CN107557381A - A kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems - Google Patents

A kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems Download PDF

Info

Publication number
CN107557381A
CN107557381A CN201710949078.1A CN201710949078A CN107557381A CN 107557381 A CN107557381 A CN 107557381A CN 201710949078 A CN201710949078 A CN 201710949078A CN 107557381 A CN107557381 A CN 107557381A
Authority
CN
China
Prior art keywords
culture
carrier
sgrna
medium
crispr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710949078.1A
Other languages
Chinese (zh)
Inventor
张昌伟
杨洋
侯喜林
刘同坤
张茹佳
高立伟
李英
肖栋
王建军
胡春梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201710949078.1A priority Critical patent/CN107557381A/en
Publication of CN107557381A publication Critical patent/CN107557381A/en
Pending legal-status Critical Current

Links

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems.Two couples of sgRNA primer sGAvrIIF1/sGR1 and sGF2/sGAvrIIR2 are designed, enters performing PCR amplification by template of pChimera sgRNA vector respectively, takes purifying purpose fragment to carry out fusion DNA vaccine by primer of sGAvrIIF1/sGAvrIIR2 respectively；By fusion connection after carrier pCAS9 TPC and fusion DNA vaccine product digestion, fusion connection product conversion Escherichia coli, acquisition positive bacteria drops into row culture extraction plasmid and obtains plant gene editor's carrier.By the present invention, the gene editing to Chinese cabbage simple and effective can be realized, the foundation to Chinese cabbage transformation system is also had laid a good foundation.

Description

A kind of foundation and its application of Chinese cabbage CRISPR-Cas9 gene editing systems
Technical field
The invention belongs to gene engineering technology field, and in particular to a kind of gene editing technology of CRISPR-Cas9 mediations And its application.
Background technology
In recent years, the fast development of genome editing technique (genome engineering technologies) is made a living Thing research brings great change.Unlike traditional gene cloning, genome editing technique can be directly applied to base Because carrying out knockout, insertion, mutation and assemble editing etc. of DNA sequence dna in group, so as to by gene function and controlling element Connect each other together, in market, bioengineering etc. has broad application prospects.CRISPR/Cas9 systems are by being oriented to The genome orientation editing technique of RNA mediations.Cas9 nucleases can be identified and cut to target site, form DNA double chain Fault structure, so as to two kinds of repair mechanisms in active cell, i.e. non-homologous end joining or homologous recombination, repaiied by both The system of answering a pager's call triggers loss, insertion and the replacement of incision position base, obtains mutant.In target region of DNA domain, design is left comprising 20bp Right oligo DNA, the oligo DNA of design first base of sequence should be G, if first base is not G, can voluntarily add On.To design easy operation, editor, efficiently advantage turns into genome editor of new generation to CRISPR-Cas9 systems with versatility is wide etc. Technology, breakthrough revolution is brought for genome directional transformation regulation and control and application etc..
Chinese cabbage (Chinese cabbage and Chinese cabbage), Cruciferae Brassica genus, it originates in China, is traditional vegetable of China Dish.Modern Chinese cabbage is generally divided into Chinese cabbage and pakchoi, and Chinese cabbage is typically called " Chinese cabbage " by northerner, and pakchoi then claims Make " rape ".Containing B family vitamin, vitamin C, calcium, iron, phosphorus in Chinese cabbage, the content of trace element zinc is also very in Chinese cabbage High.The also plantation extensively of some countries of South Asia, Japan and the United States and Europe, has become worldwide vegetable now.In recent years, with people Growth in the living standard, to the quality requirements of Chinese cabbage also more and more higher, using CRISPR-Cas9 gene editings technology also to carrying The quality of high Chinese cabbage serves the effect of novelty.
The content of the invention
It is an object of the invention to provide a kind of plant gene editor's carrier of CRISPR-Cas9 mediations.
Another object of the present invention is to provide plant gene editor's carrier of above-mentioned CRISPR-Cas9 mediations in Chinese cabbage Application in gene functional research or Chinese cabbage genetic engineering breeding.
A further object of the present invention is to provide a kind of foundation of crop in cruciferae CRISPR-Cas9 gene editing systems Method.The method of the present invention is the high efficiency gene group edit methods for crop in cruciferae such as Chinese cabbage, passes through the present invention's Method can obtain the Chinese cabbage gene editing system of CRISPR-Cas9 mediations.The present invention utilizes carrier pChimera sgRNA Vector (plasmid numbers：CD3-1930), pCas9-TPC (plasmid numbers：CD3-1927) it is purchased from www.arabidopsis.org.Base pairing is carried out by designing specific guide RNA sequence and target sequence, carrier carries special Different in nature guide RNA, by the explant of Agrobacterium-mediated Transformation to crop in cruciferae such as Chinese cabbage, it can realize and Cruciferae is made The editor of thing genome.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of plant gene editor's carrier of CRISPR-Cas9 mediations, is built using following methods：Design two couples of sgRNA Primer sGAvrIIF1/sGR1 and sGF2/sGAvrIIR2, the sequence of the primer are respectively：
sGAvrIIF1：GATCCTAGGAGCTTTCGTTGAACAACGGAAACT
sGR1：GCTCTAAAAC (sgRNA reverse complementary sequences) CAATCACTACTTCGACTCTAGCTG
sGF2：AGTAGTGATT (sgRNA forward directions sequence) GTTTTAGAGCTAGAAATAGCAAGT
sGAvrIIR2：GATCCTAGGGCCATTTGTCTGCAGAATTGGCGC；
Described sgRNA forward directions sequence is that 20bp sequence is selected before objective gene sequence NGG sequential structures, First base of sgRNA forward direction sequences must be G, therefore sgRNA forward directions sequence can also be used GNNNNNNNNNNNNNNNNNNN represents (N can be A, T, G, C).Described sgRNA reverse complementary sequences and described sgRNA Positive sequence reverse complemental, it can be represented with NNNNNNNNNNNNNNNNNNNC (N can be A, T, G, C).
Respectively using pChimera sgRNA vector as template enter performing PCR amplification, take respectively purifying purpose fragment with SGAvrIIF1/sGAvrIIR2 is that primer carries out fusion DNA vaccine；By carrier pCAS9-TPC and the company of fusion after fusion DNA vaccine product digestion Connect, fusion connection product conversion Escherichia coli, acquisition positive bacteria drops into row culture extraction plasmid and obtains plant gene editor's carrier.
Transgenosis recombinant bacterium containing above-mentioned plant gene editor carrier.
Application of the above-mentioned plant gene editor carrier in crop in cruciferae gene editing.
Application of the above-mentioned transgenosis recombinant bacterium in crop in cruciferae gene editing.
Applications of the carrier pCAS9-TPC in plant gene editor as shown in SEQ ID NO.2.
A kind of method for building up of crop in cruciferae CRISPR-Cas9 gene editing systems, comprises the following steps：
(1) plant gene editor's carrier of CRISPR-Cas9 mediations is built：Design two couples of sgRNA primers sGAvrIIF1/ SGR1 and sGF2/sGAvrIIR2, the sequence of the primer are respectively：
sGAvrIIF1：GATCCTAGGAGCTTTCGTTGAACAACGGAAACT
sGR1：GCTCTAAAAC (sgRNA reverse complementary sequences) CAATCACTACTTCGACTCTAGCTG
sGF2：AGTAGTGATT (sgRNA forward directions sequence) GTTTTAGAGCTAGAAATAGCAAGT
sGAvrIIR2：GATCCTAGGGCCATTTGTCTGCAGAATTGGCGC；
Respectively using pChimera sgRNA vector as template enter performing PCR amplification, take respectively purifying purpose fragment with SGAvrIIF1/sGAvrIIR2 is that primer carries out fusion DNA vaccine；By carrier pCAS9-TPC and the company of fusion after fusion DNA vaccine product digestion Connect, fusion connection product conversion Escherichia coli, acquisition positive bacteria drops into row culture extraction plasmid and obtains plant gene editor's carrier；
(2) plant gene editor's support chemistry method that step (1) obtains is transferred to Agrobacterium；
(3) pretreatment culture is transferred to after crop in cruciferae seed disinfection after seed germination medium culture to cotyledon period Cultivated in base, obtain explant；
