CN107686522A - A kind of identification HLA A2/SLLMWITQC single domain antibody - Google Patents

A kind of identification HLA A2/SLLMWITQC single domain antibody Download PDF

Info

Publication number
CN107686522A
CN107686522A CN201611240366.1A CN201611240366A CN107686522A CN 107686522 A CN107686522 A CN 107686522A CN 201611240366 A CN201611240366 A CN 201611240366A CN 107686522 A CN107686522 A CN 107686522A
Authority
CN
China
Prior art keywords
single domain
seq
domain antibody
sllmwitqc
hla
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201611240366.1A
Other languages
Chinese (zh)
Inventor
吕丽慧
高斌
古明珠
刘莹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHENZHEN BEIKE BIO-TECHNOLOGY Co.,Ltd.
Original Assignee
Tianjin Tian Rui Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Tian Rui Biotechnology Co Ltd filed Critical Tianjin Tian Rui Biotechnology Co Ltd
Priority to CN201611240366.1A priority Critical patent/CN107686522A/en
Priority to PCT/CN2017/118287 priority patent/WO2018121475A1/en
Publication of CN107686522A publication Critical patent/CN107686522A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2833—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention disclose it is a kind of can specific recognition HLA A2/SLLMWITQC single domain antibody, the single domain antibody include with specific recognition act on CDR1, CDR2 and CDR3 amino acid sequence；The single domain antibody can be utilized prepares a variety of fusion proteins and multi-specificity antibody, is with a wide range of applications in biomedical sector.

Description

A kind of identification HLA-A2/SLLMWITQC single domain antibody
Technical field
The invention belongs to immunotherapy of tumors technical field, more particularly to a kind of identification HLA-A2/SLLMWITQC single domain Antibody.
Background technology
Tumour antigen is found and identified, is always an important directions of immunotherapy of tumors.In recent years it is found that a large amount of swollen Knurl related antigen and tumour specific antigen, wherein with tumor-testis antigen (cancer-testisantigen, CT) in tumour Most development potentiality in immunization therapy.CT antigens have the characteristics that：(1) wide expression is in the swollen of mankind's Various Tissues source In tumor tissue；(2) in addition to testis tissue and placenta tissue, hardly express in the normal tissue；(3) assignment of genes gene mapping is dyed in X Body.NY-ESO-1 is a kind of in recent years newfound CT antigens, due to stronger immunogenicity, thus in immunotherapy of tumors Got most of the attention in research.
NY-ESO-1 is initially by Chen (chen YT et al：Cancer J, 208-217,2000) etc. from cancer of the esophagus Found in cDNA expression library it is a kind of there is very strongly immunogenic antigen protein, this albumen has in Several Kinds of Malignancy Expression, but hardly expressed in normal structure.NY-ESO-1 is in different degrees of expression in Various Tissues tumor types.Pass through Immunohistochemical staining (immunohistochemistry, IHC) finds that NY-ESO-1 albumen has high in following tumour Expression frequency：Neuroblastoma (82%), synovial sarcoma (80%), malignant mela noma (46%) and epithelial ovarian cancer (43%).RT-PCR detection displays, NY-ESO-1 mRNA is in prostate cancer, carcinoma of urinary bladder, breast cancer, Huppert's disease and liver There is higher expression in cell cancer, but when many of which is detected by IHC, its expression frequency is relatively low.Also display is had been reported that, includes lung NY-ESO-1 expression frequency is between 20%~40% in cancer, the cancer of the esophagus and uterine cancer cells.
In the melanoma cancer patients that NY-ESO-1 mRNA is positive, 50% patient's body, which exists, is directed to NY- ESO-1 spontaneous humoral immune reaction, and such a immune response is not present in normal human.Separately there is the small portion of studies have shown that Divide in the tumor peripheries blood of patient and can detect NY-ESO-1 high-affinity autoantibody.Its antitumor mechanism may be with its ammonia 157-170 epitope polypeptide is offered relevant by human leucocyte antigen-A2 molecules in base acid sequence, so as to inducing specific CTC and CD+4, CD+8 immune response.Studied based on more than, in the research in terms of tumor biotherapy, NY-ESO-1 antigens Turn into the focus of research again, especially as the TCR of genetic modification, CART, the advantage target spot of TCR sample antibodies, enjoy researcher's Concern.
NY-ESO-1 (157-165, amino acid sequence SLLMWITQC) is HLA-A2 restricted type Dominant Epitopes.Following NY- ESO-1 (157-165, amino acid sequence SLLMWITQC) is abbreviated as HLA-A2/SLLMWITQC.
Robbins research groups feed back the T cell of NY-ESO-1 antigen specific T CR genetic modifications thin to 6 synovial membranes Born of the same parents' sarcoma patients and 11 chromoma patients, as a result 4 synovial cell sarcom patients and 5 chromoma patients obtain Obvious therapeutic effect, include the patient of 2 complete incidence graphs, and obvious adverse reaction occurs for none example.
But also having researcher's discovery, the tumour of some patients remains to escape the killing of immunization therapy.Klippel (Klippel ZK et al：Gene ther, 337-342,2014) etc. find, receiving adopt NY-ESO-1 specific T-cells treatment The chromoma patient of recurrence may be relevant with its internal cell MHC loss again after method, so as to form immunologic escape.This Outside, Sommermeyer (Sommermeyer D et al：Immunol J, 6223-6231,2010) etc. find separate sources TC R affinity and adhesion is also variant, although autologous or allosome HLA-A2 Restricted CTL clonal operators is identical NY- ESO-1 epitopes, but their binding ability and function is distinguishing, and the function and MHCNY-ESO-1-TCR of ctl clone The combination of polymer is uncorrelated.They also found xenogenic origin TCR miss the target reaction risk it is higher, this is for TCR bases Because the clinical practice that the T cell of modification is treated has certain guidance meaning.
(the Schuberth PC et al such as Schuberth：Gene ther, 386-395,2013) face in one of progress In being studied before bed, the specific TCR-T cells of NY-ESO-1 peptides 157-165 are devised, and directly by these improved anti-NY- ESO-1-T1-CD28/CD3 ζ T cells, which are fed back, gives NY-ESO-1 (+) mouse model, finds point of the cell factors such as a large amount of IFN-γs Secrete, can play GVT in vivo and in vitro, there is protective effect to mouse.
Although TCR can identify extracellular antigen can also be identified by antigen process submission to cell surface intracellular antigen, But TCR usually requires to isolate specific α β tcr genes in cloning from T cell, and difficulty is larger, and repeatability is not high.In addition, turn Gene TCR also has the potential potential safety hazard that TCR mispairing is brought, and with endogenous TCR subunits mistake may occur for external source TCR two chains Match somebody with somebody, be combined into new TCR.The TCR of this mispairing can form unknown specificity, may target normal structure, cause serious Graft-versus-host reaction.TCR affinity is improved at present and reduces TCR α β chain mismatch rates has become tcr gene treatment Focus, but also two problems merit attention：The tumor microenvironment of T cell and TCR safety issue.Regulatory T cells, The inhibitory cells in medullary system source and some cell factors can all have an impact to the genetic modification T cell of input, so as to shadow Ring the killing ability of T cell.Autoimmune disease caused by TCR mispairing or excessively high etc. reason of affinity is also very important.
If the antibody molecule of identification MHC polypeptide complexes can be prepared, and express to cell surface, it is possible to which T is thin Born of the same parents are immune and ripe antibody technique is combined, and develop a kind of novel T cell modified therapeutic for having antibody and T cell advantage concurrently Technology.The antibody of this kind of Recognition polypeptide MHC compounds, because having φt cell receptor function, referred to as TCR-like antibody, sometimes Also referred to as TCR-mimic antibody.In order to avoid obscuring, have MHC polypeptide complexes specific by this kind of without exception in this patent Antibody is named as MAR (MHC Antigen Receptor), is echoed with CAR-T and TCR-T phases.MAR is solving transgenosis TCR Technical difficulty while, also remain with TCR specificity and feature, can equally reach the purpose for redirecting T cell.
The content of the invention
Embodiment of the invention discloses that a kind of screening and application of identification HLA-A2/SLLMWITQC single domain antibody, lead to Three-wheel biopanning is crossed, is screened from bacteriophage single domain library and obtains the higher antibody sequence of affinity；To screen obtain it is anti- Body sequence is cloned into protokaryon/carrier for expression of eukaryon, with people source FC amalgamation and expressions, transfection host cell, obtains bivalent antibody again Carry out the checking of external affinity.
In order to solve the above technical problems, the technical solution adopted by the present invention is：
A kind of identification HLA-A2/SLLMWITQC single domain antibody, the amino acid sequence of the single domain antibody include three mutually Mend and determine area, respectively CDR1, CDR2 and CDR3, wherein：
CDR1 is SEQ ID NO.1, and CDR2 is that SEQ ID NO.2, CDR3 are SEQ ID NO.3；
Or CDR1 is SEQ ID NO.4, CDR2 is that SEQ ID NO.5, CDR3 are SEQ ID NO.6；
Or CDR1 is SEQ ID NO.7, CDR2 is that SEQ ID NO.8, CDR3 are SEQ ID NO.9.
Further, above-mentioned single domain antibody is single domain antibodies or heavy chain becomes area or light chain becomes area.
Further, above-mentioned single domain antibody is a part for scFv or Fc fusion proteins or complete antibody.
Further, the amino acid sequence of above-mentioned single domain antibody includes SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12。
