CN107190008A - A kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence - Google Patents

A kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence Download PDF

Info

Publication number
CN107190008A
CN107190008A CN201710589991.5A CN201710589991A CN107190008A CN 107190008 A CN107190008 A CN 107190008A CN 201710589991 A CN201710589991 A CN 201710589991A CN 107190008 A CN107190008 A CN 107190008A
Authority
CN
China
Prior art keywords
dna
artificial sequence
sequence
grna
target gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710589991.5A
Other languages
Chinese (zh)
Inventor
郭良让
王德华
张佩琢
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Ji Ji Gene Sequencing Technology Co Ltd
Original Assignee
Suzhou Ji Ji Gene Sequencing Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Ji Ji Gene Sequencing Technology Co Ltd filed Critical Suzhou Ji Ji Gene Sequencing Technology Co Ltd
Priority to CN201710589991.5A priority Critical patent/CN107190008A/en
Publication of CN107190008A publication Critical patent/CN107190008A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
    • C12Y603/02—Acid—amino-acid ligases (peptide synthases)(6.3.2)
    • C12Y603/02019—Ubiquitin-protein ligase (6.3.2.19), i.e. ubiquitin-conjugating enzyme
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence.The invention provides a kind of method for capturing target gene sequence from genomic DNA based on Crispr/cas9 systems：1) multiple gRNA, are synthesized according to target gene sequence design；2) cleavage reaction will be carried out to the genomic DNA with the multiple gRNA and the cas9 enzymes, and will obtain the cleaved products of the fragmentation products containing multiple 100 300bp；3) multiple 100 300bp of the target gene sequence in capture cleaved products fragmentation products.The present invention based on CRISPR gene editings by capturing target sequence, available for high-flux sequence, it is adaptable to has the examination of the specific crowd of household heredity factors and popular physical examination market etc..

Description

It is a kind of based on Crispr/cas9 capture genome target sequence method and its Application in high-flux sequence
Technical field
The invention belongs to biological technical field, more particularly to a kind of capture genome target sequence based on Crispr/cas9 The method of row and its application in high-flux sequence.
Background technology
CRlSPR/Cas(Clusteredregularly interspaccd short palindromic repeats/ CRlSPR-associatednuclease) technology be 2013 exploitation a kind of new DNA target to edit tool, by section of the U.S. Learn magazine and be chosen as one of ten big science break-through skills in 2013.Cas9 nucleases, S.pyogenes is the nuclease of RNA mediations, The cutting of double-stranded DNA specific site can be catalyzed.Cleavage site is located on NGG PAM (Protospacer Adjacent Motif) At 3 bases for swimming sequence.The NGG of PAM sequences must be connected in after target spot, on the DNA complementary with gRNA chain.Its DNA specific recognitions are realized by a bit of hairpin RNA structure, and DNA shearings are then by the Cas nucleic acid being incorporated on RNA Enzyme is performed.CRlSPR sequences are present in microbial genome, by length 25-50bp repetitive sequence (repeat, R) and The DNA sequence dna of region sequence (spacer, S) interval cluster arrangement (R-S structures), and Cas is then to be present in CRISPR clusters side Polymorphism family gene near wing sequence, one group of functional domain albumen that encoding can have an effect with CrisPR regions (has core The activity of sour enzyme, unwindase, integrase and polymerase etc.).Target site is carried out under guide RNA (guide RNA) guiding Cutting.In addition, having CRISPR targeting sequencings L (Leader) in first repetitive sequence upstream in CRISPR sites.The leading sequence Row as promoter, can start the transcription of CRISPR sequences.Targeting sequencing, R-S structures and a series of Cas have been constituted Whole CRISPR/Cas systems.It is found that these CRISPR sequences can match with virus or plasmid dna sequence, show CRISPR/Cas systems can encode " adaptability " immune system, be played a role in the acquired immunity of bacterium.