(4) Agrobacterium that step (2) obtains is infected into conversion explant to be placed in being co-cultured on co-cultivation base；
(5) explant after co-cultivation is transferred to after differential medium culture differentiates adventitious bud to explant, with sieve The screening and culturing for selecting culture medium to carry out 2~3 times；
(6) will screen the resistance seedling that obtains be transferred in subculture medium expand it is numerous, then through root media culture of rootage To complete plant is produced, in T0 generations, obtain transgenic seed through vernalization of surviving the winter.
Described seed germination medium：1/2MS+Agar agar (0.8%, g/100ml) pH 5.8
Described pretreatment culture medium：MS+2,4-D (0.l-0.2mg/L)+NAA (l-1.5mg/L)+Agar agar (0.8%, g/100ml) pH 5.8
Described co-cultivation base：MS+2,4-D(0.l-0.2mg/L)+6BA(1.5-2.5mg/L)+AS(100μM)+Agar (0.8%, g/100ml) pH 5.2
Described differential medium：MN+6-BA(3-5mg/L)+NAA(0.5-1mg/L)+AgNO3(3-5mg/L)+Carb (400-500mg/L)+Agar (0.9%, g/100ml) pH 5.8
Described screening and culturing medium：MS+6-BA(1.5-2mg/L)+NAA(0.2-0.4mg/L)+Carb(400-500mg/ L)+Km (40-50mg/L)+Agar (0.8%, g/100ml) pH 5.8
Described subculture medium：MS+6-BA(0.5-1mg/L)+NAA(0.02-0.1mg/L)+KT(0.5-1mg/L)+ Agar (0.8%, g/100ml) pH 5.8
Described root media：B5+NAA (0.1-0.3mg/L)+Agar (0.7%, g/100ml) pH 5.8.
The screening and culturing medium of positive bacterium colony described in step (1) is the LB culture mediums containing spectinomycin, screens the sun Property bacterium colony condition of culture be 37 DEG C, 250rpm concussion and cultivates.
Condition of culture in step (3) after crop in cruciferae seed disinfection in seed germination medium culture to cotyledon period For 2000~3000lx of light intensity, 25 DEG C of temperature.
The condition of culture co-cultured described in step (4) is 25 DEG C of 24~36h of light culture.
Application of the above-mentioned method in Chinese cabbage gene editing.
The method for building up of crop in cruciferae CRISPR-Cas9 gene editing systems of the present invention, detailed technology scheme Comprise the following steps：
(1) Photographing On-line instrument http is used://cbi.hzau.edu.cn/crispr/ designs sgRNA sequences, primer sequence Row are respectively：
sGAvrIIF1：GATCCTAGGAGCTTTCGTTGAACAACGGAAACT
sGR1：GCTCTAAAAC (sgRNA reverse complementary sequences) CAATCACTACTTCGACTCTAGCTG
sGF2：AGTAGTGATT (sgRNA forward directions sequence) GTTTTAGAGCTAGAAATAGCAAGT
sGAvrIIR2：GATCCTAGGGCCATTTGTCTGCAGAATTGGCGC；
Primer sGAvrIIF1/sGR1, sGF2/sGAvrIIR2 enter using pChimera sgRNA vector as template respectively Performing PCR expands, and pcr amplification product carries out gel electrophoresis, and is purified with gel-purified QIAquick Gel Extraction Kit, and the purpose fragment of purifying is each Take 1 μ l to carry out fusion DNA vaccine, after being not added with 10 circulations of primer amplification, add primer sGAvrIIF1/sGAvrIIR2 and enter performing PCR expansion Increase.Fusion DNA vaccine product and expression vector Cas9-TPC are connected with AvrII digestions and with T4 ligases respectively.Fusion product is with carrying The fusion system of body is：Carrier：90ng, double chain DNA fragment：100ng, T4 ligase：1 μ l, 5xT4 ligases Buffer：1 μ l, Add aqua sterilisa to 10 μ l.PCR programs are：16℃10h.Connection product chemical transformation convert Escherichia coli Trans-T1, containing 37 DEG C of LB flat boards for having spectinomycin stand overnight culture and obtain positive bacterium colony, and picking single bacterium colony, which enters performing PCR and detects and be sequenced, to be tested Card.The positive bacteria of acquisition drops into row culture extraction plasmid.
(2) take 500ul bacterium solutions to go to the LB containing ampicillin the pCas9 recombinant vectors that step (1) has been verified to train Support in base, expand numerous extraction plasmid, chemical method conversion Agrobacterium GV3101, in 28 DEG C of the LB flat boards containing spectinomycin and rifampin Quiescent culture 48 hours, picking single bacterium colony enter performing PCR checking.
The μ l of bacterium solution 500 of the positive Agrobacterium obtained are inoculated into the fresh LB of 50mL (50mg/L Km+50mg/L Rif) In 28 DEG C in fluid nutrient medium, 200rpm shaken overnights, it is 0.5~0.6 to bacterium solution OD600 values, bacterium solution 4000rpm is centrifuged 10min, supernatant is abandoned, being suspended again with MS fluid nutrient mediums (pH 5.2) and being diluted to 50mL (adds AS to the μ of final concentration 100 M), 28 DEG C, for explant conversion is infected after 200rpm vibrations 4h.
(3) preculture of explant, infect and co-culture
Choose the full crop in cruciferae seed such as SUZHOUQING(sic) seed of external form 70% alcohol disinfecting 1min, 0.1% HgCl2Handle 18min, rinsed with sterile water 4 times, seed is placed on aseptic filter paper blot after be inoculated in seed germination medium, Condition of culture is：Illumination 12h, 2000~3000lx of light intensity, 25 DEG C of temperature.Treat that cotyledon is fully deployed, and cuts SUZHOUQING(sic) after 4~5d Cotyledons with petiole (carries the complete cotyledon of 1~2mm cotyledon petioles, and avoids taking growing point) oblique cutting and enters to pre-process in culture medium, Condition of culture is same as above.Explant is obtained by 2~3d precultures.
(4) Cotyledons with petiole Jing Guo 2~3d precultures is taken out to be placed in Agrobacterium prepared by step (2) and infect in bacterium solution and shaken Swing and infect 5min, unnecessary agrobacterium liquid is sucked with aseptic filter paper, separately take a sterilizing filter paper to be laid in and co-culture on base, use MS Fluid nutrient medium soaks, and the Cotyledons with petiole infected is placed on it, ensures cotyledon petiole incision contacts filter paper, 25 DEG C of light cultures 24 ~36h.
(5) adventitious shoot regeneration, screening and Plantlet formation
Blotted after Cotyledons with petiole after co-cultivation is rinsed 4 times with sterile purified water with sterilizing filter paper, be transferred to differentiation training Support base.Take the adventitious bud differentiated on cotyledon to be transferred on screening and culturing medium after 25d, carry out the screening and culturing of 2~3 times.Do not turn The adventitious bud dissolved is placed in culture on ordinary culture medium and is used as negative control.
(6) transfer-gen plant obtains
There is bleaching phenomenon in adventitious bud after 15 days, and unconverted control group adventitious bud is gradually dead in screening and culturing medium Die.The resistance seedling of survival is transferred in subculture medium and expand numerous, then is selected through culture of rootage to complete regeneration plant is produced The plant corkage hardening to grow fine, washes away the culture medium of root, moves in nutritive cube, by real after 2~3d of covered rearing with plastic film Raw seedling plant normal management.T0For plant after vernalization of surviving the winter, transgenic seed is obtained.
