CN107338288A - A kind of biomolecule detecting method - Google Patents
A kind of biomolecule detecting method Download PDFInfo
- Publication number
- CN107338288A CN107338288A CN201710446455.XA CN201710446455A CN107338288A CN 107338288 A CN107338288 A CN 107338288A CN 201710446455 A CN201710446455 A CN 201710446455A CN 107338288 A CN107338288 A CN 107338288A
- Authority
- CN
- China
- Prior art keywords
- chip
- detection
- reaction interface
- handle
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/185—Nucleic acid dedicated to use as a hidden marker/bar code, e.g. inclusion of nucleic acids to mark art objects or animals
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The present invention relates to a kind of biomolecule detecting method, belong to technical field of biological.Detection method provided by the invention is used including realizing that the synchronous of multiple samples to be tested is detected with the biochip of lower component:Base;Some chip handles being arranged in an array manner on base, chip handle edge are stretched out from the base in parallel to each other perpendicular to the direction of base;And the chip reaction interface for being used to mark detection probe of the free end of each chip handle is arranged in, being longitudinally arranged into for chip reaction interface overlaps with the longitudinal direction of chip handle.Biomolecule is detected using method provided by the invention, the synchronous detection of multiple samples to be tested can be realized, and avoid the cross pollution in detection process, a large amount of detecting steps and operating time can be saved, detection efficiency and testing result accuracy are improved, and improves the accuracy of the lateral comparison of multiple pattern detection results.
Description
Technical field
The invention belongs to technical field of biological, and in particular to a kind of biomolecule detecting method.
Background technology
, it is necessary to which each sample to be tested is one by one added sequentially into chip hole in the biomolecule detection of traditional membrane DNA chip
Or it is incubated in groove.Then, the sample after incubation is one by one removed from chip hole or groove, and in multiple times by cleaning solution according to
It is secondary to add the hole for being used for detecting or washed in groove.After washing, reaction solution is sequentially added in hole or groove and reacted, instead
Liquid after answering needs one by one to remove successively.It is used for examining, it is necessary to carry out repeatedly washing after reacted liquid is removed
The hole of survey or groove, and by the liquid removal in hole or groove.Afterwards, it is necessary to using as the liquid of detection signal one by one hole or trough according to
Secondary addition is reacted.Mixed after reaction, it is necessary to be sequentially added in each hole or groove and stop liquid to read detection data.
, it is necessary to each reaction sample solution is added to chip surface, so in the biomolecule detection of traditional glass chip
Glass-chip is enclosed in clamping in plastic core film magazine afterwards.Chip cartridges are placed in water-bath heating a few houres, or air bath heating
Overnight.Chip cartridges are taken out afterwards, are taken chip cartridges apart and are taken out chip, are put into beaker.Cleaning solution is added at twice shake washing,
Chip is taken out afterwards and is dried up.Chip scanner reading is placed into afterwards.
Traditional detection method operating procedure of biomolecule is various, detection time length, and due to being deposited between different samples
At processing time interval, cause testing result error big.Therefore, it is necessary to new biomolecule detecting method is proposed to improve inspection
Efficiency is surveyed, reduces detection error.
The content of the invention
In order to solve the above technical problems, the present invention proposes a kind of new biomolecule detecting method, comprise the following steps:
Step 1: providing biochip (or being biochip device), the biochip includes:
Base,
Some chip handles being arranged in an array manner on base, chip handle edge are parallel to each other perpendicular to the direction of base
Ground stretches out from base;With
The chip reaction interface of the free end of each chip handle is arranged in, chip reaction interface is longitudinally arranged into and core
The longitudinal direction coincidence of piece handle;
Step 2: the detection for being fixed for specific detection biomolecule to be measured respectively in each chip reaction interface is visited
Pin;
Step 3: each chip reaction interface is set to be contacted with testing sample, to detect the biology point to be measured in testing sample
Son;With
Step 4: obtain the detection signal of each chip reaction interface.
According to detection mode provided by the invention, shape is combined by chip handle and chip reaction interface by several using one kind
Into biochip unit be arranged on the biochip device that is formed on base in an array manner in one-dimensional, two-dimentional or three-dimensional
To detect biomolecule.
, can be individually to each chip reaction interface fixed test probe in step 2, can also be simultaneously to all
Chip reaction interface carry out detection probe fixation.Preferably, while in each chip reaction interface it is fixed for respectively
The detection probe of specific detection biomolecule to be measured.