From after completing human genome map, national governments all increase the support power studied human genome Degree, under such overall background, gene sequencing technology has obtained fast development, gene sequencing market also rapid expansion, and Clinic is entered into from laboratory.
High throughput sequencing technologies are captured based on liquid phase, mainly there is the full exon trapping kit of Agilent company in market, Two kinds of technologies of solid-phase hybridization method and solution hybridization method of Roche Holding Ag, although the DNA sequence dna simply full genome of these products capture The subregion of group, cost and time, which spend, for genome sequencing has very big advantage, but each sample Price still more than thousands of members, beyond the tolerance range of general public, be not suitable for examination monogenic inheritance disease in a wide range of The detection of disease.And the shortcoming of these technologies is the DNA for needing to synthesize a large amount of long segments (150-200bp), is expanded by PCR, It is transcribed into the RNA for adding biotin modification.
The content of the invention
Target base is captured from genomic DNA based on Crispr/cas9 systems it is an object of the present invention to provide one kind Because of the method for sequence.
The method that the present invention is provided, comprises the following steps：
1) multiple gRNA, are synthesized according to target gene sequence design；
Each gRNA can with reference to and recognize the different target regions of the target gene sequence；
The target gene sequence can be divided into multiple 100-300bp fragment by gRNA guiding cas9 enzymes Change product；
2) cleavage reaction will be carried out to the genomic DNA with the multiple gRNA and the cas9 enzymes, obtained containing many The cleaved products of individual 100-300bp fragmentation products；
3) multiple 100-300bp of the target gene sequence in capture cleaved products fragmentation products.
Above-mentioned cleavage reaction, which is only cut, not to be repaired.
Above-mentioned target gene can be a target gene or multiple target genes.
In the above method,
Step 1) in, the multiple gRNA of design synthesis method is following a or b：
Method shown in a comprises the following steps：
(1) multiple gRNA are designed according to the target gene sequence, is used to make further according to gRNA design synthesis The primer pair of its standby correspondence transcription templates, obtains the corresponding primer pair of multiple gRNA transcription templates；
(2) the corresponding primer pair of multiple gRNA transcription templates is subjected to PCR respectively, obtains correspondence Multiple gRNA transcription templates,
(3) corresponding multiple gRNA transcription templates are transcribed, multiple gRNA are obtained；
Method shown in b comprises the following steps：
(1) multiple gRNA are designed according to the target gene sequence, it is corresponding further according to gRNA design synthesis Transcription templates, obtain multiple gRNA transcription templates；
(2) the multiple gRNA transcription templates are transcribed, multiple gRNA are obtained.
In the above method,
The multiple gRNA transcription templates of transcription are transcribed jointly again to transcribe or mixing respectively multiple gRNA transcription templates；
Or the method for the capture is paramagnetic particle method.
In the above method,
The genomic DNA is the genomic DNA of human or animal or the cell of other species；
The target gene sequence is the extron of BRCA1 genes and the extron of BRCA2 genes；
The corresponding multiple gRNA of extron of BRCA1 genes nucleotide sequence is respectively sequence 158-220；
The corresponding multiple gRNA of extron of BRCA2 genes nucleotide sequence is respectively sequence 221-316；
Or the nucleotides of the sense primer in the corresponding primer pairs of the corresponding multiple gRNA of extron of the BRCA1 genes Sequence is respectively sequence 1- sequences 63, and the nucleotides sequence of anti-sense primer is classified as sequence 157；
Or the nucleotides of the sense primer in the corresponding primer pairs of the corresponding multiple gRNA of extron of the BRCA2 genes Sequence is respectively sequence 64- sequences 156, and the nucleotides sequence of anti-sense primer is classified as sequence 157.
Application of the above-mentioned method in prepared by the high-throughput sequencing library of target gene sequence is also that the present invention is protected Scope.
Application of the above-mentioned method in the high-flux sequence of target gene sequence is also the scope of protection of the invention.