(7) positive plant PCR is identified
The plant new life blade extraction total serum IgE that herbicide screening is positive is taken, reverse transcription is obtained cDNA, entered with Cas9-F/R Performing PCR is verified.Primer sequence is preferably：Cas9-F：GATTGTATTTGTGTGTGTATAT, Cas9-R： CTGTGGAAGAATGAATCATCCA.Detection obtains 6 plants of positive plants, names T respectively0- 1, T0- 2, T0- 3, T0- 4, T0- 5, T0- 6。
The present invention compared with prior art, it is maximum the characteristics of be：
The present invention utilizes CRISPR-Cas9 systems, and editor is oriented to Chinese cabbage target gene, obtains mutant, operation Simply, effect is good, and the germplasm for being the research of Chinese cabbage gene function and merit being cultivated using transgenic technology is laid the first stone.
The present invention establish it is a kind of for Chinese cabbage CRISPR-Cas9 mediation genome editor's system, have it is simple to operate, Specific high, versatility is wide, and breakthrough revolution is brought for genome directional transformation regulation and control and application etc..
Beneficial effect of the invention relative to prior art：Invented a kind of new genome editor's system, and it is time-consuming compared with Short, also than relatively low, this has been established well expense for the research of gene function and using transgenic technology to cultivate new varieties Basis.
Brief description of the drawings
In order that the purpose of the present invention, technical method and effect more clearly show, the invention provides the following drawings：
Fig. 1：For pCas9-TPC carrier structure schematic diagrames.
Fig. 2：Enter to pre-process in culture medium as explant oblique cutting for this experiment SUZHOUQING(sic) Cotyledons with petiole used and carry out in advance The schematic diagram of culture.
Fig. 3：Adventitious bud to be differentiated on the SUZHOUQING(sic) explant of this experiment, which is transferred on screening and culturing medium, screens training Foster schematic diagram.
Fig. 4：For the plant strain growth schematic diagram after the screening and culturing of pCAS9-TPC empty carriers.
Fig. 5：Turn white completely for plant of the pCAS9-TPC-BcPDS after 3 screening and culturings.
Fig. 6：Identified for the Cas9 gene PCRs of transfer-gen plant.
Wherein, M:DL 2000bp DNAmarker；1:Plasmid positive control；2:Nontransgenic plants；3-8:Transgenosis is planted Strain
Specific embodiment
The following example is merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.It is unreceipted in embodiment Particular technique or condition person, carried out according to the technology described by document in the art or according to product description.It is used not The reagent indicated is the conventional reagent product that can be commercially available.If be not specifically stated, the solvent of solution is water.
Technical solution of the present invention is described in detail below, but protection scope of the present invention is not limited to the implementation Example.
Embodiment 1
(1) the Chinese cabbage gene editing carrier of pCas9 mediations is built：
Utilize Photographing On-line instrument http://cbi.hzau.edu.cn/crispr/ designs BcPDS gene sgRNA primers, Primer sequence is preferably：
sGAvrII-F1：GATCCTAGGAGCTTTCGTTGAACAACGGAAACT
PDSsGR1:GCTCTAAAACTCTTCATCCTTCCATGCAGCCAATCACTACTTCGACTCTAGCTG
PDSsGF2:AGTAGTGATTGGCTGCATGGAAGGATGAAGAGTTTTAGAGCTAGAAATAGCAAGT
sGAvrII-R2：GATCCTAGGGCCATTTGTCTGCAGAATTGGCGC
Underscore part in primer PDSsGR1 and PDSsGF2 is respectively sgRNA reverse complementary sequences and sgRNA positive Sequence, the specific nucleotide sequence of sgRNA forward directions sequence and sgRNA reverse complementary sequences is experimental implementation mistake in above-mentioned primer An example in journey, the in actual applications selection of sgRNA forward directions sequence and sgRNA reverse complementary sequences are not limited to this, There can be a variety of possibility, as long as sgRNA forward directions sequence selects first base to be before objective gene sequence NGG sequential structures The purpose of invention can be achieved in G 20bp sequences, and described sgRNA reverse complementary sequences and described sgRNA forward direction sequences are anti- To complementation.
Primer sGAvrIIF1/PDSsGR1, PDSsGF2/sGAvrIIR2 respectively using pChimera sgRNA vector as Template enters performing PCR amplification, and PCR primer carries out gel electrophoresis, and is purified with gel-purified QIAquick Gel Extraction Kit, and purifying purpose fragment is simultaneously Respectively take 1 μ l to carry out fusion DNA vaccine, after being not added with 10 circulations of primer amplification, add primer sGAvrIIF1/sGAvrIIR2 and enter performing PCR Amplification.Fusion DNA vaccine product is connected with expression vector pCas9-TPC not with AvrII digestions and with T4 ligases, fusion DNA vaccine product Fusion system with carrier is：Carrier：90ng, double chain DNA fragment：100ng, T4 ligase：1 μ l, 5xT4 ligases Buffer： 1 μ l, add aqua sterilisa to 10 μ l.PCR programs are：16℃10h.Connection product chemical method converts Trans-T1, containing grand mould 37 DEG C of the LB flat boards of plain (100ug/ml) stand overnight culture and obtain positive bacterium colony, and picking single bacterium colony enters performing PCR and identifies and be sequenced Checking.Described carrier pChimerasgRNA vector (plasmid numbers：CD3-1930), pCAS9-TPC (plasmid numbers： CD3-1927 www.arabidopsis.org, wherein carrier pChimera sgRNA vector and pCAS9-TPC sequence) are purchased from Row are as shown in SEQ ID NO.1 and SEQ ID NO.2.
(2) Cas9 expression vectors conversion Agrobacterium：
500ul bacterium solutions are taken to go to containing ampicillin (100ug/ the pCas9-TPC-BcPDS recombinant vectors verified Ml in LB culture mediums), expand numerous extraction plasmid, chemical method conversion GV3101, containing spectinomycin (100ug/ml) and sharp good fortune 28 DEG C of the LB flat boards quiescent culture 48 hours of flat (50ug/ml), picking single bacterium colony enter performing PCR checking.
(3) preparation of the preculture of explant and Agrobacterium bacterium solution：
Choose 70% alcohol disinfecting 1min, 0.1%HgCl of the full SUZHOUQING(sic) seed of external form2Handle 18min, sterilized water Rinsing 4 times, seed is placed on aseptic filter paper blot after be inoculated in seed germination medium, condition of culture is：Illumination 12h, light Strong 2000~3000lx, 25 DEG C of temperature.Treat that cotyledon is fully deployed after 4~5d, cut SUZHOUQING(sic) Cotyledons with petiole and (carry 1~2mm The complete cotyledon of petiole, avoids taking growing point) oblique cutting enters to pre-process in culture medium, and condition of culture is same as above.It is pre- by 2~3d Culture obtains explant (as shown in Figure 2).
