe is all 10 μm of ol/L.
The nucleotide sequence of above primer and fluorescence probe is to be directed to transgenic pest-resistant herbicide-resistant rice G6H1 and product
Strain specificity specific site, i.e. foreign gene and oryza sativa genomic dna be integrated into design, can by the design
Accurately to detect transgenic paddy rice G6H1 transformation event；
2. the DNA profiling dilution of prepare transgenosis rice G6H1 strains：Using the DNA extraction means of routine, from turning base
Because extracting the DNA profiling dilution that concentration is 10ng/ μ L in pest-resistant herbicide-resistant rice G6H1；
3. prepare PCR reaction systems：The reaction system of the 25 μ L includes following components：
HR qPCR Master Mix come from Shanghai Hui Rui bio tech ltd in reaction system；
4. quantitative PCR detection.
According to above-mentioned PCR reaction systems, product is expanded and detected under following PCR reaction conditions, the PCR is anti-
The condition is answered to be：95 DEG C of pre-degeneration 5min, 1 circulation；95 DEG C of denaturation 15s, 58 DEG C of annealing 60s, 40 circulate.Adopted in the present embodiment
It is the quantitative PCR apparatus of ABI 7900 (Applied Biosystems, USA).
In the present embodiment, 3 personnel are invited to participate in cooperative experiment checking.In specificity of transformant quantitative PCR detection side
In method checking, it is desirable to which every personnel progressively dilute transgenic pest-resistant herbicide-resistant rice G6H1 template, establish its external source and interior
Source standard curve.Observe the knot such as the repeatability of the linearly dependent coefficient of its standard curve, reaction efficiency and data, repeatability
Fruit.Every personnel dilute transgenic paddy rice DNA by the DNA of non-transgenic rice, prepare containing transgenic paddy rice 5%, 3%,
0.5% (W/W) blind sample.And according to the standard curve of foundation, the relative amount of 3 blind samples is calculated, observes the calculating of blind sample
Difference size between value and its actual value.In this experiment, the quantitative analysis of actual sample is to use relative quantification method, is both used
The ratio of foreign gene and internal standard gene content come represent detect sample in transgene component content.By blind sample in identical threshold
Ct values under value substitute into external source respectively, endogenous standard curve, obtain respective value, according to formula (sample transgenosis content (%)
The copy number of the internal standard gene of the copy number of=external source target gene × 100/) carry out the calculating of transgenosis content.Experiment every time
It is required that setting up three repetitions, three-wheel experiment is repeated.Experimental result is as shown in table 1.
The specificity of transformant quantitative PCR detecting method the result of table 1
The accuracy of quantitative result is assessed by average value (Mean value) and deviation (Bias), and accuracy is by standard deviation
Poor (SD) and relative standard deviation (RSD) are assessed.The calculated value of the transgenic paddy rice content of biased sample and its actual value it
Between deviation between 3.0%~9.04%, respectively less than 25%, and the deviation between calculated value and actual value is with aggregate sample
The reduction of product transgenic paddy rice content and increase.But we detect transgenic paddy rice content be 0.5% mixing sample when, its
Calculated value is with actual value still in the range of it can receive；Moreover, between repeating three times, the calculated value of transgenic paddy rice content
Between standard deviation and relative standard deviation also in the ideal range, the results showed that transgenic pest-resistant herbicide-resistant rice G6H1
Strain specificity quantitative detecting method has high accuracy and accuracy.
The specific embodiment of the present invention is described above.It is to be appreciated that the invention is not limited in above-mentioned
Particular implementation, those skilled in the art can make a variety of changes or change within the scope of the claims, this not shadow
Ring the substantive content of the present invention.In the case where not conflicting, the feature in embodiments herein and embodiment can any phase
Mutually combination.
Sequence table
<110>Shanghai Communications University
<120>Transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods
<130> DAG32730
<141> 2017-10-24
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
<220>
Claims (6)
1. a kind of transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods, it is characterised in that comprise the following steps：
A1, design synthetic primer and fluorescence probe；The sequence of the primer is as shown in SEQ ID No.1 and SEQ ID No.2, institute
The sequence of fluorescence probe is stated as shown in SEQ ID No.3；
A2, the DNA profiling dilution for preparing G6H1 strains；
A3, prepare quantitative PCR reaction system；
A4, carry out quantitative PCR detection.
2. transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods according to claim 1, it is characterised in that
In step A1, the primer of the synthesis and the concentration of fluorescence probe are 10 μm of ol/L.
3. transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods according to claim 1, it is characterised in that
In step A2, the concentration of the DNA profiling dilution is 10ng/ μ L.
4. transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods according to claim 1, it is characterised in that
In step A3, the collocation method of the PCR reaction systems is：DNA profiling dilution is added in reaction system；
Described reaction system is counted by 25 μ L of cumulative volume, includes each component of volumes below percentage composition：
5. transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods according to claim 4, it is characterised in that
The volume ratio of the DNA profiling dilution and reaction system is 1:5.
6. transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods according to claim 1, it is characterised in that
In step A4, the reaction condition of the progress quantitative PCR detection is：95 DEG C of pre-degeneration 5min, 1 circulation；95 DEG C of denaturation 15s,
58 DEG C of annealing 60s, and fluorescence signal is gathered, 40 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711031096.8A CN107858444A (en) | 2017-10-24 | 2017-10-24 | Transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711031096.8A CN107858444A (en) | 2017-10-24 | 2017-10-24 | Transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107858444A true CN107858444A (en) | 2018-03-30 |
Family
ID=61698008
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711031096.8A Pending CN107858444A (en) | 2017-10-24 | 2017-10-24 | Transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107858444A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103923999A (en) * | 2014-04-25 | 2014-07-16 | 浙江省农业科学院 | Qualitative PCR detecting method for transgenic insect-resistant herbicide-tolerant rice G6H1 and derived varieties thereof |
| CN105200067A (en) * | 2015-09-25 | 2015-12-30 | 浙江大学 | Rice transformation event G6H1 and specificity PCR (polymerase chain reaction) identification method thereof |
| CN106868137A (en) * | 2017-03-01 | 2017-06-20 | 浙江省农业科学院 | Transgenic rice multiple digital pcr quantitative detecting method |
-
2017
- 2017-10-24 CN CN201711031096.8A patent/CN107858444A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103923999A (en) * | 2014-04-25 | 2014-07-16 | 浙江省农业科学院 | Qualitative PCR detecting method for transgenic insect-resistant herbicide-tolerant rice G6H1 and derived varieties thereof |
| CN105200067A (en) * | 2015-09-25 | 2015-12-30 | 浙江大学 | Rice transformation event G6H1 and specificity PCR (polymerase chain reaction) identification method thereof |
| CN106868137A (en) * | 2017-03-01 | 2017-06-20 | 浙江省农业科学院 | Transgenic rice multiple digital pcr quantitative detecting method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106636340B (en) | Detection method and reagent for transgenic corn strain VCO-01981-5 | |
| CN102212540A (en) | Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains | |
| CN105255874A (en) | Kit for accurately and quantitatively detecting transgenic maize line T25 and detection method thereof | |
| CN102242219B (en) | Method and pair of special primers for identifying purple properties of Chinese cabbages | |
| CN107236819A (en) | The method of high throughput identification muskmelon purity of hybrid | |
| CN103757038A (en) | Standard molecule suitable for specificity detection of five transgenic soybean strains synchronously | |
| CN102134602B (en) | Primer, probe, test kit and method for testing Xa21 gene modified rice or products thereof | |
| Wu et al. | Event-specific qualitative and quantitative PCR detection methods for transgenic rapeseed hybrids MS1× RF1 and MS1× RF2 | |
| CN101020902B (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application | |
| CN100558902C (en) | Transgene rape exogenous origin gene integrator incident Rf1 exogenous insertion vector flanking sequence and application thereof | |
| CN108456743A (en) | With soybean bloom and maturity period relevant SNP marker and its detection primer, method and application | |
| CN108220473A (en) | It is marked using chloroplaset InDel and differentiates CMS-S maize material | |
| CN107858444A (en) | Transgenic paddy rice G6H1 strain specificity quantitative PCR detecting methods | |
| CN101016554B (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| CN112359098B (en) | Method for detecting content of herbicide-tolerant transgenic soybean J12 by real-time fluorescence quantitative PCR | |
| CN102168103B (en) | Reference molecule for specifically detecting genetically modified rapeseed RT73 and application of reference molecule | |
| CN109055592A (en) | A kind of anti-ring spot virus papaya YK16-0-1 of transgenosis and its efficient qualitative, quantitative identification method of spin-off | |
| CN117230227A (en) | SNP locus closely linked with anthocyanin content of cowpea, KASP (KASP sequence characterized by single nucleotide polymorphism) marker and application of SNP locus | |
| CN100529089C (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Topas-19/2 and its application | |
| KR101820077B1 (en) | Primer, Probe for Detecting a Genetically Modified Resveratrol Synthesis Rice and Detecting Method using the Same | |
| CN107142322A (en) | Transgenic corns MON87403 strain specificities real-time fluorescent PCR testing primer, probe, method and kit | |
| CN105755110A (en) | Qualitative PCR detection kit and method for detecting state of transgenic insect-resistant cotton MON757 transformant in cotton material | |
| CN105755111A (en) | Method for quantitatively detecting content of MON757 transformant in cotton material population | |
| Qin et al. | Assessment of genetic diversity and relationships based on RAPD and AFLP analyses in Miscanthus genera landraces | |
| CN110714093A (en) | SCAR molecular marker related to banana wilt resistance and detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180330 |