Another object of the present invention is to provide a kind of high-flux sequence method of target gene sequence.
The method that the present invention is provided, comprises the following steps：
1) above-mentioned method captures multiple 100-300bp of target gene sequence fragmentation products；
2) high-throughput sequencing library is prepared with the multiple 100-300bp fragmentation products；
3) high-throughput sequencing library described in high-flux sequence, realizes the high-flux sequence of target gene sequence.
The application that Crispr/cas9 systems capture in genomic DNA or separate or assemble in target gene sequence is also The scope of protection of the invention；
The Crispr/cas9 systems include multiple gRNA and cas9 enzymes；
The multiple gRNA guides the CAS9 enzymes that the target gene sequence is divided into multiple sizes for 100-300bp Fragmentation products.
3rd purpose of the invention is to provide a kind of kit for being used in genomic DNA capture target gene sequence.
The Crispr/cas9 systems in the kit that the present invention is provided, including above-mentioned application.
4th purpose of the invention is to provide a kind of kit of high-flux sequence target gene sequence.
It is prepared by the Crispr/cas9 systems and sequencing library in the kit that the present invention is provided, including above-mentioned application Required reagent.
The present invention based on CRISPR gene editings by capturing target sequence, available for high-flux sequence, it is adaptable to there is family The examination of the specific crowd of Genetic history and popular physical examination market；More meaningful, the technology can also be used to develop other lists Gene, the detection kit of multiple-factor inheritance disease and extron sequencing capture agent, for clinical practice.
Brief description of the drawings
Fig. 1 is BRCA1gRNA and BRCA2gRNA quality inspection results.
Fig. 2 is the agarose gel electrophoresis figure of amplified library product 2%.
Fig. 3 is the agarose gel electrophoresis figure of library glue reclaim product 2%.
Fig. 4 is the agarose gel electrophoresis figure of library detection pcr amplification product 2%.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
The method of target gene sequence in embodiment 1, the capture genome based on Crispr/cas9
The following examples by taking BRCA1 the and BRCA2 genes in people's 293T cell genomic dnas as an example,
According to BRCA1 genes (GI:262359905) with BRCA2 genes (GI:568815585) extron is target base Because of sequence.
First, prepared by transcription RNA templates
1st, the design of primers synthesis of transcription RNA templates
According to BRCA1 genes (GI in target gene group:And BRCA2 genes (GI 262359905):568815585) outside Aobvious son, separately designs 63 BRCA1gRNA (sequence 158-220) and 96 BRCA2gRNA (sequence 221-313), these gRNA It can guide CAS9 enzymes that BRCA1 extron and BRCA2 extron are all divided into multiple sizes for 100-300bp fragments Change product.
RNA templates are transcribed according to 63 BRCA1gRNA and 96 BRCA2gRNA extrons for separately designing 63 BRCA1 Amplimer and 93 BRCA2 extron transcription RNA templates amplimer it is as follows：
The amplimer of RNA templates is transcribed for synthesizing 63 BRCA1 extron：
Sense primer is respectively BRCA1gRNA1_F-BRCA1gRNA63_F (sequence 1- sequence 63), and anti-sense primer is GRNA_R (sequence 157)；
The amplimer of RNA templates is transcribed for synthesizing 63 BRCA1 extron：
Sense primer is respectively BRCA2gRNA1_F-BRCA2gRNA93_F (sequence 64- sequence 156), and anti-sense primer is GRNA_R (sequence 157).
2nd, the preparation of RNA templates is transcribed
By above-mentioned BRCA1gRNA1_F-BRCA1gRNA63_F respectively with anti-sense primer gRNA_R in the system of such as table 1 below Annealing PCR, the extron for obtaining 63 BRCA1gRNA1-BRCA1gRNA63 transcribes RNA template；
Above-mentioned BRCA2gRNA1_F-BRCA2gRNA93_F is gathered with anti-sense primer gRNA_R in the system of such as table 1 below respectively Polymerase chain reacts, and the extron for obtaining 93 BRCA2gRNA1-BRCA2gRNA93 transcribes RNA template.