The μ l of Agrobacterium bacterium solution 500 for taking step (2) to obtain are inoculated into the fresh LB of 50mL (50mg/L Km+50mg/L Rif 200rpm shaken overnights, be 0.5~0.6 to bacterium solution OD600 values) in fluid nutrient medium in 28 DEG C, by bacterium solution 4000rpm from Heart 10min, abandons supernatant, and being suspended again with MS fluid nutrient mediums (pH 5.2) and being diluted to 50mL (adds AS to final concentration 100 μM), 28 DEG C, for explant conversion is infected after 200rpm vibrations 4h.
(4) genetic transformation of Chinese cabbage plant：
Band handle blade after preculture in step (3) is taken out, is put into ready Agrobacterium bacterium solution, vibration is infected 5min, unnecessary agrobacterium liquid is sucked with aseptic filter paper, is separately taken a sterilizing filter paper to be laid in and is co-cultured on base, is trained with MS liquid Foster base soaks, and the Cotyledons with petiole infected is placed on it, ensures cotyledon petiole incision contacts filter paper, in 25 DEG C of light culture 30h.
(5) adventitious shoot regeneration, screening and Plantlet formation
Sterilizing filter paper suck dry moisture is used after Cotyledons with petiole after co-cultivation is rinsed 4 times with sterile purified water, is transferred to point Change culture medium.Take the adventitious bud differentiated on explant to be transferred on screening and culturing medium (as shown in Figure 3) after 25d, carry out 2~3 Secondary screening and culturing, each 25d.It is unconverted go out adventitious bud be placed on ordinary culture medium culture as negative control (such as Fig. 4 institutes Show).
(6) transfer-gen plant obtains
There is bleaching phenomenon (as shown in Figure 5) in adventitious bud after 15 days, and unconverted control group adventitious bud is in screening and culturing It is gradually dead in base.The resistance seedling of survival is transferred in subculture medium expand it is numerous then complete to producing through culture of rootage Regeneration plant, select the plant to grow fine to open hardening, wash away the culture medium of root, move in nutritive cube, covered rearing with plastic film 2 Seedling plant normal management is pressed after~3d.T0For plant after vernalization of surviving the winter, transgenic seed is obtained.
Culture medium prescription needed for experiment：
Seed germination medium：1/2MS+Agar (0.8%) pH 5.8
Pre-process culture medium：MS+2,4-D (0.lmg/L)+NAA (lmg/L)+Agar (0.8%) pH 5.8
Co-culture base：MS+2,4-D (0.l mg/L)+6BA (2mg/L)+AS (100 μM)+Agar (0.8%) pH 5.2
Differential medium：MN+6-BA(4mg/L)+NAA(0.5mg/L)+AgNO3(5mg/L)+Carb(500mg/L)+ Agar (0.9%) pH 5.8
Screening and culturing medium：MS+6-BA(2mg/L)+NAA(0.3mg/L)+Carb(500mg/L)+Km(50mg/L)+Agar (0.8%) pH 5.8
Subculture medium：MS+6-BA (0.5mg/L)+NAA (0.05mg/L)+KT (0.5mg/L)+Agar (0.8%) pH 5.8
Root media：B5+NAA (0.2mg/L)+Agar (0.7%) pH 5.8
(7) transfer-gen plant PCR is identified：
The plant new life blade extraction total serum IgE that herbicide screening is positive is taken, reverse transcription is obtained cDNA, entered with Cas9-F/R Performing PCR verifies (as shown in Figure 6).Primer sequence is preferably：
Cas9-F：GATTGTATTTGTGTGTGTATAT,
Cas9-R：CTGTGGAAGAATGAATCATCCA.
Detection obtains 6 plants of positive plants, names T respectively0- 1, T0- 2, T0- 3, T0- 4, T0- 5, T0-6。
General principle, principal character and the advantages of the present invention of the present invention has been shown and described above.Described implementation Example is part of the embodiment of the present invention, rather than whole embodiments.Based on the embodiment in the present invention, ordinary skill The every other embodiment that personnel are obtained under the premise of creative work is not made, belongs to the scope of protection of the invention. The scope of the present invention is defined by the appended claims and its equivalents.
Sequence table
<110>Agricultural University Of Nanjing
<120>A kind of foundation and its application of Chinese cabbage CRISPR-Cas9 gene editing systems
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 626
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
agctttcgtt gaacaacgga aactcgactt gccttccgca caatacatca tttcttctta 60
gctttttttc ttcttcttcg ttcatacagt ttttttttgt ttatcagctt acattttctt 120
gaaccgtagc tttcgttttc ttctttttaa ctttccattc ggagtttttg tatcttgttt 180
catagtttgt cccaggatta gaatgattag gcatcgaacc ttcaagaatt tgattgaata 240
aaacatcttc attcttaaga tatgaagata atcttcaaaa ggcccctggg aatctgaaag 300
aagagaagca ggcccattta tatgggaaag aacaatagta tttcttatat aggcccattt 360
aagttgaaaa caatcttcaa aagtcccaca tcgcttagat aagaaaacga agctgagttt 420
atatacagct agagtcgaag tagtgattgg gtcttcgaga agacctgttt tagagctaga 480
aatagcaagt taaaataagg ctagtccgtt atcaacttga aaaagtggca ccgagtcggt 540
gcttttttgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg tttttagcgc 600
gtgcgccaat tctgcagaca aatggc 626
<210> 2
<211> 7296
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gaattcaaaa attacggata tgaatatagg catatccgta tccgaattat ccgtttgaca 60
gctagcaacg attgtacaat tgcttcttta aaaaaggaag aaagaaagaa agaaaagaat 120
caacatcagc gttaacaaac ggccccgtta cggcccaaac ggtcatatag agtaacggcg 180
ttaagcgttg aaagactcct atcgaaatac gtaaccgcaa acgtgtcata gtcagatccc 240
ctcttccttc accgcctcaa acacaaaaat aatcttctac agcctatata tacaaccccc 300
ccttctatct ctcctttctc acaattcatc atctttcttt ctctaccccc aattttaaga 360
aatcctctct tctcctcttc attttcaagg taaatctctc tctctctctc tctctctgtt 420
attccttgtt ttaattaggt atgtattatt gctagtttgt taatctgctt atcttatgta 480
tgccttatgt gaatatcttt atcttgttca tctcatccgt ttagaagcta taaatttgtt 540
gatttgactg tgtatctaca cgtggttatg tttatatcta atcagatatg aatttcttca 600
tattgttgcg tttgtgtgta ccaatccgaa atcgttgatt tttttcattt aatcgtgtag 660
ctaattgtac gtatacatat ggatctacgt atcaattgtt catctgtttg tgtttgtatg 720
tatacagatc tgaaaacatc acttctctca tctgattgtg ttgttacata catagatata 780
gatctgttat atcatttttt ttattaattg tgtatatata tatgtgcata gatctggatt 840
acatgattgt gattatttac atgattttgt tatttacgta tgtatatatg tagatctgga 900
ctttttggag ttgttgactt gattgtattt gtgtgtgtat atgtgtgttc tgatcttgat 960
atgttatgta tgtgcagcga attcggcgcg ccatggataa gaagtactct atcggactcg 1020
atatcggaac taactctgtg ggatgggctg tgatcaccga tgagtacaag gtgccatcta 1080
agaagttcaa ggttctcgga aacaccgata ggcactctat caagaaaaac cttatcggtg 1140
ctctcctctt cgattctggt gaaactgctg aggctaccag actcaagaga accgctagaa 1200
gaaggtacac cagaagaaag aacaggatct gctacctcca agagatcttc tctaacgaga 1260
tggctaaagt ggatgattca ttcttccaca ggctcgaaga gtcattcctc gtggaagaag 1320
ataagaagca cgagaggcac cctatcttcg gaaacatcgt tgatgaggtg gcataccacg 1380
agaagtaccc tactatctac cacctcagaa agaagctcgt tgattctact gataaggctg 1440
atctcaggct catctacctc gctctcgctc acatgatcaa gttcagagga cacttcctca 1500
tcgagggtga tctcaaccct gataactctg atgtggataa gttgttcatc cagctcgtgc 1560
agacctacaa ccagcttttc gaagagaacc ctatcaacgc ttcaggtgtg gatgctaagg 1620
ctatcctctc tgctaggctc tctaagtcaa gaaggcttga gaacctcatt gctcagctcc 1680
ctggtgagaa gaagaacgga cttttcggaa acttgatcgc tctctctctc ggactcaccc 1740
ctaacttcaa gtctaacttc gatctcgctg aggatgcaaa gctccagctc tcaaaggata 1800
cctacgatga tgatctcgat aacctcctcg ctcagatcgg agatcagtac gctgatttgt 1860
tcctcgctgc taagaacctc tctgatgcta tcctcctcag tgatatcctc agagtgaaca 1920
ccgagatcac caaggctcca ctctcagctt ctatgatcaa gagatacgat gagcaccacc 1980
aggatctcac acttctcaag gctcttgtta gacagcagct cccagagaag tacaaagaga 2040
ttttcttcga tcagtctaag aacggatacg ctggttacat cgatggtggt gcatctcaag 2100
aagagttcta caagttcatc aagcctatcc tcgagaagat ggatggaacc gaggaactcc 2160
tcgtgaagct caatagagag gatcttctca gaaagcagag gaccttcgat aacggatcta 2220
tccctcatca gatccacctc ggagagttgc acgctatcct tagaaggcaa gaggatttct 2280
acccattcct caaggataac agggaaaaga ttgagaagat tctcaccttc agaatccctt 2340
actacgtggg acctctcgct agaggaaact caagattcgc ttggatgacc agaaagtctg 2400
aggaaaccat caccccttgg aacttcgaag aggtggtgga taagggtgct agtgctcagt 2460
ctttcatcga gaggatgacc aacttcgata agaaccttcc aaacgagaag gtgctcccta 2520
agcactcttt gctctacgag tacttcaccg tgtacaacga gttgaccaag gttaagtacg 2580
tgaccgaggg aatgaggaag cctgcttttt tgtcaggtga gcaaaagaag gctatcgttg 2640
atctcttgtt caagaccaac agaaaggtga ccgtgaagca gctcaaagag gattacttca 2700
agaaaatcga gtgcttcgat tcagttgaga tttctggtgt tgaggatagg ttcaacgcat 2760
ctctcggaac ctaccacgat ctcctcaaga tcattaagga taaggatttc ttggataacg 2820
aggaaaacga ggatatcttg gaggatatcg ttcttaccct caccctcttt gaagatagag 2880
agatgattga agaaaggctc aagacctacg ctcatctctt cgatgataag gtgatgaagc 2940
agttgaagag aagaagatac actggttggg gaaggctctc aagaaagctc attaacggaa 3000
tcagggataa gcagtctgga aagacaatcc ttgatttcct caagtctgat ggattcgcta 3060
acagaaactt catgcagctc atccacgatg attctctcac ctttaaagag gatatccaga 3120
aggctcaggt ttcaggacag ggtgatagtc tccatgagca tatcgctaac ctcgctggat 3180
ctcctgcaat caagaaggga atcctccaga ctgtgaaggt tgtggatgag ttggtgaagg 3240
tgatgggaag gcataagcct gagaacatcg tgatcgaaat ggctagagag aaccagacca 3300
ctcagaaggg acagaagaac tctagggaaa ggatgaagag gatcgaggaa ggtatcaaag 3360
agcttggatc tcagatcctc aaagagcacc ctgttgagaa cactcagctc cagaatgaga 3420
agctctacct ctactacctc cagaacggaa gggatatgta tgtggatcaa gagttggata 3480
tcaacaggct ctctgattac gatgttgatc atatcgtgcc acagtcattc ttgaaggatg 3540
attctatcga taacaaggtg ctcaccaggt ctgataagaa caggggtaag agtgataacg 3600
tgccaagtga agaggttgtg aagaaaatga agaactattg gaggcagctc ctcaacgcta 3660
agctcatcac tcagagaaag ttcgataact tgactaaggc tgagagggga ggactctctg 3720
aattggataa ggcaggattc atcaagaggc agcttgtgga aaccaggcag atcactaagc 3780
acgttgcaca gatcctcgat tctaggatga acaccaagta cgatgagaac gataagttga 3840
tcagggaagt gaaggttatc accctcaagt caaagctcgt gtctgatttc agaaaggatt 3900
tccaattcta caaggtgagg gaaatcaaca actaccacca cgctcacgat gcttacctta 3960
acgctgttgt tggaaccgct ctcatcaaga agtatcctaa gctcgagtca gagttcgtgt 4020
acggtgatta caaggtgtac gatgtgagga agatgatcgc taagtctgag caagagatcg 4080
gaaaggctac cgctaagtat ttcttctact ctaacatcat gaatttcttc aagaccgaga 4140
ttaccctcgc taacggtgag atcagaaaga ggccactcat cgagacaaac ggtgaaacag 4200
gtgagatcgt gtgggataag ggaagggatt tcgctaccgt tagaaaggtg ctctctatgc 4260
cacaggtgaa catcgttaag aaaaccgagg tgcagaccgg tggattctct aaagagtcta 4320
tcctccctaa gaggaactct gataagctca ttgctaggaa gaaggattgg gaccctaaga 4380
aatacggtgg tttcgattct cctaccgtgg cttactctgt tctcgttgtg gctaaggttg 4440
agaagggaaa gagtaagaag ctcaagtctg ttaaggaact tctcggaatc actatcatgg 4500
aaaggtcatc tttcgagaag aacccaatcg atttcctcga ggctaaggga tacaaagagg 4560
ttaagaagga tctcatcatc aagctcccaa agtactcact cttcgaactc gagaacggta 4620
gaaagaggat gctcgcttct gctggtgagc ttcaaaaggg aaacgagctt gctctcccat 4680
ctaagtacgt taactttctt tacctcgctt ctcactacga gaagttgaag ggatctccag 4740
aagataacga gcagaagcaa cttttcgttg agcagcacaa gcactacttg gatgagatca 4800
tcgagcagat ctctgagttc tctaaaaggg tgatcctcgc tgatgcaaac ctcgataagg 4860
tgttgtctgc ttacaacaag cacagagata agcctatcag ggaacaggca gagaacatca 4920
tccatctctt cacccttacc aacctcggtg ctcctgctgc tttcaagtac ttcgatacaa 4980
ccatcgatag gaagagatac acctctacca aagaagtgct cgatgctacc ctcatccatc 5040
agtctatcac tggactctac gagactagga tcgatctctc acagctcggt ggtgattcaa 5100
gggctgatcc taagaagaag aggaaggttt gaggcgcgcc gagctccagg cctcccagct 5160
ttcgtccgta tcatcggttt cgacaacgtt cgtcaagttc aatgcatcag tttcattgcc 5220
cacacaccag aatcctacta agtttgagta ttatggcatt ggaaaagctg ttttcttcta 5280
tcatttgttc tgcttgtaat ttactgtgtt ctttcagttt ttgttttcgg acatcaaaat 5340
gcaaatggat ggataagagt taataaatga tatggtcctt ttgttcattc tcaaattatt 5400
attatctgtt gtttttactt taatgggttg aatttaagta agaaaggaac taacagtgtg 5460
atattaaggt gcaatgttag acatataaaa cagtctttca cctctctttg gttatgtctt 5520
gaattggttt gtttcttcac ttatctgtgt aatcaagttt actatgagtc tatgatcaag 5580
taattatgca atcaagttaa gtacagtata ggcttgagct ccctaggccc gggcctgagg 5640
acgcgtccat ggttaattaa gacgtccgga ccgactagtg gatcctctag agtcgacctg 5700
caggcatgca agcttcttcg tcaacatggt ggagcacgac acgcttgtct actccaaaaa 5760
tatcaaagat acagtctcag aagaccaaag ggcaattgag acttttcaac aaagggtaat 5820
atccggaaac ctcctcggat tccattgccc agctatctgt cactttattg tgaagatagt 5880
ggaaaaggaa ggtggctcct acaaatgcca tcattgcgat aaaggaaagg ccatcgttga 5940
agatgcctct gccgacagtg gtcccaaaga tggaccccca cccacgagga gcatcgtgga 6000
aaaagaagac gttccaacca cgtcttcaaa gcaagtggat tgatgtgata tctccactga 6060
cgtaagggat gacgcacaat caatcccact atccttcgca agaccctttt aagggggaag 6120
ttcatttcat ttggagagga cacgctgaaa tcaccagtct ctctgtacaa atcnatctct 6180
ctctataata ttgtgtaagt agttcccaga taagggaatt agggttctta tagggtttcg 6240
ctcagctgtt gagcatataa gaaaccctta gtcgatagat ctgttgggga tctaccatga 6300
gcccagaacg acgcccggcc gacatccgcc gtgccaccga ggcggacatg ccggcggtct 6360
gcaccatcgt caaccactac atcgagacaa gcacggtcaa cttccgtacc gagccgcagg 6420
aaccgcagga gtggacggac gacctcgtcc gtctgcggga gcgctatccc tggctcgtcg 6480
ccgaggtgga cggcgaggtc gccggcatcg cctacgcggg cccctggaag gcacgcaacg 6540
cctacgactg gacggccgag tcgaccgtgt acgtctcccc ccgccaccag cggacgggac 6600
tgggctccac gctctacacc cacctgctga agtccctgga ggcacagggc ttcaagagcg 6660
tggtcgctgt catcgggctg cccaacgacc cgagcgtgcg catgcacgag gcgctcggat 6720
atgccccccg cggcatgctg cgggcggccg gcttcaagca cgggaactgg catgacgtgg 6780
gtttctggca gctggacttc agcctgccgg taccgccccg tccggtcctg cccgtcaccg 6840
agatctgatg acccaactta gtatgtattt gtatttgtaa aatacttcta tcaataaaat 6900
ttctaattcc taaaaccaaa atccaggggt accgaacaag cttggcactg gccgtcgttt 6960
tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc 7020
cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt 7080
tgcgcagcct gaatggcgaa tgagcttgag cttggatcag attgtcgttt cccgccttca 7140
gtttaaacta tcagtgtttg acaggatata ttggcgggta aacctaagag aaaagagcgt 7200
ttattagaat aacggatatt taaaagggcg tgaaaaggtt tatccgttcg tccatttgta 7260
tgtgcatgcc aaccacaggg ttcccctcgg gatcaa 7296

