CN107435069A - A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts - Google Patents
A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts Download PDFInfo
- Publication number
- CN107435069A CN107435069A CN201710633469.2A CN201710633469A CN107435069A CN 107435069 A CN107435069 A CN 107435069A CN 201710633469 A CN201710633469 A CN 201710633469A CN 107435069 A CN107435069 A CN 107435069A
- Authority
- CN
- China
- Prior art keywords
- cell
- dna
- cell line
- crispr
- determination method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of quick determination method of cell line CRISPR/Cas9 gene knockouts, belong to gene engineering technology field.The present invention can quickly obtain cell genomic dna by Direct Pyrolysis method; with reference to Fluorescence PCR assay and the capillary electrophoresis method based on sequenator, extensive genotype identification can be carried out to the monoclonal cell that multiple gene locis knock out precisely within a short period of time.The present invention need not use kit extracting genomic DNA, 25min is only needed to the processing time of cell, dramatically saves on economy and time cost, sensitivity and accuracy are high, very small amount DNA is only needed, and the difference of 1 base can be detected accurately；Because not being related to DNA extractings, performing PCR is entered to sample can test and analyze the present invention by simple dilution, denaturation and Capillary Electrophoresis later, without cumbersome step, so suitable extensive batched operation.
Description
Technical field
The present invention relates to a kind of quick determination method of cell line CRISPR/Cas9 gene knockouts, belong to genetic engineering skill
Art field.
Background technology
CRISPR/Cas9 systems are a kind of newest gene site-directed editing techniques, because this system operatio is easy, using into
This is cheap, and the efficiency for entering edlin to genome specificity site is very high, so it is in animal, plant and microorganism etc.
The application in field is more and more extensive.
After CRISPR/Cas9 systems are sheared to genomic DNA, often a few base is formed in cleavage site
Missing or insertion, it is impossible to difference caused by directly detecting this change by common gel electrophoresis.Conventional detection side
Method has 5 kinds：Direct sequencing, PCR digestions detection method, T7E1 digestions detection method, PAGE electrophoresis assays, high-resolution dissolving are bent
Line detection method (high-resolution melting (HRM) analysis), wherein direct sequencing can be obtained on mutation
The very detailed information of body, but its cycle length, it is cumbersome, it is impossible to large-scale application；PCR digestions detection method is extremely relied on and cut
Whether have available restriction enzyme site, the scope of application is very narrow if cutting location proximate；T7E1 digestion detection method sensitivity is not high enough, needs
Multiple steps are wanted to be operated, and T7E1 enzymes are expensive, are not suitable for carrying out Large-scale Screening；PAGE electrophoresis assays steps
It is cumbersome, expensive reagents, waste time and energy；High-resolution solubility curve detection method can only detect whether mutation, it is impossible to obtain
Base is inserted or the specific number of missing；So the above method can not all be entered to mutant fast and accurately simultaneously
Row detection.
Publication No. is that CN105177126A Chinese invention patent discloses a kind of side of quick detection knock out mice
Method, using the knockout gene of Fluorescence PCR assay combined standard molecular weight internal reference quick detection mouse, but it is less using only density
Reference molecules amount, testing result is not accurate enough, and its detection object is limited only to mouse, is not also applied to this technology
The detection of cell line gene knockout.
The content of the invention
It is an object of the invention to provide a kind of quick determination method of cell line CRISPR/Cas9 gene knockouts, this method
The genomic DNA of cell need not be extracted, you can whether the cell line that quick detection CRISPR/Cas9 system genes knock out occurs
Sequence change, while the specific number of base insertion or missing can be obtained.
To achieve these goals, the technical solution adopted in the present invention is：
A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts, comprises the following steps：
1) specific target practice site is designed for target gene, builds transfectional cell series after CRISPR/Cas9 carriers, institute
State on CRISPR/Cas9 carriers with can be by the fluorescence labeling of flow cytometer recognition detection；
2) transfectional cell is sorted using flow cytometer, obtains positive monoclonal cell；
3) by positive monoclonal cell expansion culture, take the cell after culture to use lysate Direct Pyrolysis, it is molten to obtain DNA
Liquid；
4) upstream and downstream primer is designed so that PCR extension increasing sequences covering target practice site, ' it is glimmering that end carries out FAM to sense primer 5
Signal, by the use of the DNA solution in step 3) as template, enter performing PCR amplification, obtain monoclonal cell PCR primer；
5) standard molecular weight internal reference DNA is made：The standard molecular weight internal reference DNA is marked using ROX, clip size
Respectively：79th, 90,105,131,151,182,201,254,279,306,337,362,402 and 425；
6) formamide, the monoclonal cell PCR primer and the standard molecular weight internal reference DNA are mixed, denaturation is rearmounted
In carrying out Capillary Electrophoresis on sequenator, data analysis as a result is carried out using Genemapper softwares, directly obtains PCR primer
Size, compared with the PCR primer size of wild type control after, draw base insertion or missing specific number.
Invention increases 2 standard molecular weights that molecular size range is 279 and 402, higher density can obtain more
Accurate positioning result.
Step 1) the CRISPR/Cas9 carriers are to insert target sgRNA sequence alterations on maternal carrier pX458 to form.
Cell line described in step 1) is RAW264.7, B16 cell line.
When the target gene described in the step 1) is mouse Vav2 genes, target practice site be 5 '-
GGCCAAGTACTACCGCACCCTGG-3 ' and 5 '-GTTAGAGATTCAGGAGACCGAGG-3 '.
When the target gene described in the step 1) is mouse Vav1 genes, target practice site be 5 '-
CTACGAGGACCTAATGCGCT TGG-3 ' and 5 '-CGAGGACCTTTATGACTGCG TGG-3 '.
By after the cell culture 40-80h after transfection in step 2), selected by flow cytometry apoptosis is carried out.After the present invention will transfect
Cell culture 40-80h after, carry out selected by flow cytometry apoptosis, it is ensured that cell after sorting have maximum survival rate and
Highest gene editing efficiency.
Step 3) takes 100-1000 cell to carry out Direct Pyrolysis.
The formula of lysate described in step 3) is：100mmol/L KCl, 20mmol/L Tris-HCl pH=9.0,
0.3%Triton X-100,1.0mg/mL proteinase K.The present invention uses concentration as 0.3% being found through experiments that
During Triton X-100,1.0mg/mL proteinase K lysate, more preferable cell lytic effect can be obtained.
The concrete operations cracked described in step 3) are：15min is incubated in 55 DEG C, is then incubated 10min in 95 DEG C.This hair
It is bright to use kit extracting genomic DNA, 25min is only needed to the processing time of cell, dramatically saves on economy
And time cost.
The DNA of standard molecular weight internal reference described in step 5)：Using pUC19 DNAs template, following primer sequence is carried out
PCR expands to obtain；
ROX-R：5‘-AAGGGCCGAGCGCAGAAGTGGTC-3’；
79F：5‘-GCTCTAGCTTCCCGGCAACAATTAATAGACTG-3’；
90F：5‘-GCGAACTACTTACTCTAGCTTCCCGGCAAC-3’；
105F：5‘-GCAAACTATTAACTGGCGAACTAC-3’；
131F：5‘-GCCTGTAGCAATGGCAACAACGTTGC-3’；
151F：5‘-GACGAGCGTGACACCACGATGCCT-3’；
182F：5‘-GGAACCGGAGCTGAATGAAGCCATACC-3’；
201F：5‘-GAACTCGCCTTGATCGTTGGGAACC-3’；
254F：5‘-GATCGGAGGACCGAAGGAGCTAACC-3’；
279F：5‘-ACTGCGGCCAACTTACTTCTGACA-3’；
306F：5‘-GTGCTGCCATAACCATGAGTGATAACAC-3’；
337F：5‘-ACGGATGGCATGACAGTAAGAGAA-3’；
362F：5‘-CTCACCAGTCACAGAAAAGCATC-3’；
402F：5‘-GGTCGCCGCATACACTATTCTCAGA-3’；
425F：5‘-TGACGCCGGGCAAGAGCA-3’.
The standard molecular weight internal reference of the present invention, has more highdensity standard molecular weight, and it is more fixed to obtain
Position result.
By formamide, the monoclonal cell PCR primer and the standard molecular weight internal reference DNA with 16-20 in step 6):
1:1 ratio mixing.
The formamide is height deionized formamide Hi-DiTMFormamide (Applied Biosystems,
4440753)。
The present invention can quickly obtain cell genomic dna by Direct Pyrolysis method, with reference to Fluorescence PCR assay, pass through sequencing
Instrument carries out Capillary Electrophoresis, can carry out extensive genotype to multiple Knockout cells monoclonals precisely within a short period of time
Identification.The present invention, which is found through experiments that, to be used concentration 1.0mg/mL proteinase K's splits for 0.3%Triton X-100
When solving liquid, more preferable cell lytic effect can be obtained.The standard molecular weight internal reference of the present invention, has more highdensity standard scores
Son amount, can obtain more accurate positioning result.Compared to conventional method, the present invention has advantages below：
1) present invention need not use kit extracting genomic DNA, only need 25min, pole to the processing time of cell
The earth saves economy and time cost；
2) operating procedure of the present invention is simple, and design of primers and PCR and conventional method are just the same, has point suitable for any
The laboratory of sub- Basic of Biology；
3) present invention limits without application, and detection target area need not have the presence of specific restriction enzyme site；
4) sensitivity of the present invention and accuracy are high, it is only necessary to very small amount DNA, and to the difference of 1 base all
Can accurately it detect；
5) present invention enters after performing PCR by simple dilution, denaturation and capillary because not being related to DNA extractings to sample
Electrophoresis tube can test and analyze, without cumbersome step, so being adapted to extensive batched operation；
6) the inventive method has versatility, and the application without cell line or specific gene limits.
Brief description of the drawings
Fig. 1 is standard molecular weight internal reference DNA electrophoresis detection figures；
Fig. 2 is Vav2 gene knockout difference monoclonal cell fluorescent PCR testing results and sequencing in cell line RAW264.7
Peak figure；
Fig. 3 is Vav1 gene knockout difference monoclonal cell fluorescent PCR testing results and sequencing peak figure in cell line B16.
Embodiment
With reference to specific embodiment, the present invention is described in further detail.
Embodiment 1
(1) specific target practice site, and carrier construction, transfectional cell series are designed for mouse Vav2 genes
RAW264.7, the unicellular of the GFP positives is obtained by selected by flow cytometry apoptosis：Mouse Vav2 gene I/Ds are MGI：102718(MGI
Murine genes database), target practice site be Exon6 (ENSMUSE00001307648) section in 5 '-
GGCCAAGTACTACCGCACCCTGG-3 ' (SEQ ID NO.1) and 5 '-GTTAGAGATTCAGGAGACCGAGG-3 ' (SEQ ID
NO.2), carrier framework uses pX458 (being purchased from Addgene), and vector construction well passes through liposome transfection cell line later
Sorted after RAW264.7,40-80 hour by flow cytometer (BD fusion) and obtain the unicellular to 96 holes of the GFP positives
In Tissue Culture Plate；
(2) by unicellular expansion culture positive GFP, part cell is taken directly by cracking, to obtain DNA solution, be used for
Subsequent PCR amplification：Take a small amount of cell (need not quantify, about 100-1000), centrifugal force 350g, centrifugation time 5min,
Abandoning supernatant, retain bottom cell, then add 20ul cell pyrolysis liquids, (cell pyrolysis liquid formula is：100mM KCl,
20mM Tris-HCl pH 9.0,0.3%Triton X-100,1.0mg/ml proteinase K), will be thin using pipettor
Born of the same parents, which blow and beat, to be mixed, and adds mineral oil covering cell pyrolysis liquid, is placed in 55 DEG C of incubation 15min, cell is fully cracked, transfer to
95 DEG C, 10min is incubated, is denatured Proteinase K, handled later lysate and may act as pcr template use, be placed in -20
DEG C save backup.
(3) primer is designed, the extension increasing sequence covering target practice site of PCR reactions, ' end carries out FAM fluorescence marks to sense primer 5
Note；Expanded by PCR, obtain covering the DNA fragmentation of shooting section：Use online primer-design software primer3 (http://
Primer3.ut.ee/), specific primer, Vav2-f PCR-F are designed for target practice site flanking sequence：5‘-
CCTCTCTTCCCTCAGCTCCT-3 ' (SEQ ID NO.3) (sense primer 5 ' end carries out FAM fluorescence labelings) and Vav2-f
PCR-R：5 '-CTCACGCGTCATGTCTCCTC-3 ' (SEQ ID NO.4), are entered by the Li Ge bio tech ltd of Shanghai hundred
Row synthesis；The DNA fragmentation (theoretical length 241bp) in amplification covering target practice site is reacted by PCR, reaction system is：
(Vazyme, P111) 2*Taq Master PCR MIX：10 μ L, Vav2-F PCR-F (5 μM) and Vav2-F PCR-R (5 μM) are each
0.5μL；Cell pyrolysis liquid DNA：2μL；Supplement ddH2O to the μ L of cumulative volume 20；Response procedures are：95 DEG C, 5 min；95 DEG C, 30
S, 60 DEG C, 30 s, 72 DEG C, 40 s；72 DEG C, 10 min；35 circulations.Detect and identify by 1.5% agarose gel electrophoresis
PCR primer, if clear DNA bands, then 2 μ L PCR primers are taken, 200 times are diluted, for subsequent analysis.
(4) standard molecular weight internal reference DNA is made：Synthesize the universal primer in downstream
ROX-R：5 '-AAGGGCCGAGCGCAGAAGTGGTC-3 ' (SEQ ID NO.5), and ' end carries out ROX in primer 5
Fluorescence labeling；
It is respectively synthesized the primer sequence that upstream is used to expand different length：
79F：5‘-GCTCTAGCTTCCCGGCAACAATTAATAGACTG-3’(SEQ ID NO.6)；
90F：5‘-GCGAACTACTTACTCTAGCTTCCCGGCAAC-3’(SEQ ID NO.7)；
105F：5‘-GCAAACTATTAACTGGCGAACTAC-3’(SEQ ID NO.8)；
131F：5‘-GCCTGTAGCAATGGCAACAACGTTGC-3’(SEQ ID NO.9)；
151F：5‘-GACGAGCGTGACACCACGATGCCT-3’(SEQ ID NO.10)；
182F：5‘-GGAACCGGAGCTGAATGAAGCCATACC-3’(SEQ ID NO.11)；
201F：5‘-GAACTCGCCTTGATCGTTGGGAACC-3’(SEQ ID NO.12)；
254F：5‘-GATCGGAGGACCGAAGGAGCTAACC-3’(SEQ ID NO.13)；
279F：5‘-ACTGCGGCCAACTTACTTCTGACA-3’(SEQ ID NO.14)；
306F：5‘-GTGCTGCCATAACCATGAGTGATAACAC-3’(SEQ ID NO.15)；
337F：5‘-ACGGATGGCATGACAGTAAGAGAA-3’(SEQ ID NO.16)；
362F：5‘-CTCACCAGTCACAGAAAAGCATC-3’(SEQ ID NO.17)；
402F：5‘-GGTCGCCGCATACACTATTCTCAGA-3’(SEQ ID NO.18)；
425F：5‘-TGACGCCGGGCAAGAGCA-3’(SEQ ID NO.19).
Resulting standard molecular weight internal reference DNA electrophoresis detection results are as shown in Figure 1.
Using pUC19 DNAs template, using exo+ polymerase, (NEB Phusion 0530, are prevented in amplification
Add A) pcr amplification reaction is completed, reaction system is：5×Phusion HF buffer：10μl；10mm dNTPs：1μl；
Phusion DNA Polymerase：0.5μl；10 μM of upstream and downstream primers：Each 1 μ l；DNA：0.5μl；DdH2O is supplemented to total
The μ L of volume 50.Response procedures are：98 DEG C, 2min；98 DEG C, 15s, 55 DEG C, 15s, 72 DEG C, 15s；72 DEG C, 30min；35 circulations.
Detected by 2% agarose gel electrophoresis and identify PCR primer, -20 DEG C save backup.
(5) Capillary Electrophoresis is carried out using sequenator to identify the size of PCR primer：By high deionized formamide Hi-DiTM
Formamide (Applied Biosystems, 4440753), PCR primer (being obtained in step (3)) and standard molecular weight internal reference
DNA (being obtained in step (4)) mixes according to following ratio：Hi-DiTMFormamide：9μl；PCR primer：0.5μl；Standard scores
Son amount internal reference DNA：0.5μl.Thing mixed above is placed in PCR instrument, reaction of degeneration (RD) is carried out according to following procedure：95 DEG C,
10min；4 DEG C, 10min.After denaturation is completed, it is placed on ABI sequenators 3730 (Applied Biosystems) and carries out capillary
Electrophoresis tube, 96 samples can complete Data Collection in 2 hours.Finally use GeneScan3.0 andID software v3.2 software analysis datas, it is direct according to standard molecular weight internal reference DNA clip size
It is determined that the base number of detection sample PCR primer, by compared with the PCR primer base number of wild type control sample, finally
Accurately reflect the base numerical value of each monoclonal cell insertion or missing.
As a result, can be accurate as shown in Fig. 2 A, C, F, I are the partial results obtained by the detection method of the application in Fig. 2
Draw No. 1 clone for missing 2 and 5 bases homozygote, No. 3 clone for lack 8 and 17 bases homozygote, No. 6
Clone to lack the homozygote of 5 and 50 bases.B, D, E, G, H, J, K are the result obtained by common sequencing in Fig. 2, and A schemes
Corresponding B figures, corresponding D, E figure of C figures, corresponding G, H figure of F figures, corresponding J, K figure of I figures, it can be found that the accuracy in detection of the application is reachable
To with identical level is sequenced.
Embodiment 2
(1) design specific target practice site for mouse Vav1 genes, by carrier construction, transfectional cell series B16 and
Selected by flow cytometry apoptosis, it is final to obtain the unicellular of the GFP positives：Mouse Vav1 gene I/Ds are MGI：98923 (MGI murine genes
Database, Transcript ID:ENSMUST00000005889), target practice site is exon5 (exon ID：
ENSMUSE00000138941) (the SEQ ID NO.20) in section：5 '-CTACGAGGACCTAATGCGCT TGG-3 ' and
(SEQ ID NO.21)：5 '-CGAGGACCTTTATGACTGCG TGG-3 ', carrier framework use pX458 (to be purchased from
Addgene), vector construction after liposome transfection cell line B16,40-72 hour well later by passing through flow cytometer (BD
Fusion) sorting obtains the unicellular into 96 porocyte culture plates of the GFP positives；
(2) by unicellular expansion culture positive GFP, part cell is taken directly by cracking, to obtain DNA solution, be used for
Subsequent PCR amplification：Take a small amount of cell (need not quantify, about 100-1000), centrifugal force 350g, centrifugation time 5min,
Abandoning supernatant, retain bottom cell, then add 20ul cell pyrolysis liquids, (cell pyrolysis liquid formula is：100mM KCl,
20mM Tris-HCl pH 9.0,0.3%Triton X-100,1.0mg/ml proteinase K), will be thin using pipettor
Born of the same parents, which blow and beat, to be mixed, and adds mineral oil covering cell pyrolysis liquid, is placed in 55 DEG C of incubation 15min, cell is fully cracked, transfer to
95 DEG C, 10min is incubated, is denatured Proteinase K, handled later lysate and may act as pcr template use, be placed in -20
DEG C save backup.
(3) primer is designed so that pcr amplification product includes target practice site, and ' end carries out FAM fluorescence marks to sense primer 5
Note；Expanded by PCR, obtain the DNA fragmentation for including shooting section：Use online primer-design software primer3
(http://primer3.ut.ee/), for target practice locus gene group sequences Design specific primer, Vav1-f PCR-F：
TGGCCTGAATCTGTCCCCTA (SEQ ID NO.22) (sense primer 5 ' end carries out FAM fluorescence labelings) and Vav1-f PCR-
R：GCAGCCATCTCTACCCTTCC (SEQ ID NO.23), serves Hai Bailige bio tech ltd and is synthesized；It is logical
Cross PCR amplifications and include target practice site purpose fragment (theoretical length 181bp), system is：(Vazyme, P111) 2*Taq
Master PCR MIX：10 μ L, Vav1-F PCR-F (5 μM) and each 0.5 μ L of Vav1-F PCR-R (5 μM)；Cell pyrolysis liquid
DNA：2μL；Supplement ddH2O to the μ L of cumulative volume 20；Program is：95 DEG C, 5min；95 DEG C, 30s, 60 DEG C, 30s, 72 DEG C, 40s；72
DEG C, 10min；35 circulations.Electrophoresis detection PCR primer, if clear DNA bands, then take 2 μ L PCR primers, dilution 200
Times, for subsequent analysis.
(4) standard molecular weight internal reference DNA is made：Detailed step is the same as the step (4) in embodiment 1.
(5) capillary electrophoresis analysis PCR primer clip size is passed through using sequenator：Detailed step is the same as in embodiment 1
Step (5).
The result of this detection is as shown in figure 3, A, C, F, I are the part knot obtained by the detection method of the application in Fig. 3
Fruit, can accurately draw homozygote of No. 2 clones for 12 and 34 bases of missing, and No. 3 clones are missing 30 and 55 alkali
The homozygote of base, No. 5 clones are the homozygote of 51 bases of missing.B, D, E, G, H, J are the knot obtained by common sequencing in Fig. 3
Fruit, the corresponding B figures of A figures, corresponding D, E figure of C figures, corresponding G, H figure of F figures, the corresponding J figures of I figures, it can be found that the accuracy in detection of the application
It can reach horizontal with sequencing identical.
<110>Xinxiang College of Medical Science
<120>A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts
<160> 25
<170> PatentIn version 3.5
<211> 23
<212> DNA
<213>Sequence
<221>Vav2 genes target site 1
<400> 1
ggccaagtac taccgcaccc tgg 23
<211> 23
<212> DNA
<213>Sequence
<221>Vav2 genes target site 2
<400> 2
gttagagatt caggagaccg agg 23
<211> 20
<212> DNA
<213>Sequence
<221> Vav2-f PCR-F
<400> 3
cctctcttcc ctcagctcct 20
<211> 20
<212> DNA
<213>Sequence
<221> Vav2-f PCR-R
<400> 4
ctcacgcgtc atgtctcctc 20
<211> 23
<212> DNA
<213>Sequence
<221>DNA internal reference downstream primers
<400> 5
aagggccgag cgcagaagtg gtc 23
<211> 32
<212> DNA
<213>Sequence
<221> 79F
<400> 6
gctctagctt cccggcaaca attaatagac tg 32
<211> 30
<212> DNA
<213>Sequence
<221> 90F
<400> 7
gcgaactact tactctagct tcccggcaac 30
<211> 24
<212> DNA
<213>Sequence
<221> 105F
<400> 8
gcaaactatt aactggcgaa ctac 24
<211> 26
<212> DNA
<213>Sequence
<221> 131F
<400> 9
gcctgtagca atggcaacaa cgttgc 26
<211> 24
<212> DNA
<213>Sequence
<221> 151F
<400> 10
gacgagcgtg acaccacgat gcct 24
<211> 27
<212> DNA
<213>Sequence
<221> 182F
<400> 11
ggaaccggag ctgaatgaag ccatacc 27
<211> 25
<212> DNA
<213>Sequence
<221> 201F
<400> 12
gaactcgcct tgatcgttgg gaacc 25
<211> 25
<212> DNA
<213>Sequence
<221> 254F
<400> 13
gatcggagga ccgaaggagc taacc 25
<211> 24
<212> DNA
<213>Sequence
<221> 279F
<400> 14
actgcggcca acttacttct gaca 24
<211> 28
<212> DNA
<213>Sequence
<221> 306F
<400> 15
gtgctgccat aaccatgagt gataacac 28
<211> 24
<212> DNA
<213>Sequence
<221> 337F
<400> 16
acggatggca tgacagtaag agaa 24
<211> 23
<212> DNA
<213>Sequence
<221> 362F
<400> 17
ctcaccagtc acagaaaagc atc 23
<211> 25
<212> DNA
<213>Sequence
<221> 402F
<400> 18
ggtcgccgca tacactattc tcaga 25
<211> 18
<212> DNA
<213>Sequence
<221> 425F
<400> 19
tgacgccggg caagagca 18
<211> 23
<212> DNA
<213>Sequence
<221>Vav1 genes target site 1
<400> 20
ctacgaggac ctaatgcgct tgg 23
<211> 23
<212> DNA
<213>Sequence
<221>Vav1 genes target site 2
<400> 21
cgaggacctt tatgactgcg tgg 23
<211> 20
<212> DNA
<213>Sequence
<221> Vav1-f PCR-F
<400> 22
tggcctgaat ctgtccccta 20
<211> 20
<212> DNA
<213>Sequence
<221> Vav1-f PCR-R
<400> 23
gcagccatct ctacccttcc 20
<211> 241
<212> DNA
<213>Sequence
<221>Vav2 PCR detection fragments（Wild type）
<400> 24
cctctcttcc ctcagctcct tttggtcaga gtttcctcac aggcagagag agagagagag 60
aaaactggaa caggtgctaa gaccctgacc ctgggctttc caggagaaat ggctctcacc 120
ttctcaatgt cctccagggt gcggtagtac ttggcctcgg tctcctgaat ctctaacaag 180
cagcagcttc tcttgtcgtc ctcagtcatg cccattttct agaggagaca tgacgcgtga 240
g 241
<211> 181
<212> DNA
<213>Sequence
<221>Vav1 PCR detection fragments（Wild type）
<400> 25
tggcctgaat ctgtccccta gtgacaccgc agaggaagac gaggaccttt atgactgcgt 60
ggaaaatgag gaggcagagg gggacgagat ctacgaggac ctaatgcgct tggagtcggt 120
gcctacgcca gtgagtgggc ctgggaaggg cggggcaggt gggaagggta gagatggctg 180
c 181
Claims (8)
- A kind of 1. quick determination method of cell line CRISPR/Cas9 gene knockouts, it is characterised in that：Comprise the following steps：1) specific target practice site is designed for target gene, builds transfectional cell series after CRISPR/Cas9 carriers, it is described Being carried on CRISPR/Cas9 carriers can be by the fluorescence labeling of flow cytometer recognition detection；2) transfectional cell is sorted using flow cytometer, obtains positive monoclonal cell；3) by positive monoclonal cell expansion culture, take the cell after culture to use lysate Direct Pyrolysis, obtain DNA solution；4) upstream and downstream primer is designed so that PCR extension increasing sequences covering target practice site, ' end carries out FAM fluorescence marks to sense primer 5 Note, by the use of the DNA solution in step 3) as template, enter performing PCR amplification, obtain monoclonal cell PCR primer；5) standard molecular weight internal reference DNA is made：The standard molecular weight internal reference DNA is marked using ROX, clip size difference For：79th, 90,105,131,151,182,201,254,279,306,337,362,402 and 425；6) formamide, the monoclonal cell PCR primer and the standard molecular weight internal reference DNA are mixed, survey is placed in after denaturation Capillary Electrophoresis is carried out on sequence instrument, as a result data analysis is carried out using Genemapper softwares, directly obtains the big of PCR primer It is small, compared with the PCR primer size of wild type control after, draw base insertion or missing specific number.
- 2. the quick determination method of cell line CRISPR/Cas9 gene knockouts according to claim 1, it is characterised in that： Step 1) the CRISPR/Cas9 carriers are to insert target sgRNA sequence alterations on skeleton carrier pX458 to form.
- 3. the quick determination method of cell line CRISPR/Cas9 gene knockouts according to claim 1, it is characterised in that： Cell line described in step 1) is RAW264.7, B16 cell line.
- 4. the quick determination method of cell line CRISPR/Cas9 gene knockouts according to claim 1, it is characterised in that： By after the cell culture 40-80h after transfection in step 2), selected by flow cytometry apoptosis is carried out.
- 5. the quick determination method of cell line CRISPR/Cas9 gene knockouts according to claim 1, it is characterised in that： The formula of lysate described in step 3) is：100mmol/L KCl, 20mmol/L Tris-HCl pH=9.0,0.3% TritonX-100,1.0mg/mL proteinase K.
- 6. the quick determination method of cell line CRISPR/Cas9 gene knockouts according to claim 5, it is characterised in that： The concrete operations cracked described in step 3) are：15min is incubated in 55 DEG C, is then incubated 10min in 95 DEG C.
- 7. the quick determination method of cell line CRISPR/Cas9 gene knockouts according to claim 1, it is characterised in that： The DNA of standard molecular weight internal reference described in step 5)：Using pUC19 DNAs template, following primer sequence is entered performing PCR and expanded Arrive；ROX-R：5‘-AAGGGCCGAGCGCAGAAGTGGTC-3’；79F：5‘-GCTCTAGCTTCCCGGCAACAATTAATAGACTG-3’；90F：5‘-GCGAACTACTTACTCTAGCTTCCCGGCAAC-3’；105F：5‘-GCAAACTATTAACTGGCGAACTAC-3’；131F：5‘-GCCTGTAGCAATGGCAACAACGTTGC-3’；151F：5‘-GACGAGCGTGACACCACGATGCCT-3’；182F：5‘-GGAACCGGAGCTGAATGAAGCCATACC-3’；201F：5‘-GAACTCGCCTTGATCGTTGGGAACC-3’；254F：5‘-GATCGGAGGACCGAAGGAGCTAACC-3’；279F：5‘-ACTGCGGCCAACTTACTTCTGACA-3’；306F：5‘-GTGCTGCCATAACCATGAGTGATAACAC-3’；337F：5‘-ACGGATGGCATGACAGTAAGAGAA-3’；362F：5‘-CTCACCAGTCACAGAAAAGCATC-3’；402F：5‘-GGTCGCCGCATACACTATTCTCAGA-3’；425F：5‘-TGACGCCGGGCAAGAGCA-3’.
- 8. the quick determination method of cell line CRISPR/Cas9 gene knockouts according to claim 1, it is characterised in that： By formamide, the monoclonal cell PCR primer and the standard molecular weight internal reference DNA with 16-20 in step 6):1:1 ratio Example mixing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710633469.2A CN107435069A (en) | 2017-07-28 | 2017-07-28 | A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710633469.2A CN107435069A (en) | 2017-07-28 | 2017-07-28 | A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107435069A true CN107435069A (en) | 2017-12-05 |
Family
ID=60460237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710633469.2A Pending CN107435069A (en) | 2017-07-28 | 2017-07-28 | A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107435069A (en) |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108359720A (en) * | 2018-04-16 | 2018-08-03 | 浙江省农业科学院 | The detection method of mutant and its application |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| CN109402179A (en) * | 2018-11-21 | 2019-03-01 | 新乡医学院 | The rapid identification method of proliferation phenotype after cancer of the esophagus functional gene knocks out in a kind of cell line |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| CN112094840A (en) * | 2019-06-17 | 2020-12-18 | 南京尧顺禹生物科技有限公司 | Rapid preparation method of trace animal sample genome DNA template for genome segment amplification |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
-
2017
- 2017-07-28 CN CN201710633469.2A patent/CN107435069A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| F ANN RAN等: "Genome engineering using the CRISPR-Cas9 system", 《NAT PROTOC.》 * |
| J. ANDREW DEWOODY等: "Universal method for producing ROX-labeled size standards suitable for automated genotyping", 《BIOTECHNIQUES》 * |
| MUHAMMAD KHAIRUL RAMLEE等: "High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis", 《NATURE》 * |
| WILLIAM KELTON等: "Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange", 《NATURE》 * |
Cited By (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN108359720A (en) * | 2018-04-16 | 2018-08-03 | 浙江省农业科学院 | The detection method of mutant and its application |
| CN109402179B (en) * | 2018-11-21 | 2020-12-04 | 新乡医学院 | Method for rapidly identifying proliferation phenotype after knockout of esophageal cancer functional gene in cell line |
| CN109402179A (en) * | 2018-11-21 | 2019-03-01 | 新乡医学院 | The rapid identification method of proliferation phenotype after cancer of the esophagus functional gene knocks out in a kind of cell line |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN112094840A (en) * | 2019-06-17 | 2020-12-18 | 南京尧顺禹生物科技有限公司 | Rapid preparation method of trace animal sample genome DNA template for genome segment amplification |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107435069A (en) | A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts | |
| CN106947827B (en) | Bighead carp gender specific molecular marker, screening method and application thereof | |
| KR102121570B1 (en) | KASP primer set based on SNP for discriminating or classifying Panax ginseng cultivar or resource and uses thereof | |
| CN108060213B (en) | Probe and kit for detecting SNP (single nucleotide polymorphism) sites by recombinase-mediated isothermal amplification method based on probe guidance | |
| CN113373223A (en) | CRISPR-Cas system for FLT3-D835Y mutation detection and application thereof | |
| CN117210437A (en) | Enzyme identification of two gene editing tools and application of enzyme identification in nucleic acid detection | |
| CN106755545A (en) | The LAMP detection primer group of pat gene, kit and detection method in genetically modified crops | |
| CN108517364A (en) | Forensic medicine composite detection kit based on 56 Y chromosome SNP genetic markers | |
| CN103215356A (en) | Assay kit for detecting human leukocyte antigen-B (HLA-B)*57:01 and HLA complex P5 (HCP5) alleles | |
| CN115491431A (en) | Detection kit for detecting Japanese encephalitis B virus nucleic acid based on gene editing technology and application | |
| CN110305974B (en) | PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof | |
| CN114085926A (en) | Primer, probe, kit and detection method for SNP site polymorphism of ABCB1 gene C3435T | |
| CN109161609B (en) | SNP molecular marker of wheat leaf rust resistance gene Lr42, detection method and application | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers | |
| CN112029892A (en) | Method for rapidly identifying specificity of transgenic herbicide-tolerant soybean ZH10-6 transformant | |
| CN111793676A (en) | Method and kit for detecting gene polymorphism and application thereof | |
| CN113667714A (en) | Target area capturing method, kit and sequencing method | |
| CN113913556B (en) | Kit for rapidly detecting bat adenovirus and detection method thereof | |
| CN104789650A (en) | A molecular detection method of cytoplasms of brassica cultivars | |
| CN110195102A (en) | A kind of beta Thalassemia methods of genotyping | |
| CN109355367A (en) | The detection method of the common equivocal type in the site HLA parting A | |
| CN109266718A (en) | Detect method existing for endonuclease | |
| CN117568493B (en) | Reagent and kit for identifying insect cell line | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| CN116926221B (en) | Primer group for constructing gene library for judging mycobacterium tuberculosis typing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171205 |
|
| RJ01 | Rejection of invention patent application after publication |