CN107447021A - A kind of method and its application of the accurate identification genotype based on high-flux sequence - Google Patents
A kind of method and its application of the accurate identification genotype based on high-flux sequence Download PDFInfo
- Publication number
- CN107447021A CN107447021A CN201710802423.9A CN201710802423A CN107447021A CN 107447021 A CN107447021 A CN 107447021A CN 201710802423 A CN201710802423 A CN 201710802423A CN 107447021 A CN107447021 A CN 107447021A
- Authority
- CN
- China
- Prior art keywords
- sequence
- nucleotide sequence
- genotype
- accurate identification
- sequence set
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method of accurate identification genotype, and it is based on high-flux sequence, comprised the following steps：High-flux sequence is carried out to the genetic fragment that amplification obtains, obtains nucleotide sequence set；Nucleotide sequence set is handled, exclusive PCR sequence, obtain effective nucleotide sequence set；Repetitive sequence analysis is carried out to effective nucleotide sequence set；Statistical analysis output result is carried out to the effectively nucleotide sequence set.The method of the present invention can efficiently and accurately detect the genotype per item chromosome in mutant cells or tissue, using and can automatically remove by the non-specific sequence brought into is sequenced, and the percentage that each mutant nucleotide sequence is occupied is summarized, there is very useful commercial value.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of side of the accurate identification genotype based on high-flux sequence
Method and its application.
Background technology
Gene editing technology has just served on industrial production, medical science detection and clinical treatment since the birth huge
Effect.With the development of molecular biology technology, also become more next to CRISPR-Cas9, gene editing again from ZFN to Talen
It is more simple and easy to do.Nowadays, either drug screening, the research and development of transgene agricultural product, or gene therapy, need to make without exception
With gene editing technology.
However, the detection of genotype is not a nothing the matter after gene editing.Due to most biologies or groups of cells
It is all diploid even triploid to knit, and gene editing technology has certain randomness, the editor of each chromatid
Situation is not necessarily identical, so the definite gene order for wanting to accurately detect its each chromatid is not one easy
Thing.If cloning detection method using traditional TA, numerous and diverse operating procedure and substantial amounts of sequencing amount are not only needed, its is final
As a result it is also and inaccurate；One sample can only identify most tens sequences, be not statistically significant；When sample size is big, its
Price is high；Because sequencing amount is eventually limited, or even it is also possible to inaccurate, and result show it is unfriendly, it is necessary to manual analysis.
Therefore, the biologic medical field of accurate and quick detection is being needed, those skilled in the art are directed to exploitation one
Kind mutant gene type authentication method accurate, with a high credibility and fast and convenient and its application.
The content of the invention
Each chromatid in mutant cells or tissue can not be efficiently and accurately detected in view of prior art
Genotype, the technical problems to be solved by the invention are to provide a kind of accurate identification mutant gene based on high-flux sequence
The method and its application of type.
A kind of one aspect of the present invention, there is provided side of the accurate identification mutant gene type based on high-flux sequence
Method, it is preferably carried out at one in mode, the method for accurate identification genotype is based on high-flux sequence.
This method comprises the following steps：
1) high-flux sequence is carried out to the genetic fragment that amplification obtains, obtains nucleotide sequence set；
2) the nucleotide sequence set is handled, exclusive PCR sequence, obtains effective nucleotide sequence set；To institute
State effective nucleotide sequence set and carry out repetitive sequence analysis；
3) statistical analysis is carried out to effective nucleotide sequence set, obtains nucleotide sequence, the difference of different genotype
The nucleotides sequence of genotype is listed in the accounting in effective nucleotide sequence set.
Further, in step 3), statistical analysis also includes, and is listed according to the nucleotides sequence of different genotype above-mentioned effective
Accounting in nucleotide sequence set is ranked up to the nucleotide sequence of above-mentioned different genotype from more to few.
Further, in step 3), statistical analysis also includes the type for counting the nucleotide sequence of above-mentioned different genotype
Sum.
Further, in step 2), processing also includes preliminary exclusive PCR sequence, including sub-elects the nucleotide sequence
The sequence with amplimer in set, screens the sequence containing effective information.
Preferably, the sequence containing effective information is screened to comprise the following steps：It is determined that needed for the minimum containing effective information
Base number；The sequence with amplimer sub-elected according to base number needed for the minimum, so as to preliminary exclusive PCR sequence
Row.
Preferably, base number needed for minimum is determined according to the following steps：To the sequence with amplimer sub-elected, from every
First beginning sequence analysis after high-flux sequence joint in the amplimer of bar sequence, until all specific sequences
In X positions be effective information, the X positions for minimum needed for base number.
Further, in step 2), repetitive sequence analysis is：The sequence in effective nucleotide sequence set is carried out one by one
Analysis, for the inconsistent sequence of the sequence with having counted, is started counting up from 1；For one of the sequence with having counted identical
Sequence, carry out counting from increasing in corresponding sequence.
Further, in step 2), while repetitive sequence is analyzed, the quantity of effective nucleotide sequence is counted
From increasing.
Alternatively, in step 1), above-mentioned high-flux sequence is sequenced for two generations.
Further, in step 1), when being expanded to genetic fragment, the amplimer of use includes high pass and measures joint
Part and extension increasing sequence part.
Further, in step 1), the sequence containing amplimer is sorted out according to extension increasing sequence part.
Preferably, amplimer also includes index part, for carrying out same gene loci in different samples
Different samples is distinguished during identification.
Another aspect provides the method for above-mentioned accurate identification genotype answering in purpose mutant is screened
With.
Further, the purpose mutant is the mutant obtained by artificial method or natural method.
Further, artificial method is physics mode, chemical mode or gene editing technology.
Further, the mutant is mutant cells.
The method of accurate identification genotype provided by the invention based on high-flux sequence, can efficiently and accurately be detected
Go out the genotype of each chromatid in cell or tissue, using and can automatically remove by the non-specific sequence brought into is sequenced
Row, and summarize the percentage that each mutant nucleotide sequence is occupied.The present invention produces except that can identify by gene editing
Outside raw mutant, the DNA sequence dna of artificial or natural point mutation and any desired identification can also be identified.With existing identification
Method is compared, and qualification result is accurate, operation is relatively simple, and time-consuming shorter, a sample can measure hundreds thousand of sequences, have
Statistical significance, it is cheaper than TA clones when sample size is big, as a result show very friendly, immediately arrive at analysis result, have very
Practical commercial value.
Design, specific steps and the caused technique effect of the present invention are described further below with reference to accompanying drawing, with
It is fully understood from the purpose of the present invention, feature and effect.
Brief description of the drawings
Fig. 1 is the PCR primer schematic diagram of one embodiment of the present of invention.
Fig. 2 is the pretreatment process schematic diagram of one embodiment of the present of invention.
Fig. 3 is the formal handling process schematic diagram of one embodiment of the present of invention.
Embodiment
The experimental method of unreceipted actual conditions in following examples, generally according to normal condition, such as Sambrook etc.
Molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) described in
Condition, or according to proposed by manufacturer condition carry out.
An aspect of of the present present invention provides a kind of method of accurate identification genotype, and this method is based on high-flux sequence, because
This, can fast and accurately obtain result.
In a detailed embodiment, this method includes：
1) high-flux sequence is carried out to the genetic fragment that amplification obtains, obtains nucleotide sequence set；
Wherein, genetic fragment is expanded from the genome of mutant and obtained；Nucleosides is obtained by way of high-flux sequence
Acid sequence set.The method of high-flux sequence can be in the prior art any one, such as two generation sequence measurements specifically can be with
It is 454 technologies, the Solexa technologies of Illumina companies, Hiseq technologies or the Solid technologies of ABI companies of Roche companies；
2) the nucleotide sequence set is handled, exclusive PCR sequence, obtains effective nucleotide sequence set；To having
Imitate nucleotide sequence set and carry out repetitive sequence analysis；
The nucleotide sequence set obtained to sequencing is analyzed, and gets rid of that (such as sequencing result is not containing invalid information
Good or non-specific amplification) interference sequence.To remaining effectively nucleotide sequence set, sequence alignment point is carried out one by one
Analysis, for the inconsistent sequence of the sequence with having counted, is started counting up from 1；For one of sequence with having counted identical sequence
Row, carry out counting from increasing in corresponding sequence.Thus, it is possible to obtain sequence consistent sequence and its quantity, have multiple different
During sequence, a plurality of sequence and the quantity of a plurality of sequence respectively are just produced.Meanwhile in all effectively nucleotide sequence set
Sequence counted, obtain the sum of ordered sequence.
3) statistical analysis is carried out to effective nucleotide sequence set, obtains nucleotide sequence, the difference of different genotype
The nucleotides sequence of genotype is listed in the accounting in effective nucleotide sequence set；According to accounting from more to few Sequential output sequence
Row, accounting value, the sequence sum；The number of types of the nucleotide sequence of different genotype is exported simultaneously；
I.e. by the counting statistics result in step 2), the nucleotides sequence for calculating different genotype is listed in effective nucleotides sequence
Accounting in row set, is then ranked up and exports.
In another embodiment, this method includes：
1) high-flux sequence is carried out to the genetic fragment that amplification obtains, obtains nucleotide sequence set；As detailed above；
2) to the preliminary exclusive PCR sequence of the nucleotide sequence set, including：
By analyzing amplimer, the sequence containing effective information is screened, that is, is filtered out with amplimer
Sequence.The nucleotide sequence set obtained to high-flux sequence sorts, and sub-elects including amplimer, it preferably includes rope
Draw the sequence of part and extension increasing sequence part；If amplimer does not include index part, sub-elect including amplimer part
Sequence；
The sequence containing effective information is screened, that is, determines base number needed for the minimum containing effective information；According to minimum institute
The sequence with amplimer that base number sub-elects is needed, so as to preliminary exclusive PCR sequence.
In a preferred embodiment, base number needed for the minimum is determined according to the following steps：Carried to what is sub-elected
The sequence of amplimer, the order point since first after the high-flux sequence joint in the amplimer of every sequence
Analysis, until the X positions in all specific sequences are effective information, the X positions are base number needed for minimum.
3) exclusive PCR sequence obtains effective nucleotide sequence set again, and carries out repetitive sequence analysis；Repetitive sequence
The method of analysis and the result of acquisition are as described above；
4) statistical analysis is carried out to effective nucleotide sequence set, obtains nucleotide sequence, the difference of different genotype
The nucleotides sequence of genotype is listed in the accounting in effective nucleotide sequence set；According to accounting from more to few Sequential output sequence
Row, accounting value, the sequence sum；The number of types of the nucleotide sequence of different genotype is exported simultaneously.
Above two embodiment, the friendly of result is shown with reference to high-flux sequence and data, facilitates reality
Operation, application prospect are big.
Another aspect of the present invention provides a kind of method that quick screening obtains purpose mutation.In a specific implementation
In mode, first, mutant is obtained by artificial method or natural method, for example, by physical method (ultraviolet irradiates,
X-ray bombardment etc.), chemical method (using mutagens) or gene editing technology obtain mutant group；Then, genome is extracted
DNA, and expanded, the mutant of acquisition is analyzed using the method for above-mentioned accurate identification genotype；Finally, according to point
Analysis result selects the mutant containing targeted mutagenesis.The cell mutant being achieved in that, it is single that each dyeing can be apparent from
The genotype of body is therefore, as a result more accurate；Simultaneously as being combined with high-flux sequence, highly shortened to mutant group
In mutant qualification time.
Embodiment
The present embodiment (is purchased from ATCC from a HepG2 cell using CRISPR-Cas9 technologies progress gene editing；
Article No.：HB-8065 monoclonal cell) is tested, and the gene editing site of the monoclonal cell is UGT1A genes (NCBI
Gene ID:7361) a DNA fragmentation (chr2 in:234526291-234678310 (GRCh37/hg19)), we choose
A pair beyond DNA editing sites, amplification sequence of the Specific PCR primers as amplimer inwardly simultaneously in opposite direction
Arrange part.
1st, design of primers
First, one couple of PCR primers is designed, the PCR primer includes：1) second generation sequencing junction portion used；2) it is used for
Sort the index part used in each sample；3) the extension increasing sequence part of sequence to be detected is expanded.The schematic diagram of the PCR primer
As shown in Figure 1.
1) second generation sequencing junction portion sequence used is as follows：
It is positive：
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(SEQ ID
No.1)
Reversely：
CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ ID
No.2)
2) index part
Index sequence is the part that may be selected to include, when needs carry out the mirror of same gene loci in different samples
Regularly, in order to distinguish different samples, it is necessary to using index sequence.Index sequence can be 2bp or longer small fragment sequence,
,, can also be according to different ropes even if extension increasing sequence is identical when sorting data between joint sequence and extension increasing sequence
Draw sequence to make a distinction.
In the present embodiment, amplimer has index part.But skilled person will appreciate that, retouched according to above-mentioned
State, index part it is not necessary to, can be chosen whether to need according to actual conditions to design index part.
3) the extension increasing sequence part of sequence to be detected is expanded
The part needs designed, designed, and its position is in the peripheral both sides of gene order to be detected, according to following design of primers
Principle finds specific primer：
(1) remove (repeat masker) software with repetitive sequence and remove redundant sequence in candidate sequence；
(2) primer length 22bp or so；
(3) G/C content is close to 50%；
(4) end of primer 3 ' is preferably selected guanine or cytimidine, reduces mispairing initiation rate；
(5) there can not be the complementation of continuous 4 bases in primer or between primer；
(6) guanine three and more than three should be avoided to repeat.
Then simulation (in silico) checking of primer specificity is carried out：(1) by using Blast- in NCBI websites
Primer instruments search the specificity of checking primer in all species；(2) in-Silico PCR works are used in UCSC websites
The specificity of tool checking PCR primer.
The primer sequence of the present embodiment design is as follows：
Forward primer (SEQ ID No.3)：
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTtgggatgcagtgattat
ttcc
Reverse primer (SEQ ID No.4)：
CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTccttctgaatcattgcatc
g
Wherein, the underscore part in forward primer is index part, and the bolded section in two sequences is junction portion,
Italicized item is extension increasing sequence part.
2nd, the acquisition of genomic DNA and the amplification of purpose fragment
Sample source is in the above-mentioned HepG2 monoclonal cells that gene editing is carried out by CRISPR-Cas9 technologies, about
The cell concentration (about 4 × 10 in a hole in one 6 orifice plate6Individual cell).The extraction of genomic DNA uses Promega genome
DNA extraction kit.
Pcr amplification reaction system be 20 microlitres, each 0.6 microlitre comprising the forward and reverse primers of 10uM, 2 microlitres of DNA profiling, 2 ×
10 microlitres of PCR Mix, 6.8 microlitres of MiliQ water.PCR cycle parameter is pre-degeneration 94 degree, 3 minutes；94 degree of denaturation, 15 seconds, is moved back
60 degree, 30 seconds of fire；72 degree of extension, 1 minute, period 40；72 degree, 7 minutes of end extension eventually.
3rd, result verification
After obtaining PCR primer, sample is subjected to second generation sequencing, Treatment Analysis is carried out to sequencing result.
Treatment Analysis method in the present embodiment includes the pretreatment of data and formal processing two parts.Wherein, pre-process
Schematic flow sheet as shown in Fig. 2 the schematic flow sheet formally handled is as shown in Figure 3.
Original set is obtained to sequencing first to pre-process.Pretreatment includes：
(P100) sort：Original set is pre-processed according to index part and amplimer part, selects bag
Include the sequence of index part and amplimer part；
Skilled person will appreciate that in another embodiment, if necessary to same to being carried out in different samples
The analysis of gene loci, sequence can be classified according to the different index parts of design.
(P200) the sequence digit X containing effective information is determined：Obtained in P100 steps in sequence, since the 1st
The nucleotide of every sequence is scanned, until the nucleotides in every sequence is the digit X of effective information, so that it is determined that containing
The sequence digit X of effective information；
(P300) sequencing result, exclusive PCR sequence are scanned according to digit X.
After pretreatment terminates, effective nucleotide sequence set is obtained.
Then, effective nucleotide sequence set to acquisition is formally handled.Formal processing includes：
(S100) exclusive PCR sequence again：
(S200) repetitive sequence is analyzed：The sequence in effective nucleotide sequence set is analyzed and counted one by one, is wrapped
Include
1) for the inconsistent sequence of the sequence with having counted, started counting up from 1；I.e. for different sequence before
Row, subclass is reformulated, and the sequence quantity obtained in the subclass that added up since 1；
2) for one of sequence with having counted identical sequence, carry out counting from increasing in corresponding sequence；I.e. for it
The preceding sequence occurred, is included into corresponding subclass, and the accumulated counts in corresponding subclass；
3) accumulated counts are carried out to all sequences, obtains the sequence sum during effective nucleotide sequence combines；
(S300) data statistic analysis：The repetitive sequence for completing all sequences in effective nucleotide sequence set analyzes it
Afterwards, statistical analysis is carried out to the data of acquisition, including
1) sequence of all countings is ranked up according to counts, sorted by from more to few；
2) accounting of different genotype sequence is calculated；(S400) result exports：The sequence of total, the every kind of genotype of output sequence
Row (being arranged according to from more to few), the quantity and accounting of every kind of genotypic sequences.
After being handled using the above method, the result of output is as follows：
TCCGCTAGAACTGCTATATAATGACGATGAATTTTGGGGGGACTTTTTTTGAGATCTGAGTTCTCTGAGGGGGCAAG
CAGAAGGGCTAGAGAGGAGGAATGAGCTTGGACAGGTGGGCTGGGGTCTATCC 35.73822272%304361
TCCGCTAGAACTGCTATATAATGACGATGAATTTTGAGGGGGCAAGCAGAAGGGCTAGAGAGGAGGAATGAGCTTAG
ACAGGTGGGCTGGGGTCTATCCCAGAGTTTTGAGAGCAAGGCAGAGGACTCTG 21.61077451%184046
TCCGCTAGAACTGCTATATAATGACGATGAATTTTGGGGGGACTTTTTTTGAGATCTGAGTTCTCTTCACCTCCTCC
TTATTCTCTTTTTGACACTGGATTCTTTGCTTTGATAAATTGTGGGGGAATGA 11.56603729%98501
The type summation (Sum for the type of dna sequence) of DNA sequence dna:3
From the above results, three kinds of DNA sequence dna types are shared in sample one, a kind of most genotype of accounting accounts for about
35.7%.The three times body cell edited respectively as an each chromatid, the sample are surveyed using common sanger
Sequence result is three peaks, not can determine whether its genotype, and its gene editing situation can be accurately learnt using the present invention.
When purpose mutant is screened, said gene is carried out for the cell in all monoclonal cell ponds of gained
Type is identified, you can is filtered out required genotype clone according to demand, is obtained purpose mutant.
Preferred embodiment of the invention described in detail above.It should be appreciated that the ordinary skill of this area is without wound
The property made work can makes many modifications and variations according to the design of the present invention.Therefore, all technician in the art
Pass through the available technology of logical analysis, reasoning, or a limited experiment on the basis of existing technology under this invention's idea
Scheme, all should be in the protection domain being defined in the patent claims.
Sequence table
<110>Shanghai Communications University
<120>A kind of method and its application of the accurate identification genotype based on high-flux sequence
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 58
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58
<210> 2
<211> 58
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatct 58
<210> 3
<211> 81
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgt 60
tgggatgcag tgattatttc c 81
<210> 4
<211> 78
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
caagcagaag acggcatacg agatgtgact ggagttcaga cgtgtgctct tccgatctcc 60
ttctgaatca ttgcatcg 78
Claims (10)
- A kind of 1. method of accurate identification genotype, it is characterised in that comprise the following steps：1) high-flux sequence is carried out to the genetic fragment that amplification obtains, obtains nucleotide sequence set；2) the nucleotide sequence set is handled, exclusive PCR sequence, obtains effective nucleotide sequence set；To described Effective nucleotide sequence set carries out repetitive sequence analysis；3) statistical analysis is carried out to the effectively nucleotide sequence set, obtain different genotype nucleotide sequence, it is described not The nucleotides sequence of homogenic type is listed in the accounting in the effectively nucleotide sequence set.
- 2. the method for accurate identification genotype as claimed in claim 1, it is characterised in that in step 3), the statistical analysis Also include：Nucleotides sequence according to the different genotype is listed in accounting in the effectively nucleotide sequence set from more to It is few, the nucleotide sequence of the different genotype is ranked up；And/or the nucleotide sequence of the statistics different genotype Type sum.
- 3. the method for accurate identification genotype as claimed in claim 1, it is characterised in that in step 2), the processing is also wrapped Preliminary exclusive PCR sequence is included, including sub-elects the sequence with amplimer in the nucleotide sequence set, screening contains There is the sequence of effective information.
- 4. the method for accurate identification genotype as claimed in claim 3, it is characterised in that sequence of the screening containing effective information Comprise the following steps：It is determined that base number needed for the minimum containing effective information；The sequence with amplimer sub-elected according to base number needed for the minimum, so as to preliminary exclusive PCR sequence Row.
- 5. the method for accurate identification genotype as claimed in claim 4, it is characterised in that determine the minimum according to the following steps Required base number：To the sequence with amplimer sub-elected, measured from the high pass in the amplimer of every sequence First beginning sequence analysis after sequence joint, until the X positions in all specific sequences are effective information, the X positions are Base number needed for minimum.
- 6. the method for accurate identification genotype as claimed in claim 3, it is characterised in that in step 2), the repetitive sequence Analyze and be：The sequence in the effectively nucleotide sequence set is analyzed one by one, it is inconsistent for the sequence with having counted Sequence, started counting up from 1；For one of sequence with having counted identical sequence, carry out counting from increasing in corresponding sequence； While repetitive sequence is analyzed, the quantity of effective nucleotide sequence count from increasing.
- 7. the method for accurate identification genotype as claimed in claim 1, it is characterised in that in step 1), enter to genetic fragment During row amplification, the amplimer of use includes high-flux sequence junction portion and extension increasing sequence part.
- 8. the method for accurate identification genotype as claimed in claim 7, it is characterised in that the amplimer also includes index Part.
- 9. a kind of method of accurate identification genotype as any one of claim 1-8 is in purpose mutant is screened Using.
- 10. application as claimed in claim 9, it is characterised in that the purpose mutant is by artificial method or natural Method obtain mutant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710802423.9A CN107447021A (en) | 2017-09-07 | 2017-09-07 | A kind of method and its application of the accurate identification genotype based on high-flux sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710802423.9A CN107447021A (en) | 2017-09-07 | 2017-09-07 | A kind of method and its application of the accurate identification genotype based on high-flux sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107447021A true CN107447021A (en) | 2017-12-08 |
Family
ID=60495867
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710802423.9A Pending CN107447021A (en) | 2017-09-07 | 2017-09-07 | A kind of method and its application of the accurate identification genotype based on high-flux sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107447021A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108517567A (en) * | 2018-04-20 | 2018-09-11 | 江苏康为世纪生物科技有限公司 | Connector, primer sets, kit and the banking process in library are built for cfDNA |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104498493A (en) * | 2014-12-30 | 2015-04-08 | 武汉大学 | Method for specifically knocking out hepatitis B virus by CRISPR/Cas9 and gRNA applied to specific targeting HBV DNA |
| CN105154436A (en) * | 2015-06-30 | 2015-12-16 | 清华大学 | DNA containing mutational endonuclease identification section and application of DNA in genome editing |
| CN105316399A (en) * | 2014-08-03 | 2016-02-10 | 晶能生物技术（上海）有限公司 | Method for screening mutants by high-throughput sequencing |
| CN106497926A (en) * | 2016-11-03 | 2017-03-15 | 承启医学（深圳）科技有限公司 | A kind of amplicon primer and construction method for building microbial bacterial 16s rDNA variable regions sequencing library |
-
2017
- 2017-09-07 CN CN201710802423.9A patent/CN107447021A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105316399A (en) * | 2014-08-03 | 2016-02-10 | 晶能生物技术（上海）有限公司 | Method for screening mutants by high-throughput sequencing |
| CN104498493A (en) * | 2014-12-30 | 2015-04-08 | 武汉大学 | Method for specifically knocking out hepatitis B virus by CRISPR/Cas9 and gRNA applied to specific targeting HBV DNA |
| CN105154436A (en) * | 2015-06-30 | 2015-12-16 | 清华大学 | DNA containing mutational endonuclease identification section and application of DNA in genome editing |
| CN106497926A (en) * | 2016-11-03 | 2017-03-15 | 承启医学（深圳）科技有限公司 | A kind of amplicon primer and construction method for building microbial bacterial 16s rDNA variable regions sequencing library |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108517567A (en) * | 2018-04-20 | 2018-09-11 | 江苏康为世纪生物科技有限公司 | Connector, primer sets, kit and the banking process in library are built for cfDNA |
| CN108517567B (en) * | 2018-04-20 | 2020-08-11 | 江苏康为世纪生物科技有限公司 | Adaptor, primer group, kit and library construction method for cfDNA library construction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7119014B2 (en) | Systems and methods for detecting rare mutations and copy number variations | |
| CN107526944B (en) | A kind of sequencing data analysis method, device and the computer-readable medium of microsatellite instability | |
| CN105441432B (en) | Composition and its purposes in sequencing and variation detection | |
| Rauscher et al. | Internal transcribed spacer repeat‐specific primers and the analysis of hybridization in the Glycine tomentella (Leguminosae) polyploid complex | |
| CN103403182B (en) | The heredity relevant to cancer or the detection of molecular distortion | |
| AU2021257920A1 (en) | Variant classifier based on deep neural networks | |
| CN110846411B (en) | Method for distinguishing gene mutation types of single tumor sample based on next generation sequencing | |
| CN107513565A (en) | A kind of microsatellite instability Sites Combination, detection kit and its application | |
| CN108319813A (en) | Circulating tumor DNA copies the detection method and device of number variation | |
| CN105986008A (en) | CNV detection method and CNV detection apparatus | |
| EP2926288A1 (en) | Accurate and fast mapping of targeted sequencing reads | |
| CN108004304A (en) | A kind of Clonal method for detecting lymphocyte related genes and resetting | |
| US20200392584A1 (en) | Methods and systems for detecting residual disease | |
| CN104145028A (en) | Method and device for detecting microdeletion in chromosome sts area | |
| CN115312121B (en) | Target gene locus detection method, device, equipment and computer storage medium | |
| Pandya et al. | Whole genome single nucleotide polymorphism based phylogeny of Francisella tularensis and its application to the development of a strain typing assay | |
| Lawrence et al. | Assignment of position-specific error probability to primary DNA sequence data | |
| Smart et al. | A novel phylogenetic approach for de novo discovery of putative nuclear mitochondrial (pNumt) haplotypes | |
| CN105555970A (en) | Method and system for simultaneously performing target gene haplotype analysis and chromosomal aneuploidy detection | |
| CN109182538A (en) | Mastadenitis of cow key SNPs site rs88640083 and 2b-RAD Genotyping and analysis method | |
| Beltman et al. | Reproducibility of Illumina platform deep sequencing errors allows accurate determination of DNA barcodes in cells | |
| Simon et al. | Sequencing the peripheral blood B and T cell repertoire–quantifying robustness and limitations | |
| CN108319817A (en) | The processing method and processing device of Circulating tumor DNA repetitive sequence | |
| EP2917367B1 (en) | A method of improving microarray performance by strand elimination | |
| WO2010119407A1 (en) | Methods for nucleic acid quantification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171208 |
|
| RJ01 | Rejection of invention patent application after publication |