Claims (10)

  1. A kind of 1. plant gene editor's carrier of CRISPR-Cas9 mediations, it is characterised in that：Built using following methods：Design Two couples of sgRNA primer sGAvrIIF1/sGR1 and sGF2/sGAvrIIR2, the sequence of the primer are respectively：
    sGAvrIIF1：GATCCTAGGAGCTTTCGTTGAACAACGGAAACT
    sGR1：GCTCTAAAAC (sgRNA reverse complementary sequences) CAATCACTACTTCGACTCTAGCTG
    sGF2：AGTAGTGATT (sgRNA forward directions sequence) GTTTTAGAGCTAGAAATAGCAAGT
    sGAvrIIR2：GATCCTAGGGCCATTTGTCTGCAGAATTGGCGC；
    Respectively using pChimera sgRNA vector as template enter performing PCR amplification, take respectively purifying purpose fragment with SGAvrIIF1/sGAvrIIR2 is that primer carries out fusion DNA vaccine；By carrier pCAS9-TPC and the company of fusion after fusion DNA vaccine product digestion Connect, fusion connection product conversion Escherichia coli, acquisition positive bacteria drops into row culture extraction plasmid and obtains plant gene editor's carrier.
  2. 2. the transgenosis recombinant bacterium containing plant gene editor carrier described in claim 1.
  3. 3. the transgenosis recombinant bacterium described in plant gene editor carrier or claim 2 described in claim 1 is in Cruciferae Application in crop gene editor.
  4. 4. applications of the carrier pCAS9-TPC as shown in SEQ ID NO.2 in plant gene editor.
  5. 5. a kind of method for building up of crop in cruciferae CRISPR-Cas9 gene editing systems, it is characterised in that including following step Suddenly：
    (1) plant gene editor's carrier of CRISPR-Cas9 mediations is built：Design two couples of sgRNA primers sGAvrIIF1/sGR1 And sGF2/sGAvrIIR2, the sequence of the primer are respectively：
    sGAvrIIF1：GATCCTAGGAGCTTTCGTTGAACAACGGAAACT
    sGR1：GCTCTAAAAC (sgRNA reverse complementary sequences) CAATCACTACTTCGACTCTAGCTG
    sGF2：AGTAGTGATT (sgRNA forward directions sequence) GTTTTAGAGCTAGAAATAGCAAGT
    sGAvrIIR2：GATCCTAGGGCCATTTGTCTGCAGAATTGGCGC；
    Respectively using pChimera sgRNA vector as template enter performing PCR amplification, take respectively purifying purpose fragment with SGAvrIIF1/sGAvrIIR2 is that primer carries out fusion DNA vaccine；By carrier pCAS9-TPC and the company of fusion after fusion DNA vaccine product digestion Connect, fusion connection product conversion Escherichia coli, acquisition positive bacteria drops into row culture extraction plasmid and obtains plant gene editor's carrier；
    (2) plant gene editor's support chemistry method that step (1) obtains is transferred to Agrobacterium；
    (3) it is transferred to after crop in cruciferae seed disinfection after seed germination medium culture to cotyledon period in pretreatment culture medium Culture, obtain explant；
    (4) Agrobacterium that step (2) obtains is infected into conversion explant to be placed in being co-cultured on co-cultivation base；
    (5) explant after co-cultivation is transferred to after differential medium culture differentiates adventitious bud to explant, trained with screening Support the screening and culturing that base carries out 2~3 times；
    (6) will screen the resistance seedling that obtains be transferred in subculture medium expand it is numerous, then through root media culture of rootage to producing In raw complete plant, T0 generations, obtain transgenic seed through vernalization of surviving the winter.
  6. 6. the method for building up of crop in cruciferae CRISPR-Cas9 gene editing systems according to claim 5, its feature It is：
    Described seed germination medium：1/2MS+Agar (0.8%) pH 5.8
    Described pretreatment culture medium：MS+2,4-D (0.l-0.2mg/L)+NAA (l-1.5mg/L)+Agar (0.8%) pH 5.8
    Described co-cultivation base：MS+2,4-D(0.l-0.2mg/L)+6BA(1.5-2.5mg/L)+AS(100μM)+Agar (0.8%) pH 5.2
    Described differential medium：MN+6-BA(3-5mg/L)+NAA(0.5-1mg/L)+AgNO3(3-5mg/L)+Carb(400- 500mg/L)+Agar (0.9%) pH 5.8
    Described screening and culturing medium：MS+6-BA(1.5-2mg/L)+NAA(0.2-0.4mg/L)+Carb(400-500mg/L)+Km (40-50mg/L)+Agar (0.8%) pH 5.8
    Described subculture medium：MS+6-BA(0.5-1mg/L)+NAA(0.02-0.1mg/L)+KT(0.5-1mg/L)+Agar (0.8%) pH 5.8
    Described root media：B5+NAA (0.1-0.3mg/L)+Agar (0.7%) pH 5.8.
  7. 7. the method for building up of crop in cruciferae CRISPR-Cas9 gene editing systems according to claim 5, its feature It is：The screening and culturing medium of positive bacterium colony described in step (1) is the LB culture mediums containing spectinomycin, screens the positive bacteria The condition of culture fallen is 37 DEG C, 250rpm concussion and cultivates.
  8. 8. the method for building up of crop in cruciferae CRISPR-Cas9 gene editing systems according to claim 5, its feature It is：After crop in cruciferae seed disinfection seed germination medium culture to cotyledon period condition of culture for light intensity 2000~ 3000lx, 25 DEG C of temperature.
  9. 9. the method for building up of crop in cruciferae CRISPR-Cas9 gene editing systems according to claim 5, its feature It is：The condition of culture of the co-cultivation is 25 DEG C of 24~36h of light culture.
  10. 10. application of any described method in Chinese cabbage gene editing in claim 5~9.
CN201710949078.1A 2017-10-12 2017-10-12 A kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems Pending CN107557381A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710949078.1A CN107557381A (en) 2017-10-12 2017-10-12 A kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710949078.1A CN107557381A (en) 2017-10-12 2017-10-12 A kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems

Publications (1)

Publication Number Publication Date
CN107557381A true CN107557381A (en) 2018-01-09

Family

ID=60984500

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710949078.1A Pending CN107557381A (en) 2017-10-12 2017-10-12 A kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems

Country Status (1)

Country Link
CN (1) CN107557381A (en)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
CN111543307A (en) * 2020-05-08 2020-08-18 南京农业大学 Identification method for gene editing efficiency of Chinese cabbage or broccoli CRISPR-Cas9 gene editing system
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
CN112063651A (en) * 2020-08-20 2020-12-11 江苏省农业科学院 Method for directionally editing common head cabbage gene by using CRISPR/Cas9 and application
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
CN113549617A (en) * 2021-06-03 2021-10-26 南京农业大学 sgRNA for editing non-heading Chinese cabbage CENH3 gene, CRISPR/Cas9 vector and application thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11999947B2 (en) 2023-02-24 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107236737A (en) * 2017-05-19 2017-10-10 上海交通大学 The sgRNA sequences of special target arabidopsis ILK2 genes and its application

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107236737A (en) * 2017-05-19 2017-10-10 上海交通大学 The sgRNA sequences of special target arabidopsis ILK2 genes and its application

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
E. K. KHLESTKINA等: "Prospects for Application of Breakthrough Technologies in Breeding:The CRISPR/Cas9 System for Plant Genome Editing", 《RUSSIAN JOURNAL OF GENETICS》 *
SIMON SCHI等: "《Chromosome and Genomic Engineering in Plants》", 31 December 2016 *
王晓霞等: "CRISPR-Cas9 植物基因编辑系统敲除拟南芥AG 基因表达载体的构建", 《分子植物育种》 *
王钊辉等: "AtPHO2 的CRISPR/Cas9 靶向敲除及其在拟南芥中功能分析", 《河南农业大学学报》 *

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12006520B2 (en) 2019-06-14 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
CN111543307A (en) * 2020-05-08 2020-08-18 南京农业大学 Identification method for gene editing efficiency of Chinese cabbage or broccoli CRISPR-Cas9 gene editing system
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
CN112063651A (en) * 2020-08-20 2020-12-11 江苏省农业科学院 Method for directionally editing common head cabbage gene by using CRISPR/Cas9 and application
CN113549617B (en) * 2021-06-03 2023-06-30 南京农业大学 sgRNA editing non-heading cabbage CENH3 gene, CRISPR/Cas9 vector and application thereof
CN113549617A (en) * 2021-06-03 2021-10-26 南京农业大学 sgRNA for editing non-heading Chinese cabbage CENH3 gene, CRISPR/Cas9 vector and application thereof
US11999947B2 (en) 2023-02-24 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof

Similar Documents

Publication Publication Date Title
CN107557381A (en) A kind of foundation and its application of Chinese cabbage CRISPR Cas9 gene editing systems
CN101948867B (en) Agrobacterium-mediated jatropha curcas gene transformation method
CN102220277B (en) Method for building high-efficiency regenerating and transforming system of Oryza sativaL. subsp. japonica 11
CN103966258A (en) Agrobacterium tumefaciens mediated cabbage type oilseed rape genetic transformation method
WO2022135246A1 (en) R gene for controlling matching of soybean-rhizobium, protein and use thereof
CN101457235A (en) Method for converting lucerne by vacuum penetrating auxiliary agrobacterium-mediated
CN106480163B (en) A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene
CN103525828B (en) Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof
CN106636185A (en) Culture medium and method for highly efficient regeneration and genetic transformation of somatic embryo of potato stems
CN106755071A (en) Method and its application of transgenic peanuts are quickly obtained using peanut cotylcdon
CN103060372B (en) Method for culturing agrobacterium-mediated transgenic salix matsudana plants
CN105039396A (en) Silvergrass seed callus transforming method mediated by agrobacterium and application of method
CN1597969A (en) Double T-DNA carrier and its application in cultivating of non selecting sign transgene rice
CN107446933A (en) One grows tobacco natural resistance associated macrophage protein gene and its application
Chen et al. Agrobacterium-mediated genetic transformation of peanut and the efficient recovery of transgenic plants
CN105441479A (en) Establishment method of Dendrocalamus hamiltonii transgene system
CN113755521B (en) Construction method of agrobacterium-mediated strawberry &#39;sweet Charles&#39; genetic transformation system
CN102796761B (en) Agrobacterium-mediated transgenic method of P. tremula*P. tremuloides
CN109984041A (en) It is a kind of using blade as the azalea transgenic method of explant
CN102051376B (en) Tissue culture system based on chloroplast transformation in rape cotyledons and method for obtaining transformed plant
CN101233824B (en) High-efficiency genetic transforming method of micro potato
CN104017823B (en) Screening method for fast and effectively reducing false positive rate of peanut genetic transformation plant
CN107794278A (en) A kind of quick transgenic method of comospore poplar based on hygromycin selection
CN1582641A (en) Tetraploid transgenic locust and quick cultivation
CN112889668A (en) Populus genetic transformation method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20180109

RJ01 Rejection of invention patent application after publication