, it is necessary to which chip reaction interface is entered in sample to be tested solution in sample to be tested is detected, make chip reaction interface
The abundant haptoreaction of biomolecule in the detection probe and sample to be tested of upper fixation.In step 3, the reaction of all chips
Interface can be immersed in same sample to be tested, realize that each detection probe is to the biology in sample to be tested point in chip reaction interface
The detection of son;Each chip reaction interface can also be made to immerse respectively in respective sample to be tested, i.e. chip handle and chip reaction
The biochip unit that interface combinations are formed corresponds with sample to be tested, realizes multiple chip reaction interfaces simultaneously to multiple groups
Into the detection of identical or different sample to be tested.In some preferred embodiments of the present invention, in step 3, make each core
Piece reaction interface contacts with each sample to be tested respectively simultaneously.
As it is well known to the skilled in the art, in the detection process of biomolecule, contacted in chip with sample to be tested
After reaction, the post processing such as it can be washed, be dried to chip as needed, detection signal detection then is carried out to it again.According to
The present invention some preferred embodiments, in step 3, make each chip reaction interface and meanwhile respectively with each sample to be tested
Contact, and each chip reaction interface is implemented to post-process simultaneously.I.e. in detection process, it can be achieved to several samples to be tested
Synchronous detection, so as to realize batch processing within the shortest time.Due to either in the contact with sample to be tested still to chip
Wash etc. time difference for being eliminated in last handling process between each sample to be tested detection, (each chip reaction interface is simultaneously
Synchronizing moving) so that the error of the testing result contrast between sample to be tested minimizes, accurate so as to improve testing result
Property, and drastically increase detection efficiency.
As a result of the biochip device of specific structure, the present invention can equally realize single core in step 4
The signal acquisition of piece reaction interface or the detection signal for obtaining all chip reaction interfaces simultaneously.Some as the present invention are preferred
Embodiment, in step 4, while obtain the detection signal of each chip reaction interface.Thus, offer of the present invention is provided
Detection method each step in it is poor to the detection time of each sample to be tested, so as to be advantageous to each sample to be tested
Biomolecule content situation carries out accurate lateral comparison.
In addition, being longitudinally arranged into for chip reaction interface can reduce use with the technical scheme longitudinally overlapped of chip handle
Reactive tank volume, it is particularly suitable in the case of sample size is less.Or the cross section of the reactive tank used can be reduced
Product, it thus can increase the quantity of reactive tank in unit area, it is especially beneficial for development portable detection equipment.
According to the present invention, the detection probe is the specific probe biomolecule of biomolecule to be measured, such as can be with
It is nucleic acid probe (such as oligonucleotide probe) and/or albumen probe (such as antigen probe, antibody probe), or other biological
Molecular probe.
According to the present invention, chip reaction interface can be plane, curved surface, the shape such as granular, bar-shaped;Can during its work
To be horizontal, upright, inclined etc..For example, the chip reaction interface can be plastic foil (such as nitrocellulose
Film, nylon membrane, polystyrene film), sheet glass, plastic sheet or potsherd etc., preferably nitrocellulose filter, nylon membrane or polyphenyl
Vinyl film, more preferably nitrocellulose filter.It should be understood that in the present invention, film/diaphragm is that thickness ratio piece is thinner, and with one
Determine pliability, can for example bend the film body of even folding property;And piece refers to the lamellar body of hard.
According to method provided by the invention, can meet to mark multiple detection probes in same chip reaction interface, can root
The number of detection probe is selected according to being actually needed.For example, the probe of chip reaction interface mark can be 1~500, preferably
For 1~50, more preferably 2~20.
According to method provided by the invention, it can meet to detect while solution how to be measured, can be set according to being actually needed
Put the number of chip handle.For example, the number of chip handle can be 1~100, preferably 1~50, more preferably 2~20.
According to the present invention, the material of chip handle can be that plastics, glass etc. do not occur with sample to be tested or other treatment fluids
The material of reaction.
According to the present invention it is possible to pass through chromogenic reaction method, fluorescence method, chemoluminescence method and with regard to colloidal gold method (nanogold method)
Detection information is obtained etc. mode.Therefore, in step 4, the detection signal can be color signal, fluorescence signal or chemistry hair
Any one in optical signal.
In certain embodiments of the present invention, chip reaction interface is fitted in the side of chip handle, and close to chip handle
Free end.Chip reaction interface is directly fitted in the side of chip handle, and simple in construction, manufacturing cost is low.Preferably, chip handle
For sticking plaster.Material be plastics chip handle, low manufacture cost.
In certain embodiments of the present invention, chip handle is strip, and is provided with and is used for admittedly in its first side
Determine the fixture of chip reaction interface.It may insure that the longitudinal direction of chip reaction interface overlaps and firm with the longitudinal direction of chip handle by fixture
It is fixed on by ground on chip handle.Preferably, the fixture is folded clamp clip, for chip reaction interface to be fixedly clamped
In first side.Folded clamp clip simple structure, it is easy to use, and can realize that quickly and easily assembling and replacing chip are anti-
Answer the effect at interface.
In certain embodiments of the present invention, chip handle is strip, and installation is provided with the first side of chip handle
Hole, chip reaction interface are arranged in mounting hole.
According to some preferred embodiments of the present invention, if base is the rectangle base with dry hole, each hole is configured to
Can be with the installation end removably clamping of a corresponding chip handle.So, dismounting, the dimension of biochip device can be facilitated
Repair.
According to detection method provided by the invention, it is conventional that synthesis, the sample to be tested preparation of detection probe etc. can also be included
Operating procedure.In the present invention, the synthesis of detection probe, detection probe fixation in chip reaction interface, sample to be tested
Prepare or the processing operation such as pretreatment and the washing of chip reaction interface is all that those of ordinary skill in the art can be according to reality
Border situation carrys out routine operation, and therefore not to repeat here.
According to the present invention, detection process can be the manual mode of hand-held biochip operation or use machinery
Hand operates the automatic detection pattern of biochip.
During using being detected according to biomolecule detecting method provided by the invention, all samples, reaction solution and wash
Wash liquid pre-assigned can be all placed in reactive tank, it is not necessary to move back and forth addition or remove, it is only necessary to holding sample, reaction solution
Move back and forth biochip between the reactive tank of wash solution.Chips detection compared with prior art needs each sample
Sequentially add one by one, each reaction solution sequentially adds one by one, reacted liquid singly removes successively, washes
The various step that liquid is sequentially added, removed one by one is washed, detection method of the invention saves a large amount of detecting steps and operation
Time, and avoid the operational motion of various manual pipettor and change the action of tip heads, and avoid these action institutes
Caused potential sample contamination.Also, the moving back and forth between reactive tank of this biochip can be by automating core
Piece detecting instrument is operated, and the operating time can further be reduced.
Chip reaction interface is vertically disposed at the free end of chip handle so that the part that need to be inserted in solution to be measured
Cross-sectional area is small, therefore situation of the reactive tank for thin deep trouth containers of the long waist of body such as centrifuge tubes that be particularly suitable for use in.So, in unit
Can arrange more reactive tank and chip on area, and the sample size of detection is just more, so as to which detection efficiency is higher, more saves
Save test space.When detecting less clinical sample quantity, the smaller detection device can of volume can be used to complete inspection
Survey, it is easy to detect, cost can also be reduced.
Meanwhile the chip handle for connecting chip reaction interface can be together in series by base recited above, realize different
The combination of chip chamber.In this way it can be ensured that same group of chip for detecting same lot sample sheet is simultaneously operating in each step,
The step and detection time that can further save in detection, and significantly improve detection efficiency and same this testing result of lot sample
Lateral comparison accuracy.Simultaneously as base may insure that same group of chip can keep the spacing determined between each other, can
To prevent the intersection between differential responses liquid from causing the mutual pollution of chip chamber.Furthermore the three-dimensional chip simultaneously operating of this combination,
The reaction time difference between different samples can be eliminated, reduces the error rate of operation.Compared with prior art, due to reducing simultaneously
Using pipettor frequency and reduce the usage amounts of consumptive material tip heads, so as to reduce cost.
Brief description of the drawings
The invention will be described in more detail below based on embodiments and refering to the accompanying drawings.
Fig. 1 schematically illustrates the biochip that the embodiment 1 that the present invention uses uses.
Fig. 2 shows arrangement schematic diagram and testing result of the middle probe of the embodiment of the present invention 1 on film.Wherein, Fig. 2 a are
Arrangement schematic diagram of the probe on film, Fig. 2 b, 2c, 2d are the detection signal figure of sample 01,02,03 respectively.
Fig. 3 schematically illustrates the biochip that the embodiment of the present invention 2 uses.
Fig. 4 schematically illustrates the biochip that the embodiment of the present invention 3 uses.
Fig. 5 shows arrangement schematic diagram and testing result of the middle probe of the embodiment of the present invention 3 on film.Wherein, Fig. 5 a are
Arrangement schematic diagram of the probe on film, Fig. 5 b, 5c are the detection signal figure of sample 04,05 respectively.
In the accompanying drawings, identical part uses identical reference.Accompanying drawing is not according to the ratio of reality.
Embodiment
The present invention is described in further detail below in conjunction with the drawings and specific embodiments, but does not therefore limit this
The protection domain of invention.
Fig. 1 schematically illustrates the biochip 10 of one embodiment of the present of invention.As shown in figure 1, the life of the present embodiment
Thing chip 10 includes base 3.In this embodiment, base 3 is tabular, wherein being provided with several holes 8.Hole 8 is preferably in array
Formula is arranged.Biochip 10 also includes some chip handles 2.In this embodiment, chip handle 2 is elongated cuboid, its quantity
Quantity preferably with hole 8 corresponds.Each chip handle 2 can be plugged into a corresponding hole 8, and regularly be clamped
Firmly.It is readily appreciated that, chip handle 2 can be fixed in base 3 using various ways, such as clamping, gluing etc..At one not
In the embodiment shown, chip handle 2 is removably secured on base 3.
According to the present invention, biochip 10 also includes being used for the chip reaction interface 1 for marking detection probe.As illustrated,
On a side of chip handle 2, mounting hole 5 is provided with the region close to its free end, chip reaction interface 1 is arranged in
In mounting hole 5.Chip reaction interface 1 is arranged in a vertical direction, that is to say, that the longitudinal direction of chip reaction interface 1 and chip handle 2
Longitudinal direction overlaps.The probe that chip reaction interface 1 marks can be 1 to 50, preferably 1~10.
During using being detected according to biochip of the present invention, base recited above can will connect chip reaction interface
Chip handle be together in series, realize the combination of different chip chambers.In this way it can be ensured that detect same group of core of same lot sample sheet
Piece is simultaneously operating in each step, the step and detection time that can be saved in detection.
Because base may insure that same group of chip keeps the spacing determined between each other, can prevent between differential responses liquid
Intersection cause the mutual pollution of chip chamber.The three-dimensional chip simultaneously operating of this combination, it can eliminate anti-between different samples
Time difference is answered, reduces the error rate of operation.Compared with prior art, frequency and the reduction of pipettor are used due to reducing simultaneously
The usage amount of consumptive material tip heads, so as to reduce cost.
When secondly, using being detected according to biochip of the present invention, all samples, reaction solution and cleaning solution are all prewired
It is placed in reactive tank well, it is not necessary to move back and forth addition or remove, it is only necessary to holding sample, reaction solution and wash solution
Move back and forth biochip can between reactive tank.Chips detection compared with prior art needs each sample one by one
Sequentially add, each reaction solution sequentially adds one by one, reacted liquid singly removes successively, cleaning solution one
One various step for sequentially adding, removing, biochip of the present invention save a large amount of detecting steps and operating time.
Also, biochip of the present invention moving back and forth between reactive tank can be grasped by automating chip detector device
Make, the operating time can further be reduced.
When again, using being detected according to biochip of the present invention, chip reaction interface is vertically disposed at chip handle
Free end, its cross-sectional area is small, therefore feelings of the reactive tank for the thin deep trouth container of the long waist of body such as centrifuge tube that are particularly suitable for use in
Condition.So, can arrange more reactive tank and chip in unit area, and the sample size of detection is just more, so as to examine
Survey efficiency high.When detecting less clinical sample quantity, the smaller detection device can of volume can be used to complete detection,
It is easy to detect, cost can also be reduced.
In addition, the arrangement of chip reaction interface 1 as shown in Figure 1 is so as to be stablized, be securely fixed in
On chip handle 5, reduce very thin thickness itself chip reaction interface 1 come off or other uncertainties caused by be damaged the problems such as
Generation.
The implementation process according to detection method provided by the invention is introduced below by a specific example, wherein adopting
With biochip as shown in Figure 3.
Example 1
In this example, mycobacteria identification is carried out using biochip as shown in Figure 1, detects 4 kinds of mycobacterias
Nucleic acid.Clinic can caused by Mycobacterium lungy have many kinds, wherein common are mycobacterium tuberculosis, bird branch
Bacillus, Mycobacterium intracellulare and mycobacterium kansasii etc..
Chip reaction interface in this example is glass-chip, and the mode of detection signal uses fluorescence labeling mode.Originally show
In example, secure on a side of slide insertion chip handle for mycobacteria probe, set at the region close to its free end
In the mounting hole put.During detection, slide immersion carries out the operations such as chip hybridization, washing and fluorescence signal scanning in the solution.
Each step introduced below that the method for mycobacteria identification identification is carried out using biochip as shown in Figure 1.
Step 1:Mycobacteria identifies the making of Genotyping glass-chip
Design synthesizes the probe of each mycobacteria kind:
Mycobacterium tuberculosis probe TBTTTTTTTTTTTTTTTTTTTTAAGACATGCATCCCGT
Mycobacterium avium probe:TTTTTTTTTTTTTTTTTTTTCATGCGTCTTGAGGTC
Mycobacterium intracellulare probe:TTTTTTTTTTTTTTTTTTTTAAGACATGCGCCTAAA
Mycobacterium kansasii probe:
TTTTTTTTTTTTTTTTTTTTCGCCAAGTGGTCCTAT
Positive control probe:TTTTTTTTTTTTTTTTTTTTAACTGCAGCTTGGACTACGC
Negative control probe:TTTTTTTTTTTTTTTTTTTTATGCCTTTAAGCATGGCA
Positive control target sequence:(5 ' end fluorescein CY3 marks, can be with positive control by GCGTAGTCCAAGCTGCAGTT
Probe hybridization reaction)
Probe solution is prepared:Probe is prepared using TE solution, is diluted to 10 μM of concentration.
Fixation of the probe on slide:Point sample, take above each 0.2 μ L points of 6 probe solutions on amido modified slide.Will
Substrate after point sample, which is placed in 80 DEG C of baking ovens, is incubated 80 minutes enhancing fixed effects.The chip of probe will be fixed, be immersed in 60 DEG C
Ultra-pure water in shake and wash 1 minute, dry standby.
Probe arrangement mode is shown in Fig. 2 a.
The slide of fixed probe is embedded into the mounting hole of sticking plaster free end side and fixed.Dry and seal, -20 DEG C
Preserve.
Step 2:Detect preparation of samples
Sample 01:Mycobacterium avium sample of nucleic acid
Sample 02:Mycobacterium intracellulare sample of nucleic acid
Negative sample 03:Sterilized water
PCR system amplified sample 01, sample 02 are prepared using the primer sequence of 16SDNA genes, taq enzymes etc..
Upstream primer sequence Y01:GG TGG CTC AGG ACG AAC G (5 ' end fluorescein CY3 marks);Anti-sense primer
Sequence Y02:GGCT TGC GCC CAT TGT G, are configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures:95 DEG C, 10min;95 DEG C, 2min, 50 DEG C, 1min, 68 DEG C, 1min, 35cycles;72 DEG C,
5min.- 20 DEG C of storages of PCR primer are standby.
Step 3:Detection
1) 3 1.5ml EP pipes are taken, carry out mark, add conventional phosphate buffer (3 × SSPE) 1ml, and positive control
The μ L of sequence target row 10 (10 μM).Then take the PCR primer of 20 μ L 2 samples (01,02) to add, 10min denaturation heated in 95 DEG C,
Taking-up is placed in mixture of ice and water processing.
2) prepare one piece of 24 orifice plate, select 3 holes to carry out mark, the sample after 1) handling correspondingly is added in hole.
3) chip of 3 preparations is taken out, is marked.Then insert respectively above in 3 holes, be placed in 48 DEG C of water-baths and incubate
Educate 0.5hr.
4) glass-chip is taken out, is transferred to other 3 added with 0.2 × SSC of 1ml solution (pH7.0, per 1000ml solution
Contain 1.75g NaCl, 0.88g sodium citrates) hole in, shake and wash 2min.
5) glass-chip is transferred to shake in pure water and washes 2min.
6) glass-chip is taken out, drying, embedded slide is removed, slide is put into chip Fluorescence Scanner and scans fluorescence
Signal sentence read result.
Testing result see the table below 1 and Fig. 4.
Table 1
It can be seen that detecting mycobacteria using detection method provided by the invention, by fluorescence labeling mode, essence is obtained
True testing result.This example has used three chip reaction interfaces respectively while has determined three samples, the like, Ke Yigen
According to increase chip reaction interface number and sample to be tested number is needed, by operating simultaneously, all samples to be tested can be examined simultaneously
Survey, improve detection efficiency.
Embodiment 2
Fig. 3 schematically illustrates another chip handle 12 that can be used in the present invention.The chip handle 12 is configured to sticking plaster.
One end of each sticking plaster is arranged on base.Chip reaction interface 11 be vertically disposed at the side of chip handle 12 close to its from
By the region held.The structure of this biochip is simple, and cost is relatively low.
Embodiment 3
Fig. 4 schematically illustrates another biochip in the present invention, employs chip handle 22 as depicted.The core
Piece handle 22 is configured to elongated silver, and its one end (upper right side in figure) is arranged on base.Chip reaction interface 21 is vertically
It is arranged in the region of its close free end of the first side (i.e. upper surface in Fig. 4) of chip handle 22.Chip handle 22 also includes
Fixture 24, it is configured with the thin slice of hollow region.Constructed by lamellae is into can carry out doubling, so as to by chip reaction interface 21
Regularly clamp, but chip reaction interface 21 can be made to pass through its hollow region to expose.Chip reaction interface 21 can be mark
The nitrocellulose filter of detection probe is remembered, or nylon membrane, plastics, glass, ceramics, etc..The structure of this fixture 24
Make simply, it is easy to use, and the effect for quickly and easily assembling and changing chip reaction interface 21 can be realized.
Example 2
In this example, mycobacterium tuberculosis identification is carried out using biochip as shown in Figure 4.Secure branch bar
The nitrocellulose diaphragm of bacterium probe is fixed on the end of sticking plaster, and end plastic sheet, which can be folded up, clamps membrane DNA chip.
During detection, the processes such as chip hybridization, washing and colour developing are completed in end immersion in the solution.Relevant parameter is as follows:Nucleic acid membrane array,
Using 2 test points, containing 2 detection nucleic acid probes (Mycobacterium probe, mycobacterium tuberculosis probe);Develop the color spot, leads to
Cross naked eyes sentence read result.
Each step introduced below that the method for mycobacterium tuberculosis identification is carried out using biochip as shown in Figure 4.
Step 1:The making of membrane DNA chip
Design synthesis mycobacteria probe:
Mycobacterium probe sequence MY:TTTTTTTTTTGTATTAGACCCAGTTTCCC
Mycobacterium tuberculosis probe TB:TTTTTTTTTTAAGACATGCATCCCGT
Negative control probe YX:TTTTTTTTTTATGCCTTTAAGCATGGCA
Probe solution is prepared:Probe is prepared using TE solution, is diluted to 10 μM of concentration.
Fixation of the probe on membrane DNA chip:In nitrocellulose filter (10 × SSC buffer solutions soak 5min, drying) point sample,
Take above each 1 μ L points of 3 probe solutions on film, 2hr are dried in 80 DEG C.
Probe arrangement schematic diagram is as shown in Figure 5 a.
Membrane DNA chip is clipped into sticking plaster end, fixed.Sealing is dried, is preserved.
Step 2:Detect preparation of samples
Sample 04:Concretion mycobacterium nucleic acid
Sample 05:Sterilized water
PCR system amplified sample 04, sample 05 are prepared using the primer sequence of 16SDNA genes, taq enzymes etc..
Upstream primer sequence Y01:GG TGG CTC AGG ACG AAC G (biotin labeling);Downstream primer sequence
Y02GGCT TGC GCC CAT TGT G, are configured to 20 μM of concentration.
Pcr amplification reaction system prepares (50 μ L):
PCR response procedures:95 DEG C, 10min;95 DEG C, 2min, 50 DEG C, 1min, 68 DEG C, 1min, 35cycles;72 DEG C,
5min.- 20 DEG C of storages of PCR primer are standby.
Step 3:Detection
1) 2 1.5ml EP pipes are taken, carry out mark, add conventional phosphoric acid buffer (3 × SSPE) 1ml, take 20 μ L 2 samples
This PCR primer is added, and 10min denaturation is heated in 95 DEG C, and taking-up is placed in mixture of ice and water processing.
2) the vertical membrane DNA chip of 2 preparations is taken out, is marked.Vertical membrane DNA chip is inserted above in 2 EP pipes respectively, put
In being incubated 1hr in 50 DEG C of water-baths.
3) vertical membrane DNA chip is taken out, is transferred to two other added with 1ml buffer solutions 1 (0.1M Tris-HCl, pH7.5;
0.1M NaCl) EP pipe, rinse 2 times.
4) vertical membrane DNA chip is taken out, be transferred to two other added with 1ml streptavidins solution (1 μ g/ml, with added with
The buffer solution 1 of 3% bovine serum albumin(BSA) (BSA) dilutes) EP pipes in, 30min is incubated in 42 DEG C of water-baths.
5) vertical membrane DNA chip is taken out, is transferred to two other added with 1ml buffer solutions 2 (0.1M Tris-HCl, pH9.5;
0.1M NaCl;50M MgCl2) EP pipe, rinse 2 times.
6) vertical membrane DNA chip is taken out, being transferred to two other, (NBT solution and BCIP solution mix added with 1ml nitrite ions
Liquid) EP pipes in, normal temperature colour developing 10min.
7) vertical membrane DNA chip is taken out, rinsed in water twice, sentence read result.
Testing result is as shown in Fig. 5 and table 2 below.
Table 2
It can be seen that detecting mycobacterium tuberculosis using detection method provided by the invention, by way of spot is shown, obtain
Obtained accurate testing result.This example has used two chip reaction interfaces respectively while has determined two samples, can basis
Need to increase chip reaction interface number and sample to be tested number, by operating simultaneously, all samples to be tested can be detected simultaneously,
Improve detection efficiency.
In above-described embodiment, the chip handle for connecting chip reaction interface can be together in series by the base of biochip,
The combination of different chip chambers is realized, so may insure to detect same group of chip of same lot sample sheet in detection process each
All it is simultaneously operating in step, the step and detection time that can further save in detection.Simultaneously as base may insure
Same group of chip can keep certain spacing between each other, can prevent the intersection in detection process between differential responses liquid from making
Into the mutual pollution of chip chamber.In detection method provided by the invention, using the three-dimensional chip simultaneously operating of this combination, energy
The reaction time difference between different samples is enough eliminated, reduces the error rate of operation.Compared with prior art, make due to reducing simultaneously
Frequency and the usage amount for reducing consumptive material tip heads with pipettor, so as to simplify detection operational sequence, also reduce cost.
Biochip in above-described embodiment can use automation chip detector device to operate., can in detection process
To be moved back and forth by automating chip detector device operation biochip between reactive tank, so as to further improve inspection
Efficiency is surveyed, the reaction time difference between different samples can be eliminated, reduce the error rate of operation.
Although by reference to preferred embodiment, invention has been described, is not departing from the situation of the scope of the invention
Under, various improvement can be carried out to it and part therein can be replaced with equivalent.Especially, as long as being rushed in the absence of structure
Prominent, the every technical characteristic being previously mentioned in each embodiment can combine in any way.The invention is not limited in text
Disclosed in specific embodiment, but all technical schemes including falling within the scope of the claims.
Claims (10)
1. a kind of biomolecule detecting method, it is characterised in that comprise the following steps:
Step 1: providing biochip, the biochip includes:
Base,
Some chip handles being arranged in an array manner on the base, the chip handle is along perpendicular to the direction of the base
Stretched out in parallel to each other from the base, and
The chip reaction interface of the free end of each chip handle is arranged in, the chip reaction interface is longitudinally arranged into
Overlapped with the longitudinal direction of the chip handle;
Step 2: it is fixed for the detection probe of specific detection biomolecule to be measured respectively in each chip reaction interface;
Step 3: each chip reaction interface is set to be contacted with sample to be tested, to detect the biomolecule to be measured in testing sample;With
Step 4: obtain the detection signal of each chip reaction interface.
2. detection method according to claim 1, it is characterised in that the chip reaction interface is fitted in the chip handle
Side;It is preferred that the chip handle is sticking plaster.
3. detection method according to claim 1, it is characterised in that the chip handle is strip, and its first
Side is provided with the fixture for being used for fixing the chip reaction interface;It is preferred that the fixture is folded clamp clip, for by institute
Chip reaction interface is stated to be fixedly clamped in the first side.
4. detection method according to claim 1, it is characterised in that the chip handle is strip, in the chip handle
First side be provided with mounting hole, the chip reaction interface is arranged in the mounting hole.
5. detection method according to claim 1, it is characterised in that if the base is the rectangle base with dry hole,
Each hole is constructed to be permeable to the installation end removably clamping with a corresponding chip handle.
6. detection method according to any one of claim 1 to 5, it is characterised in that the number of the chip handle be 1~
100, preferably 2~20.
7. detection method according to claim 1, it is characterised in that the chip reaction interface is that marked detection probe
Nitrocellulose filter, nylon membrane, polystyrene film, sheet glass, plastic sheet or potsherd, preferably nitrocellulose filter, Buddhist nun
Imperial film or polystyrene film.
8. detection method according to any one of claim 1 to 7, it is characterised in that the detection probe is visited for nucleic acid
Pin and/or albumen probe, the probe of preferably described chip reaction interface mark is 1~50;And/or
The detection signal is any one in color signal, fluorescence signal or chemiluminescence signal.
9. detection method according to any one of claim 1 to 8, it is characterised in that in step 2, while each
It is fixed for the detection probe of specific detection biomolecule to be measured in chip reaction interface respectively.
10. detection method according to any one of claim 1 to 9, it is characterised in that in step 3, make each core
Piece reaction interface contacts with each sample to be tested respectively simultaneously, and each chip reaction interface is implemented to post-process simultaneously;And/or
In step 4, while obtain the detection signal of each chip reaction interface.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710446455.XA CN107338288A (en) | 2017-06-14 | 2017-06-14 | A kind of biomolecule detecting method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710446455.XA CN107338288A (en) | 2017-06-14 | 2017-06-14 | A kind of biomolecule detecting method |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107338288A true CN107338288A (en) | 2017-11-10 |
Family
ID=60220839
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710446455.XA Pending CN107338288A (en) | 2017-06-14 | 2017-06-14 | A kind of biomolecule detecting method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107338288A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110530692A (en) * | 2019-08-16 | 2019-12-03 | 南方医科大学珠江医院 | A kind of preparation method of different depth imaging of tissue experimental model |
Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1054056A1 (en) * | 1998-02-10 | 2000-11-22 | Toyo Kohan Co., Ltd | Apparatus for immobilized dna library preparation, apparatus for gene amplification, method for temperature control and method for comparing genes systematically |
US20020018991A1 (en) * | 1995-06-07 | 2002-02-14 | Richard P. Rava | Method for concurrently processing multiple biological chip assays |
CN1387044A (en) * | 2001-05-22 | 2002-12-25 | 东南大学 | Embedded biochip and its preparing process |
CN2578830Y (en) * | 2002-11-15 | 2003-10-08 | 胡东升 | Micro-array chip configurating device of biological tissue |
CN2777542Y (en) * | 2004-11-26 | 2006-05-03 | 珠海市永如生物技术发展有限公司 | Combined covex type many person portion protein chip |
CN201096776Y (en) * | 2007-10-30 | 2008-08-06 | 江苏三联生物工程有限公司 | Biologic chip |
CN103908982A (en) * | 2013-01-04 | 2014-07-09 | 索尼公司 | Liquid injection jig set |
CN105749995A (en) * | 2016-04-28 | 2016-07-13 | 宁波大学 | Biological chip hybrid device |
CN105940097A (en) * | 2014-02-10 | 2016-09-14 | 纳米生物系统株式会社 | PCR device provided with unidirectional sliding means and PCR method using same |
-
2017
- 2017-06-14 CN CN201710446455.XA patent/CN107338288A/en active Pending
Patent Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20020018991A1 (en) * | 1995-06-07 | 2002-02-14 | Richard P. Rava | Method for concurrently processing multiple biological chip assays |
EP1054056A1 (en) * | 1998-02-10 | 2000-11-22 | Toyo Kohan Co., Ltd | Apparatus for immobilized dna library preparation, apparatus for gene amplification, method for temperature control and method for comparing genes systematically |
CN1387044A (en) * | 2001-05-22 | 2002-12-25 | 东南大学 | Embedded biochip and its preparing process |
CN2578830Y (en) * | 2002-11-15 | 2003-10-08 | 胡东升 | Micro-array chip configurating device of biological tissue |
CN2777542Y (en) * | 2004-11-26 | 2006-05-03 | 珠海市永如生物技术发展有限公司 | Combined covex type many person portion protein chip |
CN201096776Y (en) * | 2007-10-30 | 2008-08-06 | 江苏三联生物工程有限公司 | Biologic chip |
CN103908982A (en) * | 2013-01-04 | 2014-07-09 | 索尼公司 | Liquid injection jig set |
CN105940097A (en) * | 2014-02-10 | 2016-09-14 | 纳米生物系统株式会社 | PCR device provided with unidirectional sliding means and PCR method using same |
CN105749995A (en) * | 2016-04-28 | 2016-07-13 | 宁波大学 | Biological chip hybrid device |
Non-Patent Citations (1)
Title |
---|
孙建伟: "《现代医学检验技术与治疗医用 上》", 31 May 2017, 吉林科学技术出版社 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110530692A (en) * | 2019-08-16 | 2019-12-03 | 南方医科大学珠江医院 | A kind of preparation method of different depth imaging of tissue experimental model |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11560592B2 (en) | Method for resetting an array | |
JP3739528B2 (en) | Automatic determination and measurement apparatus and method | |
CN110904206A (en) | Liquid path system, biomolecule analysis system and nucleic acid sequence measuring system | |
JP2004163408A (en) | System and cartridge for processing biological sample | |
CN101812527B (en) | Method for quickly detecting six kinds of genetically modified corns | |
PT1080228E (en) | In situ hybridization method for detecting target nucleic acid | |
CN105133040B (en) | A kind of genetic chip for detecting Sea central platform and preparation method thereof and detection method | |
CN106226540B (en) | Full-automatic protein chip analyzer | |
CN104031990B (en) | Pku PAH gene detecting kit | |
CN109387626A (en) | For multiple diagnostic and alignment biochip | |
CN206038700U (en) | Full -automatic protein chip analysis appearance | |
CN109486665A (en) | A kind of nucleic acid amplification hybrid organisms chip reaction tube | |
CN107338288A (en) | A kind of biomolecule detecting method | |
CN108603879A (en) | The method of sample Multiple Cycle and in situ imaging | |
CN101561392B (en) | Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same | |
JP2018520708A (en) | Modular flow cell and sequencing method | |
CN110196242A (en) | A kind of full-automatic high flux biochip detection platform | |
CN202482330U (en) | Disease source bacteria nanometer visualization gene chip for four diarrheal diseases | |
CN107418874A (en) | A kind of biochip | |
CN107340388A (en) | A kind of biomolecule detecting method | |
CN104359957B (en) | A kind of electrochemical sensor and preparation and application thereof | |
JP2024508042A (en) | Biochip for spatial transcriptome analysis, its manufacturing method and use | |
JP2004222533A (en) | Smoke exposure testing module, and smoke exposure testing method using the module | |
CN107389933B (en) | A kind of biochip | |
CN210626334U (en) | Assembly structure of full-automatic high-flux biochip detection platform |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171110 |
|
RJ01 | Rejection of invention patent application after publication |