Table 1 is annealing pcr amplification reaction system
2 × pfu Master Mix with Dye, Suzhou GenePharma Co., Ltd., catalog number (Cat.No.)：J09002.
The system of table 1 is subjected to PCR, obtains transcribing the pcr amplification product of RNA templates.
Above-mentioned response procedures are：94℃3min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 15 circulations；72℃10min；4 DEG C preserve.
5 μ 2% agarose gel electrophoresis of LPCR products are taken after PCR, are detected, nothing but specific band Afterwards, purified with PCR primer purification kit (centrifugal column), obtain 63 BRCA1gRNA-BRCA1gRNA63 and transcribe RNA's Template and 93 BRCA2gRNABRCA2gRNA93 transcribe RNA template.
2nd, gRNA transcription
By above-mentioned 63 BRCA1gRNA1-BRCA1gRNA63 transcription RNA templates and 93 BRCA2gRNA1- BRCA2gRNA93 transcription RNA templates are according to mass ratio mixing is waited, according to TranscriptAid T7HighYield Transcription Kit (silent winged scientific and technological (China) Co., Ltds of generation that of match；Catalog number (Cat.No.)：K0441) specification is transcribed jointly, is obtained To 63 BRCA1gRNA1-BRCA1gRNA63 and 93 BRCA2gRNA1-BRCA2gRNA93 mixture.
Above-mentioned transcription system is as shown in table 2,
Table 2 is responsive transcription system
Component
Water without nuclease to 20μL
5×TranscriptAid Reaction Buffer 4μL
ATP/CTP/GTP/UTP mix* 8μL
Transcribe RNA templates 2μg**
TranscriptAid Enzyme Mix 2μL
Cumulative volume 20μL
37 DEG C are transcribed 4 hours, obtain transcription product.
Transcription product is purified as follows, 63 BRCA1gRNA-BRCA1gRNA63 and 93 is obtained BRCA2gRNA-BRCA2gRNA93 mixture：
(1) transcription product adds 2 μ L Dnase I mixing, and 37 DEG C are reacted 35 minutes；
The water of 115 μ L nuclease frees, 15 μ L3M sodium acetates are added in (2) 20 μ L reaction products；
(3) isometric water-saturated phenol is added, each 75 μ L of chloroform are mixed, and 12000 revs/min centrifuge 5 minutes；
(4) (3) are repeated once；
(5) the absolute ethyl alcohol precipitation RNA of -20 DEG C of precoolings of 2 times of volumes is added, -20 DEG C stand overnight；
(6) 4 DEG C 12000 revs/min centrifuge 30 minutes, remove supernatant；
(7) 1mL70% ethanol is added, 12000 revs/min centrifuge 5 minutes, remove supernatant；
(8) drying at room temperature, adds and RNA is dissolved at 20 μ L DEPC water.
Matter will be carried out by 63 BRCA1gRNA1-BRCA1gRNA63 and 93 BRCA2gRNA1-BRCA2gRNA93 after purification Inspection, as a result as shown in figure 1, it is the gRNA that 200ng is transcribed that swimming lane M, which is 10bp DNA Ladder swimming lanes 1 and 2, it can be seen that The gRNA transcribed.
The method of above-mentioned quality inspection is as follows：
(1) prepare 15% and be denatured glue；
(2) 200v prerunnings 30 minutes；
(3) 200ng RNA is taken to add 2 × RNA sample-loading buffers；
(4) it is denatured 5 minutes in 65 DEG C, ice bath immediately；
(5) 200v electrophoresis 60 minutes；
(6) dyed 10 minutes in dye glue box；
(7) take pictures.