A kind of protein or polypeptide, its include one or two more than SEQ ID NO.10 or SEQ ID NO.11 or The amino acid sequence of SEQ ID NO.12 framework regions, and at least there is minimum 90% homology with an amino acid sequence.
A kind of protein or polypeptide, comprising amino acid sequences more than one or two in complementary determining region, and extremely It is few that there is minimum 79% homology with an amino acid sequence.
A kind of multi-functional or multispecific molecule, any of the above-described single domain antibody for this multi-functional or multispecific molecule one Part.
Egg is merged using polypeptide preparation of the amino acid sequence of complementary determining region with treating function including at least a tool In vain.Fusion protein can directly be merged by each identification function polypeptide or by joint peptide connect containing 1 or 1 with On identification function peptide molecule fusion protein.
A kind of nucleic acid molecules, the nucleic acid molecules may be encoded as any of the above-described amino acid sequence, can be with by genetic codon The particular sequence of the nucleic acid molecules is obtained at any time.Because genetic codon has degenerate, the nucleotide sequence can be according to difference Application purpose and it is different.
A kind of carrier, above-mentioned nucleic acid molecules are a part for the carrier.
A kind of protein or polypeptide, the protein or polypeptide are that above-mentioned carrier or at least part sequence can be by suitable Expression system expressed to obtain corresponding protein or polypeptide, above-mentioned expression system includes bacterium, saccharomycete, thread true Bacterium, zooblast, insect cell, plant cell or Cell free expression system.
A kind of host cell, comprising above-mentioned single domain antibody, fusion protein, more special or polyfunctional molecule, nucleic acid can be expressed The host cell of molecule, carrier or protein or polypeptide.
Some terms that the present invention is described have following implication：
Homology：Two or more amino acid sequence similarity degrees, first amino acid sequence and second amino are described The percentage of homology can pass through formula between acid sequence：(in first amino acid sequence with second amino acid sequence The quantity of the amino acid sequence identical amino acid residue of corresponding position)/(amino acid sum in first amino acid sequence) * 100% calculates, wherein the missing of some amino acid that second amino acid sequence is merely able to, insertion, replacement or addition are (with the One amino acid is compared) it is considered as to have difference.Percent homology can also utilize the known calculating for being used for sequences match Machine operation program such as NCBI Blast are obtained.Codon, also known as triplet codon, refer to the nucleotides corresponding to certain amino acid Triplet.The position of polypeptide chain in this kind of amino acid insertion growth is determined during translation.
Compared with prior art, beneficial effect possessed by the present invention is：Obtained single domain antibody is screened in the present invention The specific combination HLA-A2/SLLMWITQC compounds of energy, can be developed into treatment melanoma, breast cancer, prostate cancer, lung The antibody medicine of cancer, oophoroma, thyroid cancer, liver cancer, carcinoma of urinary bladder, late gastric cancer etc..
Brief description of the drawings
Fig. 1 is the detection of the first plate Phage-ELISA and data analysis schematic diagram after the three-wheel elutriation in the present invention；
A：The equal envelope antigen HLA-A2/SLLMWITQC in all holes of ELISA；B：Data analysis ordinate is each hole in 650nm Under absorbance value, abscissa is 96 holes.
Fig. 2 is the detection of the second plate Phage-ELISA and data analysis schematic diagram after the three-wheel elutriation in the present invention；
A：The equal envelope antigen HLA-A2/SLLMWITQC in all holes of ELISA；B：Data analysis ordinate is each hole in 650nm Under absorbance value, abscissa is 96 holes.
Fig. 3 is the plasmid map schematic diagram of single domain antibody amalgamation and expression FC in pET22b in the present invention；
Pass through linker (G4S) connections between single domain antibody and FC.
The reduction SDS-PAGE figures that Fig. 4 is the fusion protein M6-A4-FC expressed in the pET22b in the present invention；
Marker band is followed successively by 14,25,30,40,50,70,100,120,160KD from small to large.Line1 is reduction The M6-F9-FC of state, about 43KD.
Fig. 5 is the plasmid map schematic diagram of single domain antibody amalgamation and expression FC in pcDNA3.1 in the present invention；
Connected between single domain antibody and FC by Restriction Enzyme, and have signal peptide and kozak sequences before single domain antibody.
The SDS-PAGE figures that Fig. 6 is the fusion protein M6-F9-FC expressed in the pcDNA3.1 in the present invention；
A is purifying rear fusion protein M6-F9-FC reduction electrophoretogram, and B is that the non-of purifying rear fusion protein M6-F9-FC is gone back Former electrophoretogram.Marker band is followed successively by 14,25,30,40,50,70,100,120,160KD from small to large.Line1 and Line2 is respectively reduction-state M6-F9-FC and non-reduced state M6-F9-FC.
Fig. 7 is specific detections and data analysis of the fusion protein M6-A4-FC to not synantigen in the present invention Figure；
A：The two row envelope antigen HLA-A2/ of row envelope antigen HLA-A2/ITDQVPFSV, C, D of ELISA Plate A, B two The two row envelope antigen HLA-A2/SLLMWITQC of row envelope antigen HLA-A2/RMFPNAPYL, G, H of NLVPMVATV, E, F two； Line 1 is M6-A4-FC after purification, and line 2 is negative control MB.B：Ordinate be 650nm under absorbance value, horizontal seat Mark 1,2,3,4 corresponds to four kinds of antigens HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA-A2/RMFPNAPYL respectively, HLA-A2/SLLMWITQC。
Fig. 8 is specific detection and data analysis figure of the fusion protein M6-F9-FC in the present invention to not synantigen；
A：The two row envelope antigen HLA-A2/ of row envelope antigen HLA-A2/ITDQVPFSV, C, D of ELISA Plate A, B two The two row envelope antigen HLA-A2/SLLMWITQC of row envelope antigen HLA-A2/RMFPNAPYL, G, H of NLVPMVATV, E, F two； Line 1 is M6-F9-FC after purification, and line 2 is negative control MB.B：Ordinate be 650nm under absorbance value, horizontal seat Mark 1,2,3,4 respectively four kinds of antigens HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA-A2/RMFPNAPYL, HLA-A2/SLLMWITQC。
Fig. 9 is fusion protein M6-F9-FC and HLA-A2/SLLMWITQC complex molecule interphase interactions in the present invention And affinity constant measure figure.
Abscissa is the time, and ordinate is the intermolecular response (RU) be combineding with each other, and 1 is reference channel, and 2 is logical for experiment Road.
Embodiment
To make those skilled in the art be better understood from technical scheme, below in conjunction with the accompanying drawings and specific embodiment The present invention is elaborated.
Embodiment of the invention discloses that a kind of screening and application of identification HLA-A2/SLLMWITQC single domain antibody, lead to Three-wheel biopanning is crossed, is screened from bacteriophage single domain library and obtains the higher antibody sequence of affinity；To screen obtain it is anti- Body sequence is cloned into protokaryon/carrier for expression of eukaryon, with people source FC amalgamation and expressions, transfection host cell, obtains bivalent antibody again Carry out the checking of external affinity.
Embodiment 1 screens the single domain antibody of HLA-A2/SLLMWITQC compounds
It is prepared by 1.1 single domain antibody phage libraries
1.1.1 the preparation of helper phage
By M13KE bacteriophages (being purchased from NEB#N0316S) replicon AlwnI and AfeI (being purchased from NEB) double digestion, simultaneously Synthetic gene fragment also uses AlwnI and AfeI double digestions, is then linked together with T4 ligases.TG1 is transfected after connection Obtain helper phage BM13.In this way, in former replicon tctggtggtggttctggtggcggctctgagggtggtggctctgagggtggcggttctgagggtggcggctctgaggg Aggcggttccggtggtggctct sequences are substituted by synthetic gene sequence, i.e., in bacteriophage GIII coding regions, add Add trypsase to cut sequence, when helper phage is used as, increased Trypsin Induced step, reduced without fusion mesh Gene protein bacteriophage number.
Synthetic gene sequence is as follows：
CCA GCC GGC CTT TCT GAG GGG TCG ACT ATA GAA GGA CGA GGG GCC CAC GAA GGA GGT GGG GTA CCC GGT TCC GAG GGT
1.1.2 phage library is built
1.1.2.1 vector construction
PUC19 (being purchased from NEB) HindIII and NdeI (being purchased from NEB) double digestion are added based on DP47 antibody sequences The artificial single domain antibody sequence of heavy chain.In single domain antibody expression framework, single domain antibody and GIII protein fusions, centre add Myc and VSV-G labels, for purifying or identifying, it is built into Vector for Phage Display pBG3.
1.1.2.2 prepared by ssDNA templates
Coli strain CJ236 (being purchased from NEB) lacks feature dUTPase and uracil-N glycosylase, can To produce uracil single-stranded DNA templates.PBG3 plasmid transfections are entered into CJ236 and are coated on containing Carbenicillin (50 μ G/ml) and on chloramphenicol (15 μ g/ml) agar plate, overnight incubation.Select the single bacterium colony filtered out on flat board Into 3ml 2 × TY broth bouillons (containing the dual anti-of above-mentioned same concentration), 37 DEG C, overnight incubation under the conditions of 250rpm.Next day Take 0.3ml overnight cultures to add in the fresh 2 × TY broth bouillons of 30ml (the μ g/ml of Carbenicillin 50), continue 3-4 Hour culture, making OD600=0.4-0.6, addition helper phage (presses bacterium: bacteriophage number adds than 1: 10), 37 DEG C, 150rpm 1 hour, centrifugation, bacterial precipitation is resuspended in the dual anti-culture mediums of 2 × TY of 60ml, 25 DEG C, and 250rpm cultures 22 are small When, precipitation is abandoned in centrifugation.Supernatant containing bacteriophage is precipitated with 5%PEG (PEG800 and 300mM NaCl are adjusted to concentration as 5%), Then it is resuspended in PBS, ssDNA is prepared using QIAprep Spin M13 kits (being purchased from Qiagen).
1.1.2.3 prepared by library
Prepared by library synthesizes according to the form below synthesis with KunKel methods preparation CDR mutant oligonucleotides chain by Jin Weizhi companies：
Olig_CDR1
CTGCGTCTCTCCTGTGCAGCCTCCGGAKWTANSNTTANCNMTNASDHTRSCNNTTGGGTCCGCCAGGCT CCAGGGAA
Olig_CDR2
GGGTCTAGAGTGGGTATCARSCNNKRNSVVWCGTAGCGGTAGCACATACTACGCAGACTCCGTG
Olig_CDR3a
GACACCGCGGTATATTATTGCGCGGRSWNVSTHTNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNN KNNKNNKTGGGGTCAGGGAACCCTGGTCACCGTC
Olig_CDR3b
CGAGGACACCGCGGTATATTATTGCGCGGRSWNVSTHTNNKNNKNNKNNKNNKNNKNNKNNKNNKTGGG GTCAGGGAACCCTGGTCACCGTCACC
The phosphorylation of oligonucleotide chain
Artificial synthesized oligonucleotide chain is added into following 100ul 50mM Tris-HCl, and (Tris alkali is purchased from Suo Laibao, uses Hydrochloric acid adjusts PH to 7.5 to obtain), pH7.5 contains in following composition system：5U T4 polynucleotide kinases, 10mM MgCl2；1mM ATP And 5mM DTT, 37 DEG C after 1 hour, the good oligonucleotide chain of phosphorylation is purified with PCR purification kits (being purchased from Tiangeng).
Phosphorylated oligonucleotide and ssDNA annealed combinations
By phosphorylated oligonucleotide and Uracilated ssDNA (phosphorylated oligonucleotides: ssDNA=3: 1, ssDNA are 1.1.2.2 gained is prepared) it is dissolved in containing 10mM, MgCl250mM Tris-HCl, pH7.5 buffer solutions in, 90 DEG C after 2 minutes, drop To 25 DEG C (1 DEG C/min of reduction per minute).
DsDNA is synthesized
Materials described below is added in the phosphorylated oligonucleotide and ssDNA compounds of annealed combination：0.55mM ATP； 0.8mM dNTPs；5mM DTT；15u T4DNA synzyme and 15u T7DNA synzyme, 20 DEG C after 3 hours, are used Qiaquick PCR purification kits (being purchased from Qiagen) purify.Turn DNA after purification is to be transformed in competence TG1 to electricity.
1.2 BM13 helper phages and the increment of phage library
The increment of BM13 helper phages
From the fresh single bacterium colony of one e. coli tg1 of picking (being purchased from the vast spirit in Wuhan) on basic agar medium flat board, It is inoculated into 20ml 2 × TY culture mediums, gentle to shake, 37 DEG C of cultures to OD600 are about 0.8 standby.By what is prepared in 1.1.1 Original BM13 helper phages prepare a series of BM13 bacteriophages of 10 times of dilutions with 2 × TY culture mediums.Each dilution factor takes respectively 10 μ l and 200 μ l TG1 (OD600=0.8) bacterium solutions mix, and oscillator gently shakes 3s, and is mixed with top-layer agar culture medium, It is poured on the TY flat boards of pre-balance room temperature.Pivotal plate is to ensure that thalline and top-layer agar are evenly distributed.Treat that upper strata is cultivated After base solidification, in 37 DEG C of biochemical culture carton upside down overnight incubations.
Next day selects the good single bacteriophage of separation and is inoculated in the 2 × TY for containing 25 μ g/ml kanamycins equipped with 2~3ml In the 15ml culture tubes of culture medium.37 DEG C, 12~16h of 250rpm concussion and cultivates.It is sterile micro- that infection supernatant is transferred to 1.5ml Centrifuge tube is measured, on microcentrifuge, with maximum (top) speed, 4 DEG C of centrifugation 2min.Supernatant is transferred to 4 DEG C of preservations in new pipe.
The increment of phage library
The phage library prepared is seeded in 2 × TY culture mediums of the 100ml containing 60 μ g/ml ampicillins, 37 DEG C, when 250rpm concussion and cultivates to OD600 are 0.8, addition BM13 to concentration is 2 × 107pfu/ml.37 DEG C, 300rpm cultures 1h, 25 μ g/ml kanamycins are added, 37 DEG C are continued 14~18h of culture.Bacterium solution is centrifuged, supernatant is precipitated with 5%PEG, then It is resuspended in standby in 5%MPBS.
The single domain antibody of 1.3 screening HLA-A2/SLLMWITQC compounds
1.3.1 biopanning
Streptavidin immunomagnetic beads (being purchased from Invitrogen cat no.SKU#112-05D) takes 25 μ l, adds certain The biotinylated HLA-A2/SLLMWITQC, room temperature combination 5min of amount.PBST and PBS is washed 2~3 times.MPBS closes 2h, PBST And PBS is washed 2~3 times.Phage library is added in magnetic bead, is incubated at room temperature 2h.
Uncombined library is removed, magnetic bead is respectively washed 10 times with PBST and PBS.0.01% trypsin solution, room are added into magnetic bead Temperature is incubated 1H.Obtain pancreatin eluent.
Pancreatin eluent is added in 30ml TG1 (OD600=0.5), text is eluted for the first time by method increment in 1.2 Storehouse.
So carry out the second wheel, third round elutriation.The single bacterium of gained is dropped down onto in 96 orifice plates after picking three-wheel elutriation.By 1.2 Chinese library value adding method prepares culture supernatants.
1.3.2 ELISA is identified
A certain amount of supernatant is taken to do ELISA identifications.See Figure 1A and Fig. 2A.
ELISA steps are as follows：Known antigens are diluted to 1~10 μ g/ml with coating buffer solution, add 0.1ml per hole, 4 DEG C Overnight；Next day washs 3 times；Add the measuring samples 0.1ml necessarily diluted in the above-mentioned reacting hole being coated with, put 37 DEG C and be incubated 1 Hour, washing；The enzyme mark second for adding diluted fresh resists (anti-KM13-HRP 1: 5000) body 0.1ml, and 37 DEG C are incubated 60 points Clock, washing；Last time is washed with DDW.Add the tmb substrate solution 0.1ml of Extemporaneous in each reacting hole, 37 DEG C 10~ 30 minutes.With advanced plate reading machine under 650nm wavelength read plate.
Each hole absorbance value is as such as Figure 1B and Fig. 2 B.
Wherein, A：The equal envelope antigen HLA-A2/SLLMWITQC in all holes of ELISA；Antibody is different in per hole.B：Number According to analysis ordinate be absorbance value of each hole under 650nm, abscissa is 96 holes, wherein, 1-8 A1, B1, C1, D1, E1, F1, G1, H1,9-16 A2, B2, C2, D2, E2, F2, G2, H2, the like, 89-96 A12, B12, C12, D12, E12、F12、G12、H12。
Clones of the A650nm more than 0.8 is sequenced in selection Fig. 1 and 2, obtains multiple different amino acid sequences, SEQ ID NO.10 (M6-F9), SEQ ID NO.11 (M6-A4), SEQ ID NO.12 (M6-C7).
The expression of embodiment 2, fusion protein
Expression of the fusion protein M6-A4-FC in Escherichia coli
In order to form bivalent antibody, single domain antibody gene is connected to one by Not I and linker (G4S) and people source FC Rise, front and rear to be cloned into respectively with Nco I and Xho I restriction enzymes on pET22b, plasmid map is shown in Fig. 3.
The carrier built is converted into E.coli/DE3, chooses within second day monoclonal, 37 DEG C of 220rpm concussion and cultivates are extremely During OD600 about 0.5, after adding IPTG (working concentration 1mM), 18 DEG C of 220rpm induced expressions 20h.After collecting thalline, PBS is used (PH7.4) ultrasonication after being resuspended uniformly.Ultrasonication condition：600W, ultrasonic 2sec, interval 6sec, common 10min, 16 DEG C.It is super 4 DEG C of 12000rpm centrifugations 10min after sound.
Wherein, M6-A4-FC ultrasonic clear liquid runs SDS-PAG after purification with ProteinA, sees Fig. 4.Marker band from It is small to being followed successively by 14,25,30,40,50,70,100,120,160KD greatly.Linel is the M6-F9-FC, about 43KD of reduction-state.
Expression of the fusion protein M6-F9-FC in 293F
In order to form bivalent antibody, single domain antibody Gene Fusion people source FC, and antibody be previously incorporated Kozac sequences and For signal peptide rear clone on pcDNA3.1, plasmid map is shown in Fig. 5.Introduced between single domain antibody and FC and pass through BamHI restriction enzyme sites, Hind III restriction enzymes are used before single domain antibody, the restricted digestions of Xba I are used after FC.
Recombinant plasmid is transiently transfected into 293F, and culture centrifuges after 4 days, collects supernatant, and purified with ProteinA.
Wherein, M6-F9 runs SDS-PAG after merging FC protein purification, sees Fig. 6.Wherein, A is purifying rear fusion protein M6- F9-FC reduction electrophoretogram, B are purifying rear fusion protein M6-F9-FC non-reduced electrophoretogram.Marker band from it is small to It is followed successively by 14,25,30,40,50,70,100,120,160KD greatly.Linel and Line2 is respectively reduction-state M6-F9-FC and non- Reduction-state M6-F9-FC.
Embodiment 3, fusion protein M6-A4-FC and M6-F9-FC specific recognition HLA-A2/SLLMWITQC compounds
Specificity identifications of the fusion antibody M6-A4-FC to the affinity of not synantigen after purification.After adding TMB 20min With advanced plate reading machine under 650nm wavelength read plate, data preparation such as Fig. 7 B.
Wherein Fig. 7 A：To the row envelope antigen HLA-A2/ITDQVPFSV of specificity identification ELISA Plate A, B two of not synantigen, C, the two two row coatings of row envelope antigen HLA-A2/RMFPNAPYL, G, H of row envelope antigen HLA-A2/NLVPMVATV, E, F of D two are anti- Former HLA-A2/SLLMWITQC；The single domain antibody added in each hole is M6-A4-FC after purification, 500ng/ holes.Its In, it is M6-A4-FC that Line 1 eight Kong Zhongjun, which are incubated primary antibody, and line 2 is negative control MB.Every kind of antibody is to a kind of antigen Affine detection reaction have two repeating holes.B：Data analysis ELISA Plate is existed after adding TMB 20min with advanced plate reading machine B is such as schemed in read plate under 650nm wavelength, data preparation.Ordinate is the absorbance value under 650nm, shows that A650 is two in figure The average value of repeating hole.Abscissa 1,2,3,4 is four kinds of antigens HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA- A2/RMFPNAPYL, HLA-A2/SLLMWITQC.
As a result show that fusion protein only shows HLA-A2/SLLMWITQC higher affinity, it is basic to other three antigens Do not combine.
Specificity identifications of the fusion antibody M6-F9-FC to the affinity of not synantigen after purification.Wherein, ELISA fixes anti- Former method is the same, and antigen is followed successively by HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA- from the top down in each file A2/RMFPNAPYL, HLA-A2/SLLMWITQC, each two repeating holes of antigen；Same single domain is added in each file to resist Body；See Fig. 8 A.After read plate, data preparation such as Fig. 8 B.Ordinate is the absorbance value under 650nm, shows that A650 is two in figure The average value of individual repeating hole.Abscissa 1,2,3,4 is four kinds of antigens HLA-A2/ITDQVPFSV, HLA-A2/NLVPMVATV, HLA-A2/RMFPNAPYL, HLA-A2/SLLMWITQC.
Embodiment 4, fusion protein M6-F9-FC and HLA-A2/SLLMWITQC complex molecule interphase interaction and affine Force constant determines
Using plasma resonance technology carry out fusion protein M6-F9-FC and HLA-A2/SLLMWITQC interaction and Affinity constant determines.The sensing chip (senser chip SA) that experiment is coupled from Streptavidin, using HBS+EP+ as stream Dynamic phase buffer solution.Uncorrelated antigen HLA-A2/RMFPNAPYL is fixed on a passage of sensing chip as reference antigen, HLA-A2/SLLMWITQC is fixed on another passage as experimental antigen, reference antigen is used for detecting background combination situation.It is dilute Fusion antibody M6-F9-FC is released, concentration carries out sample introduction from 20nm to 335nm, and sample, which simultaneously flows through, is fixed with HLA-A2/ RMFPNAPYL and HLA-A2/SLLMWITQC passage surface.Experiment the data obtained is acquired simultaneously by BiacoreT200 instruments Analysis, is shown in Fig. 9, wherein 1 is reference channel, 2 be experiment channel；And entered with polymerization kinetics curves with 1: 1 binding models Row fitting, and calculations incorporated speed constant (Ka), dissociation rate constant (Kd), affinity constant (KD).
Test result indicates that fusion antibody M6-F9-FC and HLA-A2/SLLMWITQC is specifically bound, with reference Antigen no cross reaction, is not combined.Association rate constant 1.48E+04 (1/Ms), dissociation rate constant 9.23E-04 (1/s), parent With force constant 6.25E-08 (M).
Above example is only the exemplary embodiment of the present invention, is not used in the limitation present invention, protection scope of the present invention It is defined by the claims.Those skilled in the art can make respectively in the essence and protection domain of the present invention to the present invention Kind modification or equivalent substitution, this modification or equivalent substitution also should be regarded as being within the scope of the present invention.
SEQUENCE LISTING
<110>Tianjin Tian Rui bio tech ltd
<120>A kind of identification HLA-A2/SLLMWITQC single domain antibody
<160> 12
<210> 1
<211> 9
<212> PRT
<213>It is artificial synthesized
<400>1
Phe Arg Ile Asn Asp Glu Val Met Gly
1 5
<210> 2
<211> 6
<212> PRT
<213>It is artificial synthesized
<400>2
Thr Ile Gly Thr Thr Asp
1 5
<210> 3
<211> 11
<212> PRT
<213>It is artificial synthesized
<400>3
Thr Met Trp Arg Val Thr Ala Glu Ile Asn Tyr
1 5 10
<210> 4
<211> 9
<212> PRT
<213>It is artificial synthesized
<400>4
Phe Lys Val Ile Asp Gln Asp Thr Gly
1 5
<210> 5
<211> 6
<212> PRT
<213>It is artificial synthesized
<400>5
Ala Ile Glu Asp Ser Ser
1 5
<210> 6
<211> 12
<212> PRT
<213>It is artificial synthesized
<400>6
Gly Leu Glu Arg Ala Met Ser Ala Lys Leu Ser Tyr
1 5 10
<210> 7
<211> 9
<212> PRT
<213>It is artificial synthesized
<400>7
Tyr Met Ile Asn Ser Glu Val Met Thr
1 5
<210> 8
<211> 6
<212> PRT
<213>It is artificial synthesized
<400>8
Ser Ile Ser Gly Glu Asn
1 5
<210> 9
<211> 11
<212> PRT
<213>It is artificial synthesized
<400>9
Thr Ala Trp Asp Thr Ala Glu Thr Val Gly Phe
1 5 10
<210> 10
<211>119
<212> PRT
<213>It is artificial synthesized
<400>10
Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Arg Ile Asn Asp Glu Val Met Gly Trp
20 25 30 35
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Thr Ile Gly Thr Thr
40 45 50
Asp Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
55 60 65 70
Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln MET Asn Ser Leu Arg Ala Glu Asp
75 80 85 90
Thr Ala Val Tyr Tyr Cys Ala Thr Met Trp Arg Val Thr Ala Glu Ile Asn Tyr
95 100 105
Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser
110 115
<210> 11
<211> 120
<212> PRT
<213>It is artificial synthesized
<400>11
Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Lys Val Ile Asp Gln Asp Thr Gly Trp
20 25 30 35
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Glu Asp Ser
40 45 50
Ser Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
55 60 65 70
Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln MET Asn Ser Leu Arg Ala Glu Asp
75 80 85 90
Thr Ala Val Tyr Tyr Cys Ala Gly Leu Glu Arg Ala Met Ser Ala Lys Leu Ser
95 100 105
Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser
110 115 120
<210> 12
<211> 119
<212> PRT
<213>It is artificial synthesized
<400>12
Gln Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Tyr Met Ile Asn Ser Glu Val Met Thr Trp
20 25 30 35
Val Arg Arg Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ser Ile Ser Gly Glu
40 45 50
Asn Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg
55 60 65 70
Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln MET Asn Ser Leu Arg Ala Glu Asp
75 80 85 90
Thr Ala Val Tyr Tyr Cys Ala Thr Ala Trp Asp Thr Ala Glu Thr Val Gly Phe
95 100 105
Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser
110 115

Claims (13)

  1. A kind of 1. identification HLA-A2/SLLMWITQC single domain antibody, it is characterised in that the amino acid sequence of the single domain antibody Comprising three complementary determining regions, respectively CDR1, CDR2 and CDR3, wherein：
    CDR1 is SEQ ID NO.1, and CDR2 is that SEQ ID NO.2, CDR3 are SEQ ID NO.3；
    Or CDR1 is SEQ ID NO.4, CDR2 is that SEQ ID NO.5, CDR3 are SEQ ID NO.6；
    Or CDR1 is SEQ ID NO.7, CDR2 is that SEQ ID NO.8, CDR3 are SEQ ID NO.9.
  2. A kind of 2. identification HLA-A2/SLLMWITQC according to claim 1 single domain antibody, it is characterised in that the list Domain antibodies are single domain antibodies or heavy chain becomes area or light chain becomes area.
  3. A kind of 3. identification HLA-A2/SLLMWITQC according to claim 1 single domain antibody, it is characterised in that the list Domain antibodies are a part for scFv or Fc fusion proteins or complete antibody.
  4. A kind of 4. identification HLA-A2/SLLMWITQC according to claim 1 single domain antibody, it is characterised in that the list The amino acid sequence of the framework region of domain antibodies includes SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12.
  5. 5. a kind of identification HLA-A2/SLLMWITQC according to claim 1 single domain antibody, it is characterised in that include institute Amino acid sequences more than one or two in complementary determining region is stated, and is at least had with an amino acid sequence minimum 79% homology.
  6. A kind of 6. identification HLA-A2/SLLMWITQC according to claim 3 single domain antibody, it is characterised in that the ammonia Amino acid sequences more than one or two in framework of the base acid sequence comprising single domain antibody described in claim 4, and At least there is minimum 90% homology with an amino acid sequence.
  7. 7. egg is merged in polypeptide preparation of the amino acid sequence listed by usage right requirement 1 with treating function including at least a tool In vain.
  8. 8. the fusion protein in claim 7 can connect by the directly fusion of each identification function polypeptide or by joint peptide What is connect contains the identification function peptide molecule fusion protein of 1 or more than 1.
  9. 9. a kind of more special or polyfunctional molecules, it is characterised in that how special any single domain antibody described in claim 1 is for this An or part for polyfunctional molecule.
  10. A kind of 10. nucleic acid molecules, it is characterised in that any described amino acid sequences of nucleic acid molecule encoding claim 1-9.
  11. 11. a kind of carrier, it is characterised in that nucleotide sequence described in claim 10 is a part for the carrier, because heredity is close Numeral has degenerate, and the nucleotide sequence can be according to application purpose and different.
  12. 12. a kind of protein or polypeptide, it is characterised in that carrier is expressed by expression system described in claim 11, institute Obtain corresponding protein or polypeptide；The expression system includes bacterium, saccharomycete, filamentous fungi, mammalian cell, insect Cell, plant cell, or Cell free expression system.
  13. A kind of 13. host cell, it is characterised in that comprising can express any described single domain antibodies of claim 1-6, right will Ask any described fusion proteins of 7-8, the core described in more special or polyfunctional molecules, claim 10 described in claim 9 The host cell of protein described in carrier or claim 12 or polypeptide described in acid molecule, claim 11.
CN201611240366.1A 2016-12-28 2016-12-28 A kind of identification HLA A2/SLLMWITQC single domain antibody Pending CN107686522A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201611240366.1A CN107686522A (en) 2016-12-28 2016-12-28 A kind of identification HLA A2/SLLMWITQC single domain antibody
PCT/CN2017/118287 WO2018121475A1 (en) 2016-12-28 2017-12-25 Single-domain antibody recognizing complex formed by hla-a2 molecule and sllmwitqc short peptide

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611240366.1A CN107686522A (en) 2016-12-28 2016-12-28 A kind of identification HLA A2/SLLMWITQC single domain antibody

Publications (1)

Publication Number Publication Date
CN107686522A true CN107686522A (en) 2018-02-13

Family

ID=61152304

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611240366.1A Pending CN107686522A (en) 2016-12-28 2016-12-28 A kind of identification HLA A2/SLLMWITQC single domain antibody

Country Status (2)

Country Link
CN (1) CN107686522A (en)
WO (1) WO2018121475A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110407924A (en) * 2019-07-24 2019-11-05 暨南大学 Target binding protein and its application of CD133
CN110872347A (en) * 2018-08-30 2020-03-10 天津天锐生物科技有限公司 Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053938A1 (en) * 1998-04-17 1999-10-28 Ludwig Institute For Cancer Research Isolated peptides corresponding to amino acid sequences of ny-eso-1, wherein bind to mhc class i and mhc class ii molecules, and uses thereof
CN101001868A (en) * 2004-06-17 2007-07-18 曼康公司 Epitope analogs
WO2010106431A2 (en) * 2009-03-20 2010-09-23 Ludwig Institute For Cancer Research Ltd High affinity t-cell receptor-like ny-eso-1 peptide antibodies, methods, and uses thereof
CN102120772A (en) * 2010-01-08 2011-07-13 中国科学院微生物研究所 Chimeric antibody and immunocyte
WO2013105856A1 (en) * 2012-01-13 2013-07-18 Apo-T B.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
US20160271292A1 (en) * 2013-11-11 2016-09-22 Georgia Tech Research Corporation Functionalized microgels with fibrin binding elements

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6992176B2 (en) * 2002-02-13 2006-01-31 Technion Research & Development Foundation Ltd. Antibody having a T-cell receptor-like specificity, yet higher affinity, and the use of same in the detection and treatment of cancer, viral infection and autoimmune disease

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999053938A1 (en) * 1998-04-17 1999-10-28 Ludwig Institute For Cancer Research Isolated peptides corresponding to amino acid sequences of ny-eso-1, wherein bind to mhc class i and mhc class ii molecules, and uses thereof
CN1303300A (en) * 1998-04-17 2001-07-11 路德维格癌症研究院 Isolated peptides corresponding to amino acid sequences of NY-ESO-1, wherein bind to MHC class I and MHC class II molecules, and uses thereof
CN101001868A (en) * 2004-06-17 2007-07-18 曼康公司 Epitope analogs
WO2010106431A2 (en) * 2009-03-20 2010-09-23 Ludwig Institute For Cancer Research Ltd High affinity t-cell receptor-like ny-eso-1 peptide antibodies, methods, and uses thereof
CN102120772A (en) * 2010-01-08 2011-07-13 中国科学院微生物研究所 Chimeric antibody and immunocyte
WO2013105856A1 (en) * 2012-01-13 2013-07-18 Apo-T B.V. Aberrant cell-restricted immunoglobulins provided with a toxic moiety
US20160271292A1 (en) * 2013-11-11 2016-09-22 Georgia Tech Research Corporation Functionalized microgels with fibrin binding elements

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HELD,G等: "Dissecting cytotoxic T cell responses towards the NY-ESO-1 protein by peptide/MHC-specific antibody fragments", 《EUR J IMMUNOL》 *
HELD,G等: "MHC/Peptide-Specific Interaction of the Humoral Immune System: A New Category of Antibodies", 《JOURNAL OR IMMUNOLOGY》 *
吕丽慧等: "特异性识别胞内NY-ESO-1抗原的抗体", 《第十二届全国免疫学学术大会摘要汇编中国免疫学会会议论文集》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110872347A (en) * 2018-08-30 2020-03-10 天津天锐生物科技有限公司 Single-domain antibody for recognizing complex formed by HLA-A2 molecule and ITDQVPFSV short peptide
CN110407924A (en) * 2019-07-24 2019-11-05 暨南大学 Target binding protein and its application of CD133
CN110407924B (en) * 2019-07-24 2021-12-21 暨南大学 Binding proteins targeting CD133 and uses thereof

Also Published As

Publication number Publication date
WO2018121475A1 (en) 2018-07-05

Similar Documents

Publication Publication Date Title
JP2018520675A (en) Novel binding protein based on diubiquitin mutant protein and production method thereof
CN107674122A (en) A kind of single domain antibody for identifying human serum albumins
CN111848798B (en) Nanometer antibody capable of combining BCMA and application thereof
WO2020125120A1 (en) Antibody library construction method and application thereof
CN111378043B (en) Human-mouse chimeric anti-Siglec-15 whole-molecule IgG with neutralization function and preparation method and application thereof
US9511342B2 (en) Antibody preparation method, and antibody and antibody library thus prepared
Stern et al. Geometry and expression enhance enrichment of functional yeast‐displayed ligands via cell panning
JP6843262B2 (en) Improved anti-VEGFR-2 monoclonal antibody
CN111234020B (en) BCMA binding protein and preparation method and application thereof
CN103709251B (en) Total man source anti-CD 26 antibodies and application thereof
CN108084265B (en) Fully human single domain antibody specifically binding to human 5T4 antigen and application thereof
WO2011057435A1 (en) Anti-epidermal growth factor receptor antibodies and uses thereof
CN111825767B (en) Single-domain antibody of human epidermal growth factor receptor 2, detection kit and application thereof
CN103641917B (en) Anti-CD26 antibody and application thereof
CN112028997A (en) anti-CEACAM 5 nano antibody
CN117050165A (en) Antibody targeting monkey poxvirus, antigen binding fragment thereof and application thereof
CN107686522A (en) A kind of identification HLA A2/SLLMWITQC single domain antibody
CN108530538B (en) EpCAM single domain antibody E6
WO2022134276A1 (en) Anti-human osteopontin antibody and use thereof
CN107698681B (en) Single-domain antibody for recognizing HLA-A2/RMFPNAPYL
WO2011057437A1 (en) Anti-epidemic growth factor receptor antibody and encoding genes and uses thereof
CN108586614B (en) EpCAM single domain antibody D7
KR101473328B1 (en) Cytokeratin17―specific human antibody
WO2023273595A1 (en) Antibody binding to trop2, bispecific antibody targeting trop2 and cd3, preparation methods therefor and uses thereof
Studennikov et al. New human single chain anti-idiotypic antibody against benzo [a] pyrene

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20210324

Address after: 16 / F, Beike building, 59 Gaoxin South 9th Road, Yuehai street, Nanshan District, Shenzhen, Guangdong 518000

Applicant after: SHENZHEN BEIKE BIO-TECHNOLOGY Co.,Ltd.

Address before: Room 201, 2 / F, building 19, West District, airport business park, No.76 Huanhe North Road, Tianjin Binhai New Area Free Trade Zone (Airport Economic Zone), 300300

Applicant before: TIMMUNE BIOTECH Inc.

WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180213