CN107326088A - The method for detecting pest-resistant herbicide-resistant corn GH5112E 117C - Google Patents
The method for detecting pest-resistant herbicide-resistant corn GH5112E 117C Download PDFInfo
- Publication number
- CN107326088A CN107326088A CN201710695663.3A CN201710695663A CN107326088A CN 107326088 A CN107326088 A CN 107326088A CN 201710695663 A CN201710695663 A CN 201710695663A CN 107326088 A CN107326088 A CN 107326088A
- Authority
- CN
- China
- Prior art keywords
- resistant
- gh5112e
- sequence
- aroa
- mcry1ah
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of method for detecting pest-resistant herbicide-resistant corn GH5112E 117C.Provided by the present invention flanking sequence, detection primer and its application for turning mG2 aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E 117C external source Insert Fragments, the flanking sequence is 3 ' flanking sequences shown in sequence 1 and/or 5 ' flanking sequences shown in sequence 2.The present invention can precise Identification turn mG2 aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E 117C, and this method accuracy rate height, high specificity, sensitivity are high.
Description
Technical field
The invention belongs to biological technical field, it is related to a kind of for detecting pest-resistant herbicide-resistant corn GH5112E-117C's
Method, more particularly to a kind of flank sequence for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C
Row, detection primer pair and detection method.
Background technology
Current foreign gene such as Bt, EPSPS applied in plant transgene breeding etc., mostly from prokaryotes,
The characteristics of due to prokaryotic gene itself, such as 1) AT contents are higher, more than 60%, cause the mRNA of gene expression in plant
Inside easily it is degraded；2) there are introne point of contact, the transcription terminator sequences of similar eukaryotic gene, cause transcription it is imperfect,
MRNA abnormal cleavages etc.；3) with vegetable codon there is larger difference in codon, cause the reduction of protein translation efficiency；4) its structure
With the eucaryote significant difference such as plant, 5 '-UTR sequence of eukaryotic gene and the polyA tailings of 3 ' ends are not contained such as
Sequence, causing gene, often expression is relatively low in plant.For example, coming from the wild type desinsection of bacillus thuringiensis
Expression quantity of the GFP in plant is very low, and its toxalbumin expressed only accounts for the 0.001% of total protein or almost detected
Less than.
Corn borer is global Major Maize insect, and corn yield loss is left 5% caused by corn borer endangers every year
It is right.It is almost every two years just big to occur once since China is the multiple of corn borer and retransmits area, 1970s, year loss
Ten thousand tons of corn 380-640, the yield saved equivalent to a medium corn.
Because the endogenous insect resistace of corn is by controlled by multiple genes, and lobus cardiacus phase target pest and ear period target pest base
Because of respective independent inheritance, cultivating anti-snout moth's larva cenospecies with conventional breeding methods, not only the cycle is long, and is difficult to obtain and resist two generation
For the parent of corn borer.Meanwhile, the anti-snout moth's larva gene of corn is probably negatively correlated with high-yield character, 20 Nian Lai various countries breeding in resistance to the Asian Corn Borer
Do not make great progress.
Team is in previous work where the present inventor, by glyphosate-tolerant gene G2-aroA and anti insect gene
Cry1Ah codons optimize, after be transferred in corn, obtain transgenic corns, and be verified by experiments and phase before codon optimization
Than the expression quantity that the transgenic corns general performance after codon optimization goes out G2-aroA and Cry1Ah albumen is significantly improved, and right
The tolerance and insect resistace of glyphosate are also significantly improved (Chinese patent application, application number 201510845655.3).
The content of the invention
It is an object of the invention to provide turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C
Flanking sequence, detection primer pair and detection method.
In the present invention, it is described to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C tools
Body is CGMCC for the deposit number for being preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC)
No.14334 corn strain.
It is provided by the present invention to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E-117C external sources
The flanking sequence of Insert Fragment, is specially following (1) or (2) or (3)：
(1) 3 ' flanking sequence；
(2) 5 ' flanking sequences；
(3) it is made up of the 3 ' flanking sequence and the 5 ' flanking sequence；
The nucleotides sequence of the 3 ' flanking sequence is classified as sequence 1 in sequence table, or is turning mG2-aroA and mcry1Ah bases
Because at least containing sequence 1 in ordered list in pest-resistant herbicide-resistant corn GH5112E-117C genome, and along turning mG2-
Gained after the direction of aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C genome extends to 3 ' ends
Sequence；
5 ' the flanking sequence is sequence 2 in sequence table, or is turning the resistance to weeding of mG2-aroA and mcry1Ah gene pest-resistants
At least contain sequence 2 in ordered list in agent corn GH5112E-117C genome, and along turning mG2-aroA and mcry1Ah
The sequence of gained after the direction of gene pest-resistant herbicide-resistant corn GH5112E-117C genome extends to 5 ' ends.
The flanking sequence it is following it is any in application fall within protection scope of the present invention：
A) detect or aid in whether detection corn to be measured is to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C；
B) detect or aid in whether to contain in detection sample to be tested and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistants
Corn GH5112E-117C.
The invention provides for detecting or aiding in detection to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C primer pair or primer pair group or single stranded DNA group.
The primer pair is primer pair 1 or primer pair 2.
The primer pair group is made up of the primer pair 1 and the primer pair 2.
The single stranded DNA group is following (I) or (II) or (III)：
(I) the single stranded DNA group 1 being made up of the primer pair 1 and single-stranded probe 1；
(II) the single stranded DNA group 2 being made up of the primer pair 2 and single-stranded probe 2；
(III) the single stranded DNA group 3 being made up of the single stranded DNA group 1 and the single stranded DNA group 2.
Wherein, the sense primer of the primer pair 1 can be obtained according to the design of the T-DNA insetion sequences in the 3 ' flanking sequence
, anti-sense primer can be obtained according to the intrinsic sequences Design of the Maize genome in the 3 ' flanking sequence.The primer pair 2 it is upper
Swimming primer can obtain according to the intrinsic sequences Design of the Maize genome in the 5 ' flanking sequence, and anti-sense primer can be according to described 5 '
T-DNA insetion sequences design in flanking sequence is obtained.
Accordingly, the single-stranded probe 1 can be designed according to the 3 ' flanking sequence, and described in the 3 ' flanking sequence
The identification region of single-stranded probe 1 be located at the primer pair 1 sense primer identification region and anti-sense primer identification region it
Between；5 ' ends of the single-stranded probe 1 are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescent quenching group.The single-stranded probe 2
Can be designed according to the 5 ' flanking sequence, and the single-stranded probe 2 described in the 5 ' flanking sequence identification region be located at it is described
Between the identification region of the sense primer of primer pair 2 and the identification region of anti-sense primer；5 ' ends of the single-stranded probe 2 are marked with
Fluorescent reporter group, 3 ' ends are marked with fluorescent quenching group.
Further, when the 3 ' flanking sequence is sequence 1 in sequence table, the sense primer of the primer pair 1 can basis
1-294 designs of sequence 1 are obtained in sequence table, and anti-sense primer can be according to 295-712 of sequence in sequence table 1 designs
Obtain；The single-stranded probe 1 can be designed according to sequence in sequence table 1, and the identification region of the single-stranded probe 1 described in sequence 1
Between the identification region of sense primer and the identification region of anti-sense primer of the primer pair 1.When the 5 ' flanking sequence
For during sequence 2, the sense primer of the primer pair 2 can be obtained according to 1-319 designs of sequence in sequence table 2 in sequence table
, anti-sense primer can be obtained according to 320-393 of sequence in sequence table 2 designs；The single-stranded probe 2 can be according to sequence table
Middle sequence 2 is designed, and the single-stranded probe 2 described in sequence 2 identification region be located at the primer pair 2 sense primer identification
Between region and the identification region of anti-sense primer.
In the present invention, the primer pair 1 is specially following (a1) or (a2)：(a1) sequence 3 and sequence 4 in sequence table
The primer pair of shown two single strand dnas composition；(a2) as two single stranded DNAs shown in sequence in sequence table 7 and sequence 8
The primer pair of molecular composition.The primer pair 2 is specially as two single strand dnas shown in sequence in sequence table 5 and sequence 6
The primer pair of composition.Specific two single strand dnas shown in sequence in sequence table 7 and sequence 8 of the single stranded DNA group are constituted
(5 ' ends are marked with fluorescent reporter group to single-stranded probe in primer pair, and sequence table shown in sequence 9, and 3 ' ends are marked with fluorescence
Quenching group) composition.
In a particular embodiment of the present invention, the fluorescent reporter group is specially FAM；The fluorescent quenching group is specific
For BHQ1.
In the present invention, each single stranded DNA in the primer pair or the primer pair group or the single stranded DNA group can be distinguished
Individually packaging, also can equimolar it is hybrid packed.
Primer pair or the primer pair group or single stranded DNA group prepare be used for detect or aid in detection turn mG2-aroA and
Application in mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C kit falls within the protection model of the present invention
Enclose.
The invention provides for detecting or aiding in detection to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C kit.
It is provided by the present invention to be used to detect or aid in detection to turn mG2-aroA and mcry1Ah gene pest-resistants herbicide-resistant jade
Rice GH5112E-117C kit, includes the primer pair or primer pair group or single stranded DNA group.
Primer pair or the primer pair group or single stranded DNA group or the kit it is following it is any in application fall within this
The protection domain of invention：
A) detect or aid in whether detection corn to be measured is to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C；
B) detect or aid in whether to contain in detection sample to be tested and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistants
Corn GH5112E-117C.
Whether it is that to turn mG2-aroA and mcry1Ah gene pest-resistants resistance to the invention provides detection or auxiliary detection corn to be measured
Herbicide corn GH5112E-117C method.
Whether detection or auxiliary detection provided by the present invention corn to be measured is to turn mG2-aroA and mcry1Ah gene pest-resistants
Herbicide-resistant corn GH5112E-117C method, can be following any：
(A) comprise the following steps：
(a1) genomic DNA using the corn to be measured is carried out as template using the primer pair 1 or the primer pair 2
PCR is expanded, and obtains PCR primer；
(a2) whether according to the size of the PCR primer, it is to turn mG2- that the corn to be measured is determined as follows
AroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If containing expected size in the PCR primer
DNA fragmentation, then the corn to be measured is or candidate is to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C；Conversely, then the corn to be measured be not or candidate mG2-aroA and mcry1Ah gene pest-resistants are resistance to be removed to turn
Careless agent corn GH5112E-117C.
(B) comprise the following steps：
(b1) genomic DNA using the corn to be measured is distinguished as template using the primer pair 1 and the primer pair 2
Enter performing PCR amplification, obtain PCR primer；
(b2) whether according to the size of the PCR primer, it is to turn mG2- that the corn to be measured is determined as follows
AroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If the primer pair 1 and the primer pair 2 are respective
DNA fragmentation in the corresponding PCR primer containing expected size, then the corn to be measured is or candidate is to turn mG2-
AroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Conversely, then the corn to be measured be not or candidate not
To turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C.
(C) comprise the following steps：
(c1) genomic DNA using the corn to be measured is template, using the single stranded DNA group 1 or the single stranded DNA group
2 carry out real-time fluorescence quantitative PCR amplification；
(c2) according to the real-time fluorescence quantitative PCR amplification, determine as follows be in the sample to be tested
It is no containing turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If Ct values are less than 38, described
Contain in sample to be tested or candidate is contained and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；
If otherwise Ct values be more than or equal to 38 or can not show, do not contained in the sample to be tested or candidate do not contain turn mG2-aroA with
Mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C.
(D) comprise the following steps：
(d1) genomic DNA using the corn to be measured is template, using the single stranded DNA group 1 and the single stranded DNA group
2 carry out real-time fluorescence quantitative PCR amplification respectively；
(d2) according to the real-time fluorescence quantitative PCR amplification, the corn to be measured is determined as follows whether
To turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：According to the He of single stranded DNA group 1
Ct values respectively less than 38, then described to be measured in two real-time fluorescence quantitative PCR amplification procedures that the single stranded DNA group 2 is carried out respectively
Corn is or candidate is to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Conversely, then described
Corn to be measured is not or candidate is not to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C.
Whether the invention provides anti-containing mG2-aroA and mcry1Ah genes are turned in detection or auxiliary detection sample to be tested
Worm herbicide-resistant corn GH5112E-117C method.
Whether contain in detection provided by the present invention or auxiliary detection sample to be tested and turn mG2-aroA and mcry1Ah genes
Pest-resistant herbicide-resistant corn GH5112E-117C method, can be following any：
(A) comprise the following steps：
(a1) it is template genomic DNA to be extracted from the sample to be tested, using the primer pair 1 or the primer pair 2
Enter performing PCR amplification, obtain PCR primer；
(a2) according to the size of the PCR primer, whether determine as follows in the sample to be tested containing turning
MG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If containing expected size in the PCR primer
DNA fragmentation, then contain in the sample to be tested or candidate contain that to turn mG2-aroA and mcry1Ah gene pest-resistants herbicide-resistant beautiful
Rice GH5112E-117C；Conversely, not contained in the sample to be tested then or candidate does not contain and turns mG2-aroA and mcry1Ah genes
Pest-resistant herbicide-resistant corn GH5112E-117C.
(B) comprise the following steps：
(b1) it is template genomic DNA to be extracted from the sample to be tested, using the primer pair 1 and the primer pair 2
Enter performing PCR amplification respectively, obtain PCR primer；
(b2) according to the size of the PCR primer, whether determine as follows in the sample to be tested containing turning
MG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If the primer pair 1 and the primer pair 2
Each the DNA fragmentation in the corresponding PCR primer containing expected size, then contain in the sample to be tested or candidate contain
Have and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Conversely, then in the sample to be tested not
Contain or candidate does not contain and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C.
(C) comprise the following steps：
(c1) it is template genomic DNA to be extracted from the sample to be tested, using the single stranded DNA group 1 or described single-stranded
DNA groups 2 carry out real-time fluorescence quantitative PCR amplification；
(c2) according to the real-time fluorescence quantitative PCR amplification, determine as follows be in the sample to be tested
It is no containing turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If Ct values are less than 38, described
Contain in sample to be tested or candidate is contained and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；
If otherwise Ct values be more than or equal to 38 or can not show, do not contained in the sample to be tested or candidate do not contain turn mG2-aroA with
Mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C.
(D) comprise the following steps：
(d1) it is template that genomic DNA is extracted from the sample to be tested, using the single stranded DNA group 1 and described single-stranded
DNA groups 2 carry out real-time fluorescence quantitative PCR amplification respectively；
(d2) according to the real-time fluorescence quantitative PCR amplification, determine as follows be in the sample to be tested
It is no containing turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：According to the single stranded DNA group
1 and two real-time fluorescence quantitative PCR amplification procedures carrying out respectively of the single stranded DNA group 2 in Ct values be respectively less than 38, then it is described to treat
Contain in test sample sheet or candidate is contained and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Instead
It, then do not contain in the sample to be tested or candidate do not contain and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C。
In (A) described in above two method and (B), when the primer pair 1 is sequence 3 and sequence in sequence table
During the primer pair of two single strand dnas composition shown in row 4, the DNA fragmentation of the expected size is 712bp DNA fragmentation；
It is described when the primer pair that the primer pair 2 constitutes for the sequence 5 in sequence table and two single strand dnas shown in sequence 6
It is expected that the DNA fragmentation of size is 393bp DNA fragmentation.
Further, the DNA fragmentation of the 712bp is specially DNA fragmentation shown in sequence 1 in sequence table；The 393bp's
DNA fragmentation is specially DNA fragmentation shown in sequence 2 in sequence table.
The present invention is according to the flank sequence for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C
Row design is obtained as the primer pair 1 shown in sequence in sequence table 3 and sequence 4, as drawing shown in sequence in sequence table 5 and sequence 6
Thing is to 2, and has the primer pair and probe shown in sequence 7-9.It is demonstrated experimentally that using the primer pair 1 and primer pair 2 by common
PCR, or corn to be measured can detect by the method for real-time fluorescence quantitative PCR using the primer pair and probe shown in sequence 7-9
Whether be to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E-117C, and in sample to be tested whether
Containing turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E-117C, and this method accuracy rate is high, special
The strong, sensitivity of property is high.
Brief description of the drawings
Fig. 1 is the 3 ' flanking sequences for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C
Specific PCR detects collection of illustrative plates.1：D2000marker；2：Blank control；3：Acceptor material (negative control)；4：It is other to turn mG2-
AroA and mcry1Ah gene conversion events corns 5-6：Turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C。
Fig. 2 is the 5 ' flanking sequences for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C
Specific PCR detects collection of illustrative plates.1：D2000marker；2：Acceptor material (negative control)；3-4：Turn mG2-aroA and mcry1Ah
Gene pest-resistant herbicide-resistant corn GH5112E-117C；5：It is other to turn mG2-aroA and mcry1Ah gene conversion events corns.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
Embodiment 1, the acquisition for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C and property
Shape is identified
First, mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C acquisition is turned
According to the Chinese patent application (application number of team's early stage application where the present inventor
201510845655.3) embodiment 2 is operated, and obtains several T for being transferred to mG2-aroA and mcry1Ah genes6In generation, turns
Gene corn strain, GH5112E-117C is designated as by one of strain.
2nd, mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C Characters Identification is turned
Several obtained to step one are transferred to mG2-aroA and mcry1Ah T6It is sweet that grass is carried out for transgenic corns strain
Phosphine resistance and insect resistace identification.
A. the concrete operations of glyphosate resistance are as follows：
1st, experimental design：5M rows length, 3 row areas, 3 repetitions, density：60×35cm.
2nd, test process：Agriculture is sprayed according to about 6 times of consumptions for recommending glyphosate concentration -1200ml/ mus to reach
(Roundup, containing 41% glyphosate, field recommends dosage for 150-250ml/ mus).
3rd, test process period：The 5-6 leaf phases.Start observation experiment result after 7 days.Each strain observes at least 20 plants.
As a result show, turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C growths normally,
And other are transferred to the T of mG2-aroA and mcry1Ah genes6There are different glyphosates to endanger for transgenic corns strain.
B. the concrete operations of insect resistace identification are as follows：
1st, experimental design：5M rows length, 3 row areas, 3 repetitions, density：60×35cm
2nd, test process：Worm will be connect for examination plant, every plant connect artificial feeding newly hatched larvae (corn borer) 30~40, use
Writing brush is inoculated into corn lobus cardiacus, after connecing worm 3 days, connects worm the 2nd time, connects borer population amount with the 1st time.After 14 days investigate maize leaf by
The extent of injury and larvae alive number of corn borer, investigation are performed by corn insect resistace identification technology specification NY/T 1248.5.
3rd, test process period：Artificial Inoculation of Anoplophora glabripennis is carried out when plant is developed to the 8-10 leaf phases (toy trumpet mouthful phase), is connect
Worm selection of time in the morning or at dusk.
As a result show：Turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C food leaf-size class
Wei not be 0 grade, and other are transferred to the T of mG2-aroA and mcry1Ah genes6Food leaf level for transgenic corns strain is 3 grades.
The present inventor is further by GH5112E-117C strains in field planting, to except glyphosate resistance and pest-resistant
Property outside other economical characters investigated, as a result find GH5112E-117C strains on other economical characters, such as breeding time,
Plant height, yield, nutritional ingredient of seed etc., basically identical with transgene receptor-corn variety, no difference of science of statistics.
To sum up, it is seen that GH5112E-117C strains not only show extremely strong glyphosate resistance and insect resistace, and
The excellent economical character of receptor parent is maintained well.The present inventor is by the GH5112E-117C strains in 2017
August is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on the 9th, and (abbreviation CGMCC, address is：Beijing
The institute 3 of city Chaoyang District North Star West Road 1), ginseng Ju biomaterial (strain) be GH5112E-117C, it is proposed that Classification And Nomenclature for jade
Rice (Zea mays), its deposit number is CGMCC No.14334.
Embodiment 2, detection turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C reagent
The preparation of box
First, gram of mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C flanking sequence is turned
It is grand
Turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistants using Genome walking method is isolated
The following flanking sequence of two of corn GH5112E-117C.Referring in particular to Genome walking kits (TaKaRa Code：
D316) specification is operated.
1st, 3' ends flanking sequence
Its nucleotide sequence is as shown in sequence 1 in sequence table.3' ends flanking sequence T-DNA LB sequences on conversion carrier
Column-slice section and maize genomic sequence fragment two parts composition.Specifically, 1-294 of sequence 1 are T-DNA on conversion carrier
LB sequence fragments, 295-712 are maize genomic sequence fragment.
2nd, 5' ends flanking sequence
Its nucleotide sequence is as shown in sequence 2 in sequence table.The 5' ends flanking sequence by maize genomic sequence fragment and
T-DNA RB sequence fragments two parts are constituted on conversion carrier.Specifically, 1-319 of sequence 2 are maize genomic sequence
Fragment, 320-393 are T-DNA RB sequence fragments on conversion carrier.
2nd, detection turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C kit
Prepare
A. mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C is turned according to what step one was obtained
Two flanking sequences, the specific primer pair of design screening, for preparing regular-PCR kit.
Regular-PCR kit conventional reagent needed for following two special primers pair and PCR is constituted.
The primer pair 1 designed for 3' ends flanking sequence (sequence 1)：
M3Z4：5 '-GCCTCCCTGACGATTCTGGT-3 ' (sequence 3)；
C10F2：5 '-CCAAGCAACAAAATGAAACAAAAC-3 ' (sequence 4).
In theory, using primer pair 1 pair turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-
117C genomic DNA, which enters performing PCR amplification, can obtain the purpose band that size is 712bp, that is, obtain the shown DNA pieces of sequence 1
Section.
The primer pair 2 designed for 5' ends flanking sequence (sequence 2)：
C2F2：5 '-TTAGTGTTGAGCACATTTCCTG-3 ' (sequence 5)；
M3z2：5 '-TCGACCCAGGTACATTAAAAACGT-3 ' (sequence 6).
In theory, using primer pair 2 pairs turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-
117C genomic DNA, which enters performing PCR amplification, can obtain the purpose band that size is 393bp, that is, obtain the shown DNA pieces of sequence 2
Section.
B. mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C is turned according to what step one was obtained
3 ' flanking sequences, the design specific primer pair of screening and probe, for preparing real-time fluorescence quantitative PCR kit.
Primers F：5 '-TCTGAGGCAGATGGGTGTC-3 ' (sequence 7)；
Primer R：5 '-GTTAGGGTTTGTTTGGTTTGCT-3 ' (sequence 8)；
Probe：5 '-(FAM) ACCGGATGACACGAGCTATGGTTAA (BHQ1) -3 ' (sequence 9).
In theory, using primer pair F/R to turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-
117C genomic DNA, which enters performing PCR amplification, can obtain the purpose band that size is 111bp, that is, obtain the 257-367 of sequence 2
DNA fragmentation shown in position.
Embodiment 3, detection turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C reagent
The specificity and sensitivity technique of box
First, detection turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C regular-PCR examination
The specific detection of agent box
For sample sheet：Turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C, embodiment 1
Other obtained are transferred to the T of mG2-aroA and mcry1Ah genes6For transgenic corns strain, and transformation receptor corn variety
HiII。
Two specific primers are to (primer pair 1 and primer pair 2) difference in the regular-PCR kit obtained with embodiment 2
To each confession sample, this progress is detected, to verify the specificity of primer pair 1 and primer pair 2.Each sample uses identical detection side
Method, it is specific as follows：
Genomic DNA is extracted from each confession sample sheet respectively, as template, the regular-PCR reagent obtained using embodiment 2
Two specific primers enter performing PCR amplification to (primer pair 1 and primer pair 2) respectively in box.
The reaction system that two primer pairs are used is consistent.
Reaction system (20 μ l)：The μ l of 2 × Easy Taq PCR SuperMix 10, (consumption is equal by each 0.5 μ l of upstream and downstream primer
For 250nm), template DNA 1 μ l (100ng), ddH2O 8μl.Wherein, 2 × Easy Taq PCR SuperMix are the full formula in Beijing
Golden Bioisystech Co., Ltd's product, its catalog number is AS111-13.
Use the response procedures of primer pair 1 for：94℃5min；94 DEG C of 40s, 56 DEG C of 30s, 72 DEG C of 40s, 35 circulations；72
℃10min。
Use the response procedures of primer pair 2 for：94℃5min；94 DEG C of 40s, 54 DEG C of 30s, 72 DEG C of 40s, 35 circulations；72
℃10min。
After reaction terminates, PCR primer is subjected to 1% agarose gel electrophoresis.
Experiment sets the blank control that template DNA is replaced with water simultaneously.
As a result as depicted in figs. 1 and 2, performing PCR amplification is entered to (primer pair 1 and primer pair 2) using two specific primers,
Only turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C amplifications and obtain purpose band
(amplification of primer pair 1 is used to obtain purpose band of the size for 712bp；The amplification of primer pair 2 is used to obtain size for 393bp's
Purpose band), and other T for being transferred to mG2-aroA and mcry1Ah genes6For transgenic corns strain, and transformation receptor
Corn variety HiII does not obtain purpose band.The size that the present inventor further obtains amplification is 712bp mesh
Band and size be sequenced for sample presentation after 393bp purpose band glue reclaim, as a result show 712bp purpose band really such as sequence
In list shown in sequence 1,393bp purpose band is really as shown in sequence 2 in sequence table.Result above shows that embodiment 2 is obtained
To regular-PCR kit in primer pair 1 and primer pair 2 have stronger specificity.
2nd, detection turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C real-time fluorescence
Specificity and the detection line identification of quantitative PCR kit
For sample sheet：Turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C, embodiment 1
2 obtained other be transferred to the T of mG2-aroA and mcry1Ah genes6For transgenic corns strain (be designated as respectively 823C and
743C), and soybean and paddy rice (soybean and rice leaf pick up from the Chinese Academy of Agricultural Sciences and make institute of section).
Primer pair and probe originally enter to each confession sample respectively in the real-time fluorescence quantitative PCR kit obtained with embodiment 2
Row detection, to verify the specificity of the primer pair and probe.Each sample uses identical detection method, specific as follows：
1st, the extraction of template DNA
Table 1CTAB Extraction buffers are formulated
(1) 50mL centrifuge tubes are taken, 20mL CTAB Extraction buffers (table 1) are added, preheated in 65 DEG C of constant temperature drying boxes
30min；
(2) 2.0g blades are weighed, addition liquid nitrogen is fully ground into powdered in mortar；
(3) in the liquid that powder is carefully scraped to centrifuge tube, mix.30min~1h is incubated in 65 DEG C of constant temperature drying boxes,
Jog is for several times therebetween；
(4) centrifuge tube is taken out, is cooled to after room temperature and adds 15mL phenol/chloroform/isoamyl alcohol (25:24:1, volume ratio), slightly
And be thoroughly mixed, the homogenate of mixing is transferred in 50mL centrifuge tubes, 8000rpm low-temperature centrifugations 10min；
(5) supernatant is transferred in new 50mL centrifuge tubes, the isopropanol for adding 2/3rds volumes is mixed, and makes nucleic acid
Precipitation is in cotton-shaped；
(6) 3000rpm centrifuges 2min, abandons in supernatant, centrifuge tube the addition ethanol of 10mL 70%, room temperature place 10min with
On；
(7) supernatant is removed after low-speed centrifugal, allows nucleic acid to be deposited in 65 DEG C of drying bakers and dry or drained with vacuum desiccator；
(8) 800 μ L sterilized waters (containing 100 μ g/mL RNaseA) are added, 37 DEG C of insulation more than 60min dissolving precipitations are abundant mixed
It is even, and digest RNA.
(9) postdigestive solution is transferred in 2mL centrifuge tubes, with phenol/chloroform/isoamyl alcohol (25:24:1, volume ratio) and
Chloroform/isoamyl alcohol (24:1, volume ratio) respectively extract once, if protein residue is still a lot, can repeatedly it be taken out again with above-mentioned denaturing liquid
Carry until Protein Extraction is clean.Want soft after denaturing liquid (phenol etc.) is added every time and be thoroughly mixed, place more than 10min
Afterwards, 12,000rpm normal temperature centrifugation 10min, suctions out supernatant.
(10) ammonium acetate (concentration 3M) of 1/10 volume is added in supernatant, the isopropanol of 2/3 volume, low temperature is then added
Lower placement more than 10min, 4 DEG C, 12,000rpm centrifugation 10min abandon supernatant；
(11) in precipitation add the ethanol of 1mL 70%, with hand flick it is several under, place more than 20min；12,000rpm is centrifuged
10min, abandons supernatant；Precipitation is dried up on super-clean bench, is precipitated with the μ L dissolving DNAs of sterilized water 200；
(12) 1 μ L DNA solutions are taken, DNA mass is checked with 0.8% agarose gel electrophoresis, and ultraviolet specrophotometer is surveyed
DNA content is measured, the DNA of extraction is standby in -20 DEG C or -80 DEG C refrigerations.
2nd, real-time fluorescence quantitative PCR is detected
Reaction system is as shown in table 2.
The real-time fluorescence quantitative PCR reaction system of table 2
Response procedures：95℃5min；95 DEG C of 30sec, 58 DEG C of 30sec, 72 DEG C of 30sec, totally 45 circulations.
The CFX96TM Touch Real-Time System qPCR instrument of BIO-RAD productions is used in the present embodiment,
Reagent primix Ex TaqTM are purchased from the products C at#RR390A of TAKARA companies, and probe is with primer in Invitrogen (Shanghai)
Trade Co., Ltd synthesizes.
3rd, standard curve is drawn
First by the gene for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C of extraction
Group DNA is quantitative (500ng/ μ L), then with 1:39 (volume ratios) dilute, and are then diluted to 7 concentration gradients by sesquialter dilution method, make
In the DNA extract solutions of dilution the copy number of sequence to be amplified be followed successively by (4438,2219,1109,555,277,139,69), so
1 μ L are taken to carry out qPCR amplifications by amplification template of the DNA of these dilutions afterwards, in triplicate, the standard curve of making is shown in Table for experiment
3：
The standard curve of 3 three repetitions of table
| Standard curve | Amplification efficiency | R2 |
| Y=-3.371x+39.86 | 0.98 | 0.999 |
| Y=-3.500x+39.93 | 0.93 | 0.998 |
| Y=-3.565x+40.55 | 0.95 | 0.998 |
In standard curve, y represents Ct values, and x represents Log10(copy number).
4th, detection method is verified
(1) detectable limit
By the genome for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C of extraction
DNA dilutes 355 times (500 copies), 3550 times (50 copies) and 35500 times (5 copies), takes 1 μ L to carry out qPCR amplifications,
And calculate the accuracy of detection.
It the results are shown in Table 4.The result shows that detectable limit has been reached in 5 copies, the detection sample DNA even extracted,
DNA profiling amount containing pest-resistant herbicide-resistant corn GH5112E-117C is 0.014ng/ μ L, can be examined using the detection method
Measure and contain GH5112E-117C transformation events in institute's test sample product.
DNA profiling is diluted to the copy number of 500 copies, 50 copies and 5 copy detections by table 4
| Template | Repeat 1 | Repeat 2 | Repeat 3 | Detect copy number | Deviation |
| 355 times of dilution (500 copies) | 520.4 | 578.0 | 533.7 | 544.0±27.0 | 8.8% |
| 3550 times of dilution (50 copies) | 54.1 | 58.1 | 54.2 | 55.5±2.0 | 10.9% |
| 35500 times of dilution (5 copies) | 5.3 | 4.6 | 4.8 | 4.9±1.7 | 2.2% |
(2) quantitation limit
By the genome for turning mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C of extraction
DNA is diluted to the amplification template containing 100 copies, takes 1 μ L to carry out qPCR amplifications.
Amplification Ct values are shown in Table 5.The result shows that quantitative detection limit reaches 100 copies, the detection sample even extracted
In DNA, the DNA profiling amount containing pest-resistant herbicide-resistant corn GH5112E-117C is 0.28ng/ μ L, is using the detection method
Can accurate quantitative analysis go out the content for detecting GH5112E-117C in sample.
DNA profiling is diluted to the copy number of 100 copy qPCR detections by table 5
(3) specificity is detected
A. infraspecific different transformant
Extraction turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E-117C, and embodiment 1 is obtained
2 other be transferred to the T of mG2-aroA and mcry1Ah genes6For transgenic corns strain (being designated as 823C and 743C respectively),
Genomic DNA, it is quantitative after, be diluted to 5 copies of amplification template, take 1 μ L to carry out qPCR amplifications.
As a result show, the primer and probe can only specific detection turn the resistance to weeding of mG2-aroA and mcry1Ah gene pest-resistants
Agent corn GH5112E-117C, and to 823C and 743C without amplification, amplification Ct values are shown in Table 6.
B. different species
Extraction turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E-117C, and soybean and water
The genomic DNA of rice, is diluted to 5 copies of amplification template, takes 1 μ L to carry out qPCR amplifications after quantifying.
As a result show, the primer and probe can only specific detection turn the resistance to weeding of mG2-aroA and mcry1Ah gene pest-resistants
Agent corn GH5112E-117C, and to soybean and oryza sativa genomic dna without amplification, amplification Ct values are shown in Table 6.
The Ct values of the checking test of table 6
Note：Sample concentration and Ct values are inversely proportional, and Ct values, which are more than or equal to 38 or can not shown, can determine that as feminine gender, otherwise can sentence
It is set to the positive.
<110>Beijing Aoruijin Seed Co., Ltd
<120>The method for detecting pest-resistant herbicide-resistant corn GH5112E-117C
<130> GNCLN171179
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 712
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
gcctccctga cgattctggt ccgcatgtcg gacactccac tccacctcgc ctggaccagg 60
agccctgtac cttgtcgtcc cagaagacgg ttacggtgac gccacccaac ttcccgttga 120
ctgggaaggt cgctccacct ggctccaagt ccatcaccaa ccgtgcactg ttgctggctg 180
cgttggccaa agggaccagt cggttgagcg gtgcgctcaa gtcggatgac actcgccaca 240
tgtcggtggc tctgaggcag atgggtgtca cgatcgacga accggatgac acgagctatg 300
gttaagcaga aaagttagac acattgtgac gtcttagcta gcaaaccaaa caaaccctaa 360
ctatgataca tttttaagtt ttttttccat tttttgttgt tagtgcatac atttcataaa 420
tccttatagg ttaagttaaa gatctatgtt tttttaaata ttttccattt ttctgttata 480
agtcggcatc attttatttc ctactcgaca atgaacaaag caggttttag cttatagcat 540
cgctgtacga ccaaataacg aataccaata aaatcatact tccacatata tatcatgtgc 600
gcctgtagct cagtggatag agcgtctgtt tcctaagcag aaggtcgtag gttcgacccc 660
tatctggcgc gtttttattt gaaaatttgt tttgtttcat tttgttgctt gg 712
<210> 2
<211> 393
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 2
ttagtgttga gcacatttcc tgtgagcttg catatctatt tctgacttga actgtatcac 60
ctcttcattc aggtgaggat tttgaccaga ggatcatgga atacttcatc aagttgatca 120
agaagaagta cagcaaggac atcggcaagg acaaccgtgc tcttggaaag ctgaggaggg 180
aagctgagcg tgccaagaga gcccttagca accagcacca ggtccgagtt gagatcgagt 240
ccctctttga cgggaccgac ttctcggagc cgctgacccg tgccaggttt gaggagctga 300
acaacgatct gttccgcaaa ttgtggtgta aacaaattga cgcttagaca acttaataac 360
acattgcgga cgtttttaat gtacctgggt cga 393
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
gcctccctga cgattctggt 20
<210> 4
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
ccaagcaaca aaatgaaaca aaac 24
<210> 5
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 5
ttagtgttga gcacatttcc tg 22
<210> 6
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 6
tcgacccagg tacattaaaa acgt 24
<210> 7
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 7
tctgaggcag atgggtgtc 19
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 8
gttagggttt gtttggtttg ct 22
<210> 9
<211> 25
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 9
accggatgac acgagctatg gttaa 25
Claims (10)
1. turn the flank sequence of mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corn GH5112E-117C external source Insert Fragments
Row, are following (1) or (2) or (3)：
(1) 3 ' flanking sequence；
(2) 5 ' flanking sequences；
(3) it is made up of the 3 ' flanking sequence and the 5 ' flanking sequence；
The nucleotides sequence of the 3 ' flanking sequence is classified as sequence 1 in sequence table, or resists turning mG2-aroA and mcry1Ah genes
At least contain sequence 1 in ordered list in worm herbicide-resistant corn GH5112E-117C genome, and along turning mG2-aroA
The sequence of gained after extending with the direction of mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C genome to 3 ' ends
Row；
5 ' the flanking sequence is sequence 2 in sequence table, or beautiful turning mG2-aroA and mcry1Ah gene pest-resistants herbicide-resistant
At least contain sequence 2 in ordered list in rice GH5112E-117C genome, and along turning mG2-aroA and mcry1Ah genes
The sequence of gained after the direction of pest-resistant herbicide-resistant corn GH5112E-117C genome extends to 5 ' ends.
2. flanking sequence described in claim 1 it is following it is any in application：
A) detect or aid in whether detection corn to be measured is to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C；
B) detect or aid in whether to contain in detection sample to be tested and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C。
3. turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C's for detecting or aiding in detect
Primer pair or primer pair group or single stranded DNA group；
The primer pair is primer pair 1 or primer pair 2；
The primer pair group is made up of the primer pair 1 and the primer pair 2；
The single stranded DNA group is following (I) or (II) or (III)：
(I) the single stranded DNA group 1 being made up of the primer pair 1 and single-stranded probe 1；
(II) the single stranded DNA group 2 being made up of the primer pair 2 and single-stranded probe 2；
(III) the single stranded DNA group 3 being made up of the single stranded DNA group 1 and the single stranded DNA group 2；
T-DNA insetion sequence design of the sense primer of the primer pair 1 according to claim 1 in 3 ' flanking sequences is obtained
, the intrinsic sequences Design of Maize genome of the anti-sense primer according to claim 1 in 3 ' flanking sequences is obtained；
Maize genome intrinsic sequence of the sense primer of the primer pair 2 according to claim 1 in 5 ' flanking sequences
Design is obtained, and T-DNA insetion sequence design of the anti-sense primer according to claim 1 in 5 ' flanking sequences is obtained；
The single-stranded probe 13 ' flanking sequences according to claim 1 are designed, and single described in the 3 ' flanking sequence
The identification region of chain probe 1 is located between the identification region of sense primer of the primer pair 1 and the identification region of anti-sense primer；
5 ' ends of the single-stranded probe 1 are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescent quenching group；
The single-stranded probe 25 ' flanking sequences according to claim 1 are designed, and single described in the 5 ' flanking sequence
The identification region of chain probe 2 is located between the identification region of sense primer of the primer pair 2 and the identification region of anti-sense primer；
5 ' ends of the single-stranded probe 2 are marked with fluorescent reporter group, and 3 ' ends are marked with fluorescent quenching group.
4. primer pair according to claim 3 or primer pair group or single stranded DNA group, it is characterised in that：
The primer pair 1 is following (a1) or (a2)：(a1) as two single stranded DNAs shown in sequence in sequence table 3 and sequence 4 point
Molecular primer pair；(a2) primer pair being made up of two single strand dnas shown in sequence in sequence table 7 and sequence 8；
The primer pair that the primer pair 2 constitutes for the sequence 5 in sequence table and two single strand dnas shown in sequence 6；
The primer pair that the single stranded DNA group two single strand dnas shown in the sequence 7 in sequence table and sequence 8 are constituted, and
Single-stranded probe composition in sequence table shown in sequence 9.
5. the primer pair or primer pair group or single stranded DNA group described in claim 3 or 4 are being prepared for detecting or aiding in detection to turn
Application in mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C kit.
6. turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C's for detecting or aiding in detect
Kit, includes primer pair or primer pair group or the single stranded DNA group described in claim 3 or 4.
7. the kit described in primer pair or primer pair group or single stranded DNA group or claim 6 described in claim 3 or 4 exists
It is following it is any in application：
A) detect or aid in whether detection corn to be measured is to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C；
B) detect or aid in whether to contain in detection sample to be tested and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C。
8. whether detection or auxiliary detection corn to be measured are to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C method, is following any：
(A) comprise the following steps：
(a1) genomic DNA using the corn to be measured is template, using primer pair 1 described in claim 3 or the primer
Enter performing PCR amplification to 2, obtain PCR primer；
(a2) according to the size of the PCR primer, determine as follows the corn to be measured whether be turn mG2-aroA and
Mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If the DNA fragmentation containing expected size in the PCR primer,
Then the corn to be measured is or candidate is to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；
Conversely, then the corn to be measured is not or candidate is not to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C；
(B) comprise the following steps：
(b1) genomic DNA using the corn to be measured is template, using primer pair 1 described in claim 3 and the primer
Enter performing PCR amplification respectively to 2, obtain PCR primer；
(b2) according to the size of the PCR primer, determine as follows the corn to be measured whether be turn mG2-aroA and
Mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If the primer pair 1 and the primer pair 2 are each corresponding
The PCR primer in DNA fragmentation containing expected size, then the corn to be measured be or candidate for turn mG2-aroA and
Mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Conversely, then the corn to be measured is not or candidate is not to turn
MG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；
(C) comprise the following steps：
(c1) genomic DNA using the corn to be measured is template, using single stranded DNA group described in claim 31 or the list
Chain DNA group 2 carries out real-time fluorescence quantitative PCR amplification；
(c2) according to the real-time fluorescence quantitative PCR amplification, determine whether contain in the sample to be tested as follows
Have and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If Ct values are less than 38, described to be measured
Contain in sample or candidate is contained and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；It is on the contrary
38 or can not be shown if Ct values are more than or equal to, do not contained in the sample to be tested or candidate do not contain turn mG2-aroA and
Mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；
(D) comprise the following steps：
(d1) genomic DNA using the corn to be measured is template, using single stranded DNA group described in claim 31 and the list
Chain DNA group 2 carries out real-time fluorescence quantitative PCR amplification respectively；
(d2) whether according to the real-time fluorescence quantitative PCR amplification, it is to turn that the corn to be measured is determined as follows
MG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：According to the single stranded DNA group 1 and described
Ct values are respectively less than 38 in two real-time fluorescence quantitative PCR amplification procedures that single stranded DNA group 2 is carried out respectively, then the corn to be measured
For or candidate to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Conversely, then described to be measured
Corn is not or candidate is not to turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C.
9. whether contain in detection or auxiliary detection sample to be tested and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C method, is following any：
(A) comprise the following steps：
(a1) it is template genomic DNA to be extracted from the sample to be tested, using primer pair 1 described in claim 3 or described
Primer pair 2 enters performing PCR amplification, obtains PCR primer；
(a2) according to the size of the PCR primer, whether determine as follows in the sample to be tested containing turning mG2-
AroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If containing expected size in the PCR primer
DNA fragmentation, then contain in the sample to be tested or candidate is contained and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C；Conversely, do not contained in the sample to be tested then or candidate do not contain turn mG2-aroA and mcry1Ah genes resist
Worm herbicide-resistant corn GH5112E-117C；
(B) comprise the following steps：
(b1) it is template that genomic DNA is extracted from the sample to be tested, using primer pair 1 described in claim 3 and described
Primer pair 2 enters performing PCR amplification respectively, obtains PCR primer；
(b2) according to the size of the PCR primer, whether determine as follows in the sample to be tested containing turning mG2-
AroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If the primer pair 1 and the primer pair 2 are respective
DNA fragmentation in the corresponding PCR primer containing expected size, then contain in the sample to be tested or candidate is contained and turned
MG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Conversely, not contained in the sample to be tested then
Or candidate does not contain and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；
(C) comprise the following steps：
(c1) it is template genomic DNA to be extracted from the sample to be tested, using single stranded DNA group described in claim 31 or institute
State single stranded DNA group 2 and carry out real-time fluorescence quantitative PCR amplification；
(c2) according to the real-time fluorescence quantitative PCR amplification, determine whether contain in the sample to be tested as follows
Have and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：If Ct values are less than 38, described to be measured
Contain in sample or candidate is contained and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；It is on the contrary
38 or can not be shown if Ct values are more than or equal to, do not contained in the sample to be tested or candidate do not contain turn mG2-aroA and
Mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；
(D) comprise the following steps：
(d1) it is template genomic DNA to be extracted from the sample to be tested, using single stranded DNA group described in claim 31 and institute
State single stranded DNA group 2 and carry out real-time fluorescence quantitative PCR amplification respectively；
(d2) according to the real-time fluorescence quantitative PCR amplification, determine whether contain in the sample to be tested as follows
Have and turn mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C：According to the He of single stranded DNA group 1
Ct values respectively less than 38, then described to be measured in two real-time fluorescence quantitative PCR amplification procedures that the single stranded DNA group 2 is carried out respectively
Contain in sample or candidate is contained and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns GH5112E-117C；Conversely,
Do not contained in the sample to be tested then or candidate does not contain and turns mG2-aroA and mcry1Ah gene pest-resistant herbicide-resistant corns
GH5112E-117C。
10. method according to claim 8 or claim 9, it is characterised in that：In (A) and (B), when the primer
During the primer pair constituted to 1 for the sequence 3 in sequence table and two single strand dnas shown in sequence 4, the expected size
DNA fragmentation is 712bp DNA fragmentation；When the primer pair 2 is single-stranded as two shown in sequence in sequence table 5 and sequence 6
During the primer pair of DNA molecular composition, the DNA fragmentation of the expected size is 393bp DNA fragmentation；
Specifically, the DNA fragmentation of the 712bp is DNA fragmentation shown in sequence 1 in sequence table；The DNA fragmentation of the 393bp is
DNA fragmentation shown in sequence 2 in sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710695663.3A CN107326088B (en) | 2017-08-15 | 2017-08-15 | Method for detecting insect-resistant herbicide-tolerant corn GH5112E-117C |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710695663.3A CN107326088B (en) | 2017-08-15 | 2017-08-15 | Method for detecting insect-resistant herbicide-tolerant corn GH5112E-117C |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107326088A true CN107326088A (en) | 2017-11-07 |
| CN107326088B CN107326088B (en) | 2020-06-16 |
Family
ID=60225077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710695663.3A Active CN107326088B (en) | 2017-08-15 | 2017-08-15 | Method for detecting insect-resistant herbicide-tolerant corn GH5112E-117C |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107326088B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880925A (en) * | 2017-12-06 | 2019-06-14 | 天津市农业质量标准与检测技术研究所 | A kind of detection method of the dual anti-12-6 specificity of transformant PCR of transgenic corns |
| CN110195122A (en) * | 2019-01-02 | 2019-09-03 | 四川省农业科学院生物技术核技术研究所 | It is a kind of for detecting the nucleic acid sequence and its detection method of corn plant T anti-4 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676553A (en) * | 2012-04-12 | 2012-09-19 | 北京奥瑞金种业股份有限公司 | Artificially synthesized glyphosate-tolerant gene and application thereof |
| CN104017881A (en) * | 2014-06-16 | 2014-09-03 | 北京奥瑞金种业股份有限公司 | Primer pair for detecting G2-aroA gene-modified herbicide-tolerant corn G11105E-823C |
| CN104032017A (en) * | 2014-06-16 | 2014-09-10 | 北京奥瑞金种业股份有限公司 | Primer pair for detecting G2-aroA genetically modified herbicide-tolerant corn G1105E-823C |
| CN104032014A (en) * | 2014-06-16 | 2014-09-10 | 北京奥瑞金种业股份有限公司 | Method and primer pair for detecting transgenic G2-aroA gene herbicide-resisting corn G1105E-823C |
| CN105400814A (en) * | 2015-11-26 | 2016-03-16 | 北京奥瑞金种业股份有限公司 | Method for cultivating insect-resistant transgenic maize |
-
2017
- 2017-08-15 CN CN201710695663.3A patent/CN107326088B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676553A (en) * | 2012-04-12 | 2012-09-19 | 北京奥瑞金种业股份有限公司 | Artificially synthesized glyphosate-tolerant gene and application thereof |
| CN104017881A (en) * | 2014-06-16 | 2014-09-03 | 北京奥瑞金种业股份有限公司 | Primer pair for detecting G2-aroA gene-modified herbicide-tolerant corn G11105E-823C |
| CN104032017A (en) * | 2014-06-16 | 2014-09-10 | 北京奥瑞金种业股份有限公司 | Primer pair for detecting G2-aroA genetically modified herbicide-tolerant corn G1105E-823C |
| CN104032014A (en) * | 2014-06-16 | 2014-09-10 | 北京奥瑞金种业股份有限公司 | Method and primer pair for detecting transgenic G2-aroA gene herbicide-resisting corn G1105E-823C |
| CN105400814A (en) * | 2015-11-26 | 2016-03-16 | 北京奥瑞金种业股份有限公司 | Method for cultivating insect-resistant transgenic maize |
Non-Patent Citations (2)
| Title |
|---|
| AIHU PAN ET AL: "Event-specific qualitative and quantitative PCR detection of MON863 maize based upon the 3’-transgene integration sequence", 《JOURNAL OF CEREAL SCIENCE》 * |
| LITAO YANG ET AL: "Event Specific Qualitative and Quantitative Polymerase Chain Reaction Detection of Genetically Modified MON863 Maize Based on the 5′-Transgene Integration Sequence", 《J. AGRIC. FOOD CHEM.》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880925A (en) * | 2017-12-06 | 2019-06-14 | 天津市农业质量标准与检测技术研究所 | A kind of detection method of the dual anti-12-6 specificity of transformant PCR of transgenic corns |
| CN110195122A (en) * | 2019-01-02 | 2019-09-03 | 四川省农业科学院生物技术核技术研究所 | It is a kind of for detecting the nucleic acid sequence and its detection method of corn plant T anti-4 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107326088B (en) | 2020-06-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105316327A (en) | Wheat TaAGO4a gene CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats)/-CRISPR-associated protein 9) vector and application thereof | |
| CN104830845B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878 | |
| CN109536490A (en) | Transgenic pest-resistant herbicide-resistant corn C M8101 external source Insert Fragment flanking sequence and its application | |
| CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
| CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
| Zhang et al. | Assessment of transgene copy number and zygosity of transgenic maize overexpressing Cry1Ie gene with SYBR® Green qRT-PCR | |
| CN104878095B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9858 | |
| CN107400674B (en) | Method for identifying tobacco resistance by using tomato spotted wilf virus NSm gene | |
| CN104195225A (en) | Quantitative PCR method for rapidly identifying transgenic paddy rice homozygote | |
| Kanakala et al. | Response of chickpea genotypes to Agrobacterium-mediated delivery of Chickpea chlorotic dwarf virus (CpCDV) genome and identification of resistance source | |
| CN107326088A (en) | The method for detecting pest-resistant herbicide-resistant corn GH5112E 117C | |
| CN104032017B (en) | For detecting the primer pair turning G2-aroA gene herbicide-resistant corn G1105E-823C | |
| Ying et al. | Discrimination of Panax ginseng from counterfeits using single nucleotide polymorphism: A focused review | |
| Schepler-Luu et al. | Genome editing of an African elite rice variety confers resistance against endemic and emerging Xanthomonas oryzae pv. oryzae strains | |
| CN109735648A (en) | A kind of method and its dedicated kit for screening different mass of 1000 kernel wheats | |
| CN116287384B (en) | Nucleic acid molecule of insect-resistant herbicide-resistant corn transformation event LD05, detection method and application thereof | |
| CN108064302A (en) | QTL associated with the resisting breakage of Canola and the method for identifying resisting breakage | |
| Kang | Application of CRISPR/Cas9-mediated genome editing for studying soybean resistance to soybean cyst nematode | |
| Wang et al. | Engineering bacterial blight-resistant plants through CRISPR/Cas9-targeted editing of the MeSWEET10a promoter in cassava | |
| Lindsay et al. | Genetic analysis of North American Phragmites australis guides management approaches | |
| Reddy et al. | Inheritance and molecular mapping of wilt resistance | |
| US20220282339A1 (en) | Genetic purity estimate method by sequencing | |
| Sutrawati et al. | Disease incidence and molecular diversity of Tungro Virus on rice (Oryza sativa) in Bengkulu, Indonesia. | |
| Zhang et al. | Evaluation of the resistance to Chinese predominant races of Puccinia triticina and analysis of effective leaf rust resistance genes in wheat accessions from the US National Plant Germplasm System | |
| BR112020015480A2 (en) | COMPOSITIONS AND METHODS TO IMPROVE CULTURE INCOME BY STACKING TRACES |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |