CN107827989A

CN107827989A - Target transgenic T cells of myeloma BCMA antigens and preparation method and application

Info

Publication number: CN107827989A
Application number: CN201710991908.7A
Authority: CN
Inventors: 黄昕华; 于丽丽; 生德伟; 徐峰波; 李德柱; 曹启龙
Original assignee: HUBEI YINFENG DINGCHENG BIOLOGY ENGINEERING Co Ltd; Yinfeng Biological Group Ltd
Current assignee: HUBEI YINFENG DINGCHENG BIOLOGY ENGINEERING Co Ltd; Yinfeng Biological Group Ltd
Priority date: 2017-10-18
Filing date: 2017-10-18
Publication date: 2018-03-23

Abstract

The invention discloses a kind of gene for encoding anti-BCMA Chimeric antigen receptors, its nucleotide sequence such as SEQ ID NO:Shown in 2.Disclose one kind and include the gene recombinant vectors.Disclose a kind of transgenic T cells for targetting myeloma BCMA antigens, to be including above-mentioned recombinant expression carrier and knocked out the initial cell of PD1 genes or/and CTLA4 genes, or be integrated with said gene in chromosome and knocked out the initial cell of PD1 genes or/and CTLA4 genes；Its preparation method：GRNA, CRISPR cas9mRNA, HDR mixing, electricity turn restructuring T cell.Application of the transgenic T cells of the targeting myeloma BCMA antigens in the medicine for preparing treatment Huppert's disease.The present invention is in carT structures, EGFR recognition sequence is introduced, EGFR monoclonal antibodies Cetuximab can be used to eliminate carT cells if necessary, and knocked out PD1, CTLA4 gene, its suppression to carT cells is relieved, carT cells is enhanced and overcomes tumor microenvironment to suppress immune cell function.

Description

Target transgenic T cells of myeloma BCMA antigens and preparation method and application

Technical field

The present invention relates to transgenic T cells of targeting myeloma BCMA antigens and preparation method and application.

Background technology

Huppert's disease is a kind of leukemia for betiding marrow, typically by the anti-infective thick liquid cell canceration in marrow after Proliferation out of control causes.Huppert's disease may cause immunity degradation and cause including other problems such as bone and kidney. Global Huppert's disease annual about 114,200 new cases, and 79 are had more than every year, 000 people is therefore dead.It is multiple Property the incidence of disease of the myeloma in China be about ten a ten thousandths to 2/100000ths, American-European countries's incidence of disease is 4/100000ths.

The treatment of Huppert's disease experienced traditional chemotherapy period, HSCT period, until at present Thalidomide, lenalidomide and bortezomib etc. be representative new drug period.Even so, Huppert's disease is in very great Cheng A kind of disease for being difficult to cure is still on degree, only about 45% patient can live through 5 years after making a definite diagnosis.Many patient's pauses The state of an illness can also recur repeatedly after treatment.After recurrence in 5 years of patient survival rate less than 20%.Particularly those are to protease The trouble of body inhibitor (bortezomib and Carfilzomib) and immunomodulator (lenalidomide, Thalidomide and pomalidomide) resistance Person's poor prognosis.In no Carfilzomib and the epoch of pomalidomide, the expection always existence of these patients only 9 months.FDA exists It has approved a kind of monoclonal antibody treatment MM in December, 2015, target CD38.Another monoclonal antibody targeting CS1 complete random, open label, The clinical trial phase of multicenter 2.Anti-CD38 daratumumab treat responsiveness 82.9%, and control drug group is 63.2%；In Position is 9.3 months without disease life cycle, and control drug group is 6.5 months.Anti-CS1 elotuzumab treat responsiveness 79%, right It is 66% according to medicine group；Middle position is 19.4 months without disease life cycle, and control drug group is 14.9 months.

In December, 2015, U.S. James N.Kochenderfer, MD report, the carT clinical tests 12 for targetting BCMA are suffered from Person, 2CR, 1VGPR, 1PR, 5SD.Used in view of dosage, for the therapy in 9x10e6 per kg, curative effect might have 80% CR above.

In December, 2016, Bluebird companies report, target the BCMA patient of carT clinical tests 11, and low dosage occurs 1 There are 2 patient CR, 1 patient VGPR, 3 patient PR in patient PR, high dose.

The general principle Chimeric antigen receptor T cell (CAR-T cells) of car T technologies is to identify certain tumour antigen Antigen-binding portion and the CD3- ζ chains of antibody or Fc ε RI γ intracellular part be coupled in vitro as a chimeric protein, pass through base Because the method for transduction transfects the T cell of patient, it is set to express Chimeric antigen receptor (CAR).The T cell of patient is by " recodification " Afterwards, the specific CAR-T cells of massive tumor are generated.

First generation CAR by identification tumor surface antigen single-chain antibody (single chain fragment variable, ) and ITAM (immunoreceptor tyrosine-based activation scFv Motifs, ITAM, usually CD3- ζ and Fc ε RI γ) composition.The experiment of early stage demonstrates CAR-T feasibility, but first For CAR of short duration T cell can only be caused to rise in value and relatively low cytokine secretion, it is impossible to provide prolonged T cell amplification letter Number and continue inside GVT.

According to the dual signal theory of T cell activation, the activation of T cell and propagation need costimulatory signal；The second generation, the 3rd Costimulatory molecules signal sequence (costimulatory molecule, CM) is introduced for CAR, it is intended to improves the cell of T cell Cytotoxic activity, proliferative and time-to-live, promote the release of cell factor.Existing 2nd generation carT cell culture technologies both at home and abroad, Similar technology path is substantially followed, i.e., after peripheral blood mononuclear cells are separated, after starting is cultivated 1~2 day, transfection is inverse Retroviral (retroviral), or slow virus (lentiviral), or the gene table that transposons (transponson) is carrier Up to Chimeric antigen receptor (chimeric antigenreceptor, car) molecule, add costimulation factor (growth factor such as IL2, Auxiliary with CD3CD28 antibody, or cell line of antigen presentation etc.) culture 7~30 days after, feed back patient.

The as shown by data of American-European a small amount of clinical test, existing BCMA chimeric antigen receptor T (car T) technology, the objective cure rate of Huppert's disease (objective response, OBB) is treated up to 50% or so.It is also existing Clinical deficiency is as follows：

1st, patient needs to guard closely over the course for the treatment of, there is the CRS of moderate, and it is several times in normal to dominate one of reason Horizontal serum IL 6.American-European clinic has relatively good processing scheme to this, and mainly IL6R monoclonal antibodies or heavy dose of steroids swashs Element；

2nd, treated effect is less than the complete cure rates of typical CD19 carT 70-90%, and effective percentage has much room for improvement, needed In the suppression for overcoming tumor microenvironment；

3rd, after treating successfully, patient's body long-term lacking generates the thick liquid cell of antibody, thus must injection one in every 2~3 weeks Secondary immunoglobulin is to keep that demand is immunized substantially；

4th, in therapeutic process, some patientss lose carT cells.

The content of the invention

For above-mentioned prior art, the invention provides a kind of transgenic T cells for targetting myeloma BCMA antigens, and its Preparation method.The present invention introduces EGFR recognition sequence, can use EGFR monoclonal antibodies Cetuximab if necessary in carT structures CarT cells are eliminated, and have knocked out PD1, CTLA4 gene, its suppression to carT cells is relieved, enhances carT cells Tumor microenvironment is overcome to suppress immune cell function.

The present invention is achieved by the following technical solutions：

A kind of anti-BCMA Chimeric antigen receptors, its amino acid sequence such as SEQ ID NO:Shown in 1, including following cis series connection Domain：The hinge region and transmembrane region of scFv fragments BCMAscFv, CD27 of anti-BCMA antibody, CD28 intracellular signal structure Domain, 4-1BB intracellular signal domain, CD3 ζ intracellular signal domain, T2A and EGFRt antigens.

A kind of gene for encoding above-mentioned anti-BCMA Chimeric antigen receptors, its nucleotide sequence such as SEQ ID NO:Shown in 2；Its Structure is：Anti-BCMA scFv-CD27 Hinge-TM-CD28-41BB-CD3zeta, including be sequentially connected in series scFc sequences, Costimulation sequence in the outer sequence of CD27 cross-films sequence and film, CD28 recipient cells, be costimulation sequence in 4-1BB recipient cells, CD3zeta sequences, T2A sequences, EGFRt recognition sequence (after the cDNA sequence splicing of these sequences, it is excellent to make codon with software Change, to be suitable for human cell's expression, eliminate some restriction enzyme enzyme sequences, eliminate potential strong secondary structure, go Except GC or AT compact districts, SEQ ID NO are obtained:Sequence shown in 2).

A kind of recombinant expression carrier, be Lentiviral, retrovirus expression vector, adenovirus expression carrier, Glandular associated virus expression vector or plasmid, it includes the gene of the anti-BCMA Chimeric antigen receptors of above-mentioned coding.The recombination expression The construction method of carrier, it is conventional method.

It is a kind of target myeloma BCMA antigens transgenic T cells, for include above-mentioned recombinant expression carrier and knock out The initial cell of PD1 genes or/and CTLA4 genes, or it is integrated with the base of above-mentioned anti-BCMA Chimeric antigen receptors in chromosome Cause and knocked out the initial cell of PD1 genes or/and CTLA4 genes, the initial cell is that CD4+T cells or CD8+T are thin Born of the same parents.

A kind of preparation method for the transgenic T cells for targetting myeloma BCMA antigens：gRNA、CRISPR-cas9 mRNA、 HDR is mixed, and electricity turns restructuring T cell (400V, 0.5ms), produces；The gRNA is the gRNA or targeting CTLA4 of targeting PD1 genes The gRNA of gene, the HDR are the HDR of the HDR or CTLA4 genes of PD1 genes；

The restructuring T cell, to include the initial cell of above-mentioned recombinant expression carrier, or it is integrated with chromosome above-mentioned The initial cell of the gene of anti-BCMA Chimeric antigen receptors (the restructuring T cell, can be obtained by the method for routine：Structure group table Up to after carrier, slow-virus transfection is i.e. available), the initial cell is CD4+T cells or CD8+T cells.

The CRISPR-cas9mRNA, obtained by in-vitro transcription spCas9-2.0.SpCas9(BB)-2A-Puro (PX459) V2.0 (abbreviation spCas9-2.0) is existing sequence in the prior art, is issued by Zhang Feng (ZhangFeng), its Nucleotide sequence such as SEQ ID NO：(sequence show corresponding DNA sequence dna) shown in 3；Clone spCas9-2.0 cas9 The mRNA of albumen, it is cloned into pUC19 plasmids, by vitro transcriptions and 5 ' cappings, ripe mRNA is formed, for thin Dysuria with lower abdominal colic contaminates.

The gRNA of the targeting PD1 genes, its nucleotide sequence such as SEQ ID NO：(sequence show corresponding shown in 4 DNA sequence dna).

The gRNA of the targeting CTLA4 genes, its nucleotide sequence such as SEQ ID NO：(sequence is shown relatively shown in 5 The DNA sequence dna answered).

The HDR of the PD1 genes, its nucleotide sequence such as SEQ ID NO：Shown in 6.

The HDR of the CTLA4 genes, its nucleotide sequence such as SEQ ID NO：Shown in 7.

Transgenic T cells the answering in the medicine for preparing treatment Huppert's disease of the targeting myeloma BCMA antigens With.

Technical scheme, 1 and 3 the problem of in background technology, the present invention proposes to use EGFR monoclonal antibodies if necessary Cetuximab eliminates carT cells, therefore, in carT structures, introduces EGFR recognition sequence.For in background technology Problem 2, the method for this special invention proposition gene editing, knocking out PD1, CTLA4 gene, (two kinds of genes knock out respectively, unsuitable same When knock out, reason is：1st, the efficiency of gene knockout is low, and two kinds of efficiency when knocking out simultaneously are lower；2nd, PD1, CTLA4 gene are respectively positioned on No. 2 chromosomes, while knock out and be possible to that chromosome large fragment deletion can be caused), the suppression to carT cells is released, strengthens carT Cell overcomes tumor microenvironment to suppress immune cell function.The problem of in background technology 3, the present invention propose to use EGFR monoclonal antibodies Cetuximab eliminates carT cells.The problem of in background technology 4, present invention improves over BCMA carT culture process.

Brief description of the drawings

Fig. 1：Slow virus carrier builds sketch.

Fig. 2：The design drawing of car molecules and attached selection markers.

Fig. 3：Short-term growth curves of the BCMA carT of various structures after K562-BCMA cell line cultures.

Fig. 4：Killing activities of the BCMA carT of various structures to K562-BCMA cell lines.

Fig. 5：AP1903 molecules induce the BCMA carT programmed cell death figures of various structures.

Fig. 6：Cetuximab induces BCMA carT cytotoxicities (cytotoxicity) figure of various structures.

Embodiment

With reference to embodiment, the present invention is further illustrated.

Involved instrument, reagent, material etc. in following embodiments, it is existing in the prior art unless otherwise noted Conventional instrument, reagent, material etc., can be obtained by regular commercial sources.Involved experimental method in following embodiments, inspection Survey method etc., it is existing normal experiment method, detection method etc. in the prior art unless otherwise noted.

Embodiment 1 builds slow virus carrier

Slow virus carrier structure sketch is as shown in Figure 1.

The design of car molecules and attached selection markers is as shown in Figure 2.

Constructed car molecules, its nucleotide sequence such as SEQ ID NO:Shown in 2.

Slow virus is coated with：For conventional method.Briefly, 293T cells are cultivated with RPMI1640+10%FBS, treats cell After 90% density, with lipo2000 mixing transfected plasmids, 293T cells are transfected, after harvesting slow virus, centrifugal concentrating.Plasmid transfection The method of 293T cells according to the lipofactamine 2000 of Invitrogen manufacturers reagent guide.Plasmid has：Slow virus Expression plasmid, helper plasmid 3 kinds (pMDLg/pRRE, pRSV-Rev, pMD2.G), the molar ratio for mixing plasmid are 2:1:1: 0.5.After transfection 24~48 hours, the supernatant containing slow virus is harvested；Add Clontech Lenti-X concentrator, mix 1500g after conjunction, 4C centrifuge 45min, remove supernatant, slow virus precipitation are obtained, for subsequent experimental.

Embodiment 2 is cultivated and slow-virus transfection T cell

The peripheral blood of Healthy People or tumor patient extracts 50~100ml, or with Cobra Spectra blood cell separators Mononuclearcell is obtained, after Ficoll is separated, (magnetic bead is purchased from Stem Cell with CD4+ or CD8+ magnetic bead sortings Technologies companies).(culture medium prescription after T cell use is cultivated 1 day：Lonza X vivo15, adult serum 10%, IL2300-500IU/ml, penicillin (100units/ml) and streptomycin (100 μ g/ml), with AntiCD3 McAb CD28 Magnetic bead (with T cell 1:3 mixing) culture 24 hours after, infect slow virus.

Slow-virus infection people's CD4+T or CD8+T cell：Slow-virus infection after preparing and concentrating refers to Takara Retronectin specifications, are briefly described as follows：

The μ g/ml of Retronectin concentration 20~100 are prepared, bed board is 4~20 μ g/cm using density², room temperature 2 hours Afterwards, it is standby to suck supernatant；The above-mentioned μ l/cm of plate 125~250 are added to slow virus², 37C warm bath 4~6 hours；T cell to be infected With density 0.5~2.5 × 10⁴cells/cm²Bed board.T cell changes liquid after infecting 24 hours.

Stimulate BCMA carT cell growths 8~12 days, keep cell concentration 1~2 × 10⁶cells/ml.Then sort BCMA carT performance.

Embodiment 3 knocks out PD1 genes, CTLA4 genes

Electrotransfection CRISPR-cas9 carries out the gene editing of T cell, carries out knocking out PD1 genes, CTLA4 genes respectively Experiment, concrete mode are as follows：

CRISPR-cas9mRNA, gRNA the mixing HDR synthesized in vitro, electricity turn T cell (400V, 0.5ms).Cell exists Lonza X vivo15, adult serum 10%, after IL2300-500IU/ml is cultivated 3 days, harvest genomic DNA.Then do Genomic PCR (primer of targeting PD1 exon2 near zones, Forward：TTCCTCACCTCTCTCCATCTC； Reverse：CTCTCTTTGATCTGCGCCTT, such as SEQ ID NO：8、SEQ ID NO：Shown in 9.The exon2 for targetting CTLA4 is attached The primer of near field：Forward：TGAGTTCACTGAGTTCCCTTTG；Reverse：GAAATGGCTTTGCTCACCAATTA, Such as SEQ ID NO：10、SEQ ID NO：Shown in 11), after Agarose glue purifications, TA clones are carried out, are surveyed after purification of individual clone Sequence obtains Indel abrupt informations, calculates the information of mutation and non-mutated sequence, gene editing efficiency PD1：13.5%, CTLA4： 15.1%.

The CRISPR-cas9mRNA nucleotide sequences such as SEQ ID NO：Shown in 3；

When knocking out PD1 genes, the gRNA, nucleotide sequence such as SEQ ID NO of PD1 genes are targetted：Shown in 4；PD1 genes HDR nucleotide sequences such as SEQ ID NO：Shown in 6；

When knocking out CTLA4 genes, the gRNA, nucleotide sequence such as SEQ ID NO of CTLA4 genes are targetted：Shown in 5；CTLA4 The HDR nucleotide sequences of gene such as SEQ ID NO：Shown in 7.

The BCMA carT of embodiment 4 cell Performance Testing

Fig. 3：Short-term growth curves of the BCMA carT of various structures after K562-BCMA cell line cultures.Culture completely Base is Lonza X vivo15, adult serum 10%, IL2300-500IU/ml.Each group is：BCMA car T (car molecules Structure is free of CD28-41BB costimulations sequence)；BCMA car T (car molecule constructions are free of CD28 costimulations sequence)；BCMA Car T (car molecule constructions are free of 41BB costimulations sequence)；BCMA car T (car molecule constructions costimulations containing CD28-41BB Sequence).BCMA car T (sequence of costimulation containing CD28-41BB) visible by Fig. 3, that the present invention is built, positive effect is better than Other, there were significant differences.

Fig. 4：Killing activities of the BCMA carT of various structures to K562-BCMA cell lines.Complete medium is Lonza X vivo15, adult serum 10%, IL2300-500IU/ml.3 each groups are：(car acceptors are total to BCMA car T containing CD28 Stimulus sequence)；BCMA car T (car acceptors structure costimulation containing 41BB sequence)；(car acceptors contain CD28- to BCMA car T 41BB costimulations sequence).

Fig. 5：AP1903 molecules induce the BCMA carT programmed cell death figures of various structures.Complete medium is Lonza X Vivo15, adult serum 10%, IL2300-500IU/ml.In in vitro culture ware, the molecules of 5nMAP 1903 are added in the medium Afterwards, programmed cell death is entered in the BCMAcarT cells short time, competent cell quantity declines.Each group is：Carrier GFP feminine genders are right According to；BCMA car T (car receptor extracellular regions sequence containing CD27)；BCMA car T (car receptor extracellular regions sequence containing CD8).

Fig. 6：Cetuximab induces BCMA carT cytotoxicities (cytotoxicity) figure of various structures.Culture completely Base is Lonza X vivo15, non-heat-inactivated adult serum 10%, IL2300-500IU/ml.In in vitro culture ware, cultivating Enter programmed cell death after adding 1000ng/mlCetuximab in base, in the BCMAcarT cell short time, under competent cell quantity Drop.Each group is：Carrier GFP negative controls；BCMA car T (car acceptors sequence containing CD28)；BCMA car T (car by Body sequence containing CD28-41BB).

Sequence table

<110>The rich bioengineering group Co., Ltd of silver

Yin Feng Ding Cheng bioengineering Co., Ltd of Hubei Province

<120>Target transgenosis T cells of myeloma BCMA antigens and preparation method and application

<141> 2017-10-18

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 932

<212> PRT

<213> Artificial Sequence

<400> 1

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Glu Gln Ile Gln Leu Val Gln Ser Gly Pro

20 25 30

Glu Leu Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser

35 40 45

Gly Tyr Thr Phe Thr Asp Tyr Ser Ile Asn Trp Val Lys Arg Ala Pro

50 55 60

Gly Lys Gly Leu Lys Trp Met Gly Trp Ile Asn Thr Glu Thr Arg Glu

65 70 75 80

Pro Ala Tyr Ala Tyr Asp Phe Arg Gly Arg Phe Ala Phe Ser Leu Glu

85 90 95

Thr Ser Ala Ser Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Tyr Glu

100 105 110

Asp Thr Ala Thr Tyr Phe Cys Ala Leu Asp Tyr Ser Tyr Ala Met Asp

115 120 125

Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly

130 135 140

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Leu Thr

145 150 155 160

Gln Ser Pro Pro Ser Leu Ala Met Ser Leu Gly Lys Arg Ala Thr Ile

165 170 175

Ser Cys Arg Ala Ser Glu Ser Val Thr Ile Leu Gly Ser His Leu Ile

180 185 190

His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Thr Leu Leu Ile Gln

195 200 205

Leu Ala Ser Asn Val Gln Thr Gly Val Pro Ala Arg Phe Ser Gly Ser

210 215 220

Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asp Pro Val Glu Glu Asp

225 230 235 240

Asp Val Ala Val Tyr Tyr Cys Leu Gln Ser Arg Thr Ile Pro Arg Thr

245 250 255

Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser Pro

260 265 270

Thr His Leu Pro Tyr Val Ser Glu Met Leu Glu Ala Arg Thr Ala Gly

275 280 285

His Met Gln Thr Leu Ala Asp Phe Arg Gln Leu Pro Ala Arg Thr Leu

290 295 300

Ser Thr His Trp Pro Pro Gln Arg Ser Leu Gly Ser Ser Asp Phe Ile

305 310 315 320

Arg Ile Leu Val Ile Phe Ser Gly Met Phe Leu Val Phe Thr Leu Ala

325 330 335

Gly Ala Leu Phe Leu His Gln Arg Ser Lys Arg Ser Arg Gly Gly His

340 345 350

Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys

355 360 365

His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser

370 375 380

Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln

385 390 395 400

Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser

405 410 415

Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys

420 425 430

Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln

435 440 445

Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu

450 455 460

Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg

465 470 475 480

Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met

485 490 495

Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly

500 505 510

Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp

515 520 525

Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Glu Gly Arg

530 535 540

Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Ala

545 550 555 560

Cys Gly Ala Asp Ser Tyr Glu Met Glu Glu Asp Gly Val Arg Lys Cys

565 570 575

Lys Lys Cys Glu Gly Pro Cys Arg Lys Val Cys Asn Gly Ile Gly Ile

580 585 590

Gly Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His

595 600 605

Phe Lys Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val

610 615 620

Ala Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln

625 630 635 640

Glu Leu Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu

645 650 655

Ile Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn

660 665 670

Leu Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu

675 680 685

Ala Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys

690 695 700

Glu Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys

705 710 715 720

Tyr Ala Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln

725 730 735

Lys Thr Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr

740 745 750

Gly Gln Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro

755 760 765

Glu Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu

770 775 780

Cys Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val

785 790 795 800

Glu Asn Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala

805 810 815

Met Asn Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys

820 825 830

Ala His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly

835 840 845

Val Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly

850 855 860

His Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly

865 870 875 880

Pro Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro Ser Ile

885 890 895

Ala Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu

900 905 910

Gly Ile Gly Leu Phe Met Arg Arg Arg His Ile Val Arg Lys Arg Thr

915 920 925

Leu Arg Arg Leu

930

<210> 2

<211> 2781

<212> DNA

<213> Artificial Sequence

<400> 2

atgctgctgt tggtcacatc tttgttgctc tgtgaacttc cgcatccggc attccttctc 60

attcctgagc aaattcagct tgttcaaagt ggcccagaac tgaagaaacc cggggaaacc 120

gtgaagatta gttgcaaagc gagtggttat acgttcacgg attattccat aaactgggtg 180

aagcgagcgc cgggcaaggg tcttaaatgg atgggctgga ttaacacaga aacccgggaa 240

cctgcctatg cgtatgattt tagagggcga tttgcgtttt ctcttgagac atcagcaagc 300

acggcctact tgcagataaa caacctcaag tacgaagata ccgcaacata cttttgtgct 360

ttggattact catatgcgat ggattattgg ggtcagggaa caagtgtcac ggtgagtagc 420

ggcggagggg gatctggtgg cggaggttcc ggcggagggg gatctgacat agtccttacc 480

cagagtccac cttccctggc tatgtccctc gggaaaagag cgaccatcag ctgtagagcg 540

agtgagtcag tcaccattct cggcagtcat ttgatccact ggtatcagca aaagcccgga 600

cagccaccga ctttgctgat ccaactggcc tccaatgtcc aaacaggtgt gcccgcccgg 660

tttagcggat cagggtcccg gacagacttt acattgacga tagaccctgt cgaggaagat 720

gacgtagcgg tatactattg tctccagtca agaacgatcc cacgcacatt cggcggtgga 780

actaaactcg agataaaagg cgggggaggt tcaccgacac acctgccgta cgtttctgaa 840

atgctggagg ctcgcactgc tggccacatg cagaccctcg ctgactttag gcaactgcca 900

gcacggaccc tcagcaccca ctggcctcca cagcggagtc ttggctcaag tgactttatc 960

aggatactcg tgatattttc aggcatgttt ttggttttta ctctcgcggg tgcactcttt 1020

ctgcatcaac ggagcaaaag gtctagggga gggcacagcg attacatgaa catgactcct 1080

cggcggccag ggccgacacg caagcactac caaccctatg cgccgccgag agattttgcg 1140

gcttaccgct caagtgtcgt taaaaggggt cgaaaaaagc tgctgtatat attcaaacaa 1200

cccttcatga gaccagtcca aaccacgcaa gaggaggatg ggtgttcctg tcgatttcct 1260

gaagaggaag aaggagggtg cgaacttagg gtaaaattca gccgatccgc tgatgcccct 1320

gcgtaccaac aaggacagaa ccagctgtat aacgagctca acctgggccg gagggaagaa 1380

tacgacgtct tggataaaag acgcgggcgg gaccccgaaa tggggggaaa gccgaggcga 1440

aaaaatcctc aggagggttt gtacaacgaa cttcaaaaag acaagatggc cgaggcctat 1500

tccgagatag ggatgaaagg agagcggcgc cgagggaaag gtcacgacgg gctgtaccaa 1560

ggtctgtcaa ctgcaaccaa ggatacctat gacgcccttc atatgcaggc cttgcctcct 1620

agagagggca gaggcagcct gctgacctgc ggcgacgtgg aggagaaccc cggccccatg 1680

gcctgtgggg ccgacagcta tgagatggag gaagacggcg tccgcaagtg taagaagtgc 1740

gaagggcctt gccgcaaagt gtgtaacgga ataggtattg gtgaatttaa agactcactc 1800

tccataaatg ctacgaatat taaacacttc aaaaactgca cctccatcag tggcgatctc 1860

cacatcctgc cggtggcatt taggggtgac tccttcacac atactcctcc tctggatcca 1920

caggaactgg atattctgaa aaccgtaaag gaaatcacag ggtttttgct gattcaggct 1980

tggcctgaaa acaggacgga cctccatgcc tttgagaacc tagaaatcat acgcggcagg 2040

accaagcaac atggtcagtt ttctcttgca gtcgtcagcc tgaacataac atccttggga 2100

ttacgctccc tcaaggagat aagtgatgga gatgtgataa tttcaggaaa caaaaatttg 2160

tgctatgcaa atacaataaa ctggaaaaaa ctgtttggga cctccggtca gaaaaccaaa 2220

attataagca acagaggtga aaacagctgc aaggccacag gccaggtctg ccatgccttg 2280

tgctcccccg agggctgctg gggcccggag cccagggact gcgtctcttg ccggaatgtc 2340

agccgaggca gggaatgcgt ggacaagtgc aaccttctgg agggtgagcc aagggagttt 2400

gtggagaact ctgagtgcat acagtgccac ccagagtgcc tgcctcaggc catgaacatc 2460

acctgcacag gacggggacc agacaactgt atccagtgtg cccactacat tgacggcccc 2520

cactgcgtca agacctgccc ggcaggagtc atgggagaaa acaacaccct ggtctggaag 2580

tacgcagacg ccggccatgt gtgccacctg tgccatccaa actgcaccta cggatgcact 2640

gggccaggtc ttgaaggctg tccaacgaat gggcctaaga tcccgtccat cgccactggg 2700

atggtggggg ccctcctctt gctgctggtg gtggccctgg ggatcggcct cttcatgcga 2760

aggcgccaca tcgtttgata a 2781

<210> 3

<211> 4869

<212> DNA

<213> Artificial Sequence

<400> 3

atggccccaa agaagaagcg gaaggtcggt atccacggag tcccagcagc cgacaagaag 60

tacagcatcg gcctggacat cggcaccaac tctgtgggct gggccgtgat caccgacgag 120

tacaaggtgc ccagcaagaa attcaaggtg ctgggcaaca ccgaccggca cagcatcaag 180

aagaacctga tcggagccct gctgttcgac agcggcgaaa cagccgaggc cacccggctg 240

aagagaaccg ccagaagaag atacaccaga cggaagaacc ggatctgcta tctgcaagag 300

atcttcagca acgagatggc caaggtggac gacagcttct tccacagact ggaagagtcc 360

ttcctggtgg aagaggataa gaagcacgag cggcacccca tcttcggcaa catcgtggac 420

gaggtggcct accacgagaa gtaccccacc atctaccacc tgagaaagaa actggtggac 480

agcaccgaca aggccgacct gcggctgatc tatctggccc tggcccacat gatcaagttc 540

cggggccact tcctgatcga gggcgacctg aaccccgaca acagcgacgt ggacaagctg 600

ttcatccagc tggtgcagac ctacaaccag ctgttcgagg aaaaccccat caacgccagc 660

ggcgtggacg ccaaggccat cctgtctgcc agactgagca agagcagacg gctggaaaat 720

ctgatcgccc agctgcccgg cgagaagaag aatggcctgt tcggaaacct gattgccctg 780

agcctgggcc tgacccccaa cttcaagagc aacttcgacc tggccgagga tgccaaactg 840

cagctgagca aggacaccta cgacgacgac ctggacaacc tgctggccca gatcggcgac 900

cagtacgccg acctgtttct ggccgccaag aacctgtccg acgccatcct gctgagcgac 960

atcctgagag tgaacaccga gatcaccaag gcccccctga gcgcctctat gatcaagaga 1020

tacgacgagc accaccagga cctgaccctg ctgaaagctc tcgtgcggca gcagctgcct 1080

gagaagtaca aagagatttt cttcgaccag agcaagaacg gctacgccgg ctacattgac 1140

ggcggagcca gccaggaaga gttctacaag ttcatcaagc ccatcctgga aaagatggac 1200

ggcaccgagg aactgctcgt gaagctgaac agagaggacc tgctgcggaa gcagcggacc 1260

ttcgacaacg gcagcatccc ccaccagatc cacctgggag agctgcacgc cattctgcgg 1320

cggcaggaag atttttaccc attcctgaag gacaaccggg aaaagatcga gaagatcctg 1380

accttccgca tcccctacta cgtgggccct ctggccaggg gaaacagcag attcgcctgg 1440

atgaccagaa agagcgagga aaccatcacc ccctggaact tcgaggaagt ggtggacaag 1500

ggcgcttccg cccagagctt catcgagcgg atgaccaact tcgataagaa cctgcccaac 1560

gagaaggtgc tgcccaagca cagcctgctg tacgagtact tcaccgtgta taacgagctg 1620

accaaagtga aatacgtgac cgagggaatg agaaagcccg ccttcctgag cggcgagcag 1680

aaaaaggcca tcgtggacct gctgttcaag accaaccgga aagtgaccgt gaagcagctg 1740

aaagaggact acttcaagaa aatcgagtgc ttcgactccg tggaaatctc cggcgtggaa 1800

gatcggttca acgcctccct gggcacatac cacgatctgc tgaaaattat caaggacaag 1860

gacttcctgg acaatgagga aaacgaggac attctggaag atatcgtgct gaccctgaca 1920

ctgtttgagg acagagagat gatcgaggaa cggctgaaaa cctatgccca cctgttcgac 1980

gacaaagtga tgaagcagct gaagcggcgg agatacaccg gctggggcag gctgagccgg 2040

aagctgatca acggcatccg ggacaagcag tccggcaaga caatcctgga tttcctgaag 2100

tccgacggct tcgccaacag aaacttcatg cagctgatcc acgacgacag cctgaccttt 2160

aaagaggaca tccagaaagc ccaggtgtcc ggccagggcg atagcctgca cgagcacatt 2220

gccaatctgg ccggcagccc cgccattaag aagggcatcc tgcagacagt gaaggtggtg 2280

gacgagctcg tgaaagtgat gggccggcac aagcccgaga acatcgtgat cgaaatggcc 2340

agagagaacc agaccaccca gaagggacag aagaacagcc gcgagagaat gaagcggatc 2400

gaagagggca tcaaagagct gggcagccag atcctgaaag aacaccccgt ggaaaacacc 2460

cagctgcaga acgagaagct gtacctgtac tacctgcaga atgggcggga tatgtacgtg 2520

gaccaggaac tggacatcaa ccggctgtcc gactacgatg tggaccatat cgtgcctcag 2580

agctttctga aggacgactc catcgacaac aaggtgctga ccagaagcga caagaaccgg 2640

ggcaagagcg acaacgtgcc ctccgaagag gtcgtgaaga agatgaagaa ctactggcgg 2700

cagctgctga acgccaagct gattacccag agaaagttcg acaatctgac caaggccgag 2760

agaggcggcc tgagcgaact ggataaggcc ggcttcatca agagacagct ggtggaaacc 2820

cggcagatca caaagcacgt ggcacagatc ctggactccc ggatgaacac taagtacgac 2880

gagaatgaca agctgatccg ggaagtgaaa gtgatcaccc tgaagtccaa gctggtgtcc 2940

gatttccgga aggatttcca gttttacaaa gtgcgcgaga tcaacaacta ccaccacgcc 3000

cacgacgcct acctgaacgc cgtcgtggga accgccctga tcaaaaagta ccctaagctg 3060

gaaagcgagt tcgtgtacgg cgactacaag gtgtacgacg tgcggaagat gatcgccaag 3120

agcgagcagg aaatcggcaa ggctaccgcc aagtacttct tctacagcaa catcatgaac 3180

tttttcaaga ccgagattac cctggccaac ggcgagatcc ggaagcggcc tctgatcgag 3240

acaaacggcg aaaccgggga gatcgtgtgg gataagggcc gggattttgc caccgtgcgg 3300

aaagtgctga gcatgcccca agtgaatatc gtgaaaaaga ccgaggtgca gacaggcggc 3360

ttcagcaaag agtctatcct gcccaagagg aacagcgata agctgatcgc cagaaagaag 3420

gactgggacc ctaagaagta cggcggcttc gacagcccca ccgtggccta ttctgtgctg 3480

gtggtggcca aagtggaaaa gggcaagtcc aagaaactga agagtgtgaa agagctgctg 3540

gggatcacca tcatggaaag aagcagcttc gagaagaatc ccatcgactt tctggaagcc 3600

aagggctaca aagaagtgaa aaaggacctg atcatcaagc tgcctaagta ctccctgttc 3660

gagctggaaa acggccggaa gagaatgctg gcctctgccg gcgaactgca gaagggaaac 3720

gaactggccc tgccctccaa atatgtgaac ttcctgtacc tggccagcca ctatgagaag 3780

ctgaagggct cccccgagga taatgagcag aaacagctgt ttgtggaaca gcacaagcac 3840

tacctggacg agatcatcga gcagatcagc gagttctcca agagagtgat cctggccgac 3900

gctaatctgg acaaagtgct gtccgcctac aacaagcacc gggataagcc catcagagag 3960

caggccgaga atatcatcca cctgtttacc ctgaccaatc tgggagcccc tgccgccttc 4020

aagtactttg acaccaccat cgaccggaag aggtacacca gcaccaaaga ggtgctggac 4080

gccaccctga tccaccagag catcaccggc ctgtacgaga cacggatcga cctgtctcag 4140

ctgggaggcg acaaaaggcc ggcggccacg aaaaaggccg gccaggcaaa aaagaaaaag 4200

gaattcggca gtggagaggg cagaggaagt ctgctaacat gcggtgacgt cgaggagaat 4260

cctggcccaa tgaccgagta caagcccacg gtgcgcctcg ccacccgcga cgacgtcccc 4320

agggccgtac gcaccctcgc cgccgcgttc gccgactacc ccgccacgcg ccacaccgtc 4380

gatccggacc gccacatcga gcgggtcacc gagctgcaag aactcttcct cacgcgcgtc 4440

gggctcgaca tcggcaaggt gtgggtcgcg gacgacggcg ccgcggtggc ggtctggacc 4500

acgccggaga gcgtcgaagc gggggcggtg ttcgccgaga tcggcccgcg catggccgag 4560

ttgagcggtt cccggctggc cgcgcagcaa cagatggaag gcctcctggc gccgcaccgg 4620

cccaaggagc ccgcgtggtt cctggccacc gtcggagtct cgcccgacca ccagggcaag 4680

ggtctgggca gcgccgtcgt gctccccgga gtggaggcgg ccgagcgcgc cggggtgccc 4740

gccttcctgg agacctccgc gccccgcaac ctccccttct acgagcggct cggcttcacc 4800

gtcaccgccg acgtcgaggt gcccgaagga ccgcgcacct ggtgcatgac ccgcaagccc 4860

ggtgcctga 4869

<210> 4

<211> 98

<212> DNA

<213> Artificial Sequence

<400> 4

gcggagagct tcgtgctaaa cgttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgct 98

<210> 5

<211> 98

<212> DNA

<213> Artificial Sequence

<400> 5

ggtgcggcaa cctacatgat ggttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgct 98

<210> 6

<211> 100

<212> DNA

<213> Artificial Sequence

<400> 6

aacgccacct tcacctgcag cttctccaac acatcggaga gcttcgtgtg ataatggtac 60

cgcatgagcc ccagcaacca gacggacaag ctggccgctt 100

<210> 7

<211> 99

<212> DNA

<213> Artificial Sequence

<400> 7

caggctgaca gccaggtgac tgaagtctgt gcggcaacct acatgtgata aaatgagttg 60

accttcctag atgattccat ctgcacgggc acctccagt 99

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 8

ttcctcacct ctctccatct c 21

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

ctctctttga tctgcgcctt 20

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 10

tgagttcact gagttccctt tg 22

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 11

gaaatggctt tgctcaccaa tta 23

Claims

A kind of 1. anti-BCMA Chimeric antigen receptors, it is characterised in that：Its amino acid sequence such as SEQ ID NO:Shown in 1.
2. anti-BCMA Chimeric antigen receptors according to claim 1, it is characterised in that：Its structure is：Including following cis The domain of series connection：Hinge region and transmembrane region, the CD28 intracellular signal of scFv fragments BCMAscFv, CD27 of anti-BCMA antibody Domain, 4-1BB intracellular signal domain, CD3 ζ intracellular signal domain, T2A and EGFRt antigens.
A kind of 3. gene for encoding the anti-BCMA Chimeric antigen receptors described in claim 1 or 2, it is characterised in that：Its nucleotides Sequence such as SEQ ID NO:Shown in 2.
4. the gene of the anti-BCMA Chimeric antigen receptors of coding according to claim 3, it is characterised in that：Its structure is： Anti-BCMA scFv-CD27Hinge-TM-CD28-41BB-CD3zeta, including scFc sequences, the CD27 cross-films being sequentially connected in series Costimulation sequence in the outer sequence of sequence and film, CD28 recipient cells, it is costimulation sequence in 4-1BB recipient cells, CD3zeta sequences Row, T2A sequences, EGFRt recognition sequence.
5. a kind of recombinant expression carrier, it is Lentiviral, retrovirus expression vector, adenovirus expression carrier, gland Associated virus expression vector or plasmid, it is characterised in that：It includes the anti-BCMA inosculating antibodies of coding described in claim 3 or 4 The gene of original receptor.
A kind of 6. transgenic T cells for targetting myeloma BCMA antigens, it is characterised in that：To include described in claim 5 Recombinant expression carrier and knocked out the initial cell of PD1 genes or/and CTLA4 genes, or integrate that have the right will in chromosome Seek the original that is gene and having knocked out PD1 genes or/and CTLA4 genes of the anti-BCMA Chimeric antigen receptors of coding described in 3 or 4 Beginning cell.
7. the transgenic T cells of targeting myeloma BCMA antigens according to claim 6, it is characterised in that：It is described original Cell is CD4+T cells or CD8+T cells.
8. the preparation method of the transgenic T cells of the targeting myeloma BCMA antigens described in claim 6 or 7, it is characterised in that： GRNA, CRISPR-cas9mRNA, HDR are mixed, and electricity turns restructuring T cell (400V, 0.5ms), produces；

The gRNA be targeting PD1 genes gRNA or target CTLA4 genes gRNA, the HDR be PD1 genes HDR or The HDR of CTLA4 genes；

The restructuring T cell, to include the initial cell of the recombinant expression carrier described in claim 5, or in chromosome it is whole Close the initial cell of the gene for the anti-BCMA Chimeric antigen receptors of coding described in requirement 3 or 4 of having the right.
9. preparation method according to claim 8, it is characterised in that：The CRISPR-cas9mRNA, its nucleotide sequence Such as SEQ ID NO：Shown in 3；

The gRNA of the targeting PD1 genes, its nucleotide sequence such as SEQ ID NO：Shown in 4；

The gRNA of the targeting CTLA4 genes, its nucleotide sequence such as SEQ ID NO：Shown in 5；

The HDR of the PD1 genes, its nucleotide sequence such as SEQ ID NO：Shown in 6；

The HDR of the CTLA4 genes, its nucleotide sequence such as SEQ ID NO：Shown in 7.
10. the transgenic T cells of the targeting myeloma BCMA antigens described in claim 6 or 7 are preparing the multiple marrow for the treatment of Application in the medicine of knurl.