3rd, target gene group DNA In vitro digestions
1) by above-mentioned 63 BRCA1gRNA1-BRCA1gRNA63 and 93 BRCA2gRNA1-BRCA2gRNA93 after purification Mixture takes 10 μ L to be diluted to 15 μM, then 90 DEG C are heated 5 minutes, are slowly cooled to room temperature (formation secondary structure), are handled 93 BRCA2gRNA1-BRCA2gRNA93 after 63 BRCA1gRNA1-BRCA1gRNA63 and processing afterwards.
2) will 93 BRCA2gRNA1 after 63 BRCA1gRNA1-BRCA1gRNA63 and processing after processing- BRCA2gRNA93 mixtures are added in the cleavage reaction system shown in table 3, are incubated at room temperature 15 minutes, are then added 5.5 μ L100ng/ μ L people's 293T cell genomic dnas.
The genomic DNA cleavage reaction system of table 3
Volume(μL)
Water without nuclease 27.5
5×Cleavage buffer 11.0
Cas9 nucleases：15μM 5.5
Reaction product：15μM 5.5
Cas9 nucleases, S.pyogenes, NEB (Beijing) Co., Ltd, NEB (Beijing) Co., Ltd, M0386M.
It is incubated 30 minutes at 37 DEG C, obtains reaction product.
(3) by 2) obtained reaction product adds 5 μ L 500mM EDTA, adds 22 μ L protease K digesting Cas9, room temperature It is incubated 20 minutes, obtains cleaved products.
4th, the paramagnetic particle method sequence capturing fragmentation products from cleaved products
1. vibrate Ampure XP magnetic beads (the Agencourt AMPure XP of Beckman Coulter Inc.'s production Kit:Catalog number is A63880), fully mix；
2. into above-mentioned three obtained cleaved products add 0.7 × magnetic bead, with pipettor mix 10 times, room temperature place 1 Minute；
Adsorbed 5 minutes 3. being placed on magnetic frame, transfer supernatant is into new centrifuge tube；
4. adding the magnetic bead of 1.1 times of volumes, mixed 10 times with pipettor, room temperature is placed 1 minute；
5. adding 80% ethanol of 200 μ L Fresh into magnetic bead, room temperature places 30s, abandons supernatant；
6. repeat the above steps 1 time；
7. room temperature of uncapping is placed 10 minutes；
8. adding the water that 50 μ L are free of nuclease, mixed with pipettor, room temperature is placed 1 minute；
9. being placed on magnetic frame 5 minutes, transfer supernatant obtains the extron size containing BRCA1 into new centrifuge tube For 100-300bp fragmentation products and BRCA2 extron size be 100-300bp fragmentation products mixture.
Embodiment 2, high-flux sequence target target sequence
First, high-throughput sequencing library is built
1st, end reparation, phosphorylation and plus dA tails
(1) added in sterilizing EP pipes shown in following reagent table 4：
Table 4 is end reparation, phosphorylation and adds dA urosomes system
(2) mixing is gently blown and beaten using pipettor, of short duration centrifugation collects reaction solution to ttom of pipe.
(3) reaction tube is placed in PCR instrument, the program of table 5 obtains reaction product：
Table 5
2nd, joint is connected
(1) following component is added in the reaction product obtained to step 1：
Table 6
T4DNA ligases, NEB (Beijing) Co., Ltd, NEB (Beijing) Co., Ltd, M0202L.
Breeches joint (UAF/AI1)
UAF AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T
AI1GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
* thio-modification, is synthesized by Shanghai Jierui Biology Engineering Co., Ltd.
(2) mixing is gently blown and beaten using pipettor, of short duration centrifugation collects reaction solution to ttom of pipe.
(3) reaction tube is placed in PCR instrument, runs following procedure, obtain joint connection product：
Table 7
3rd, the purifying of joint connection product and size sorting
(1) vortex oscillation mixes AMPure XP beads and (can produced for Beckman Coulter Inc. Agencourt AMPure XP Kit:Catalog number is A63880)；
(2) 50ul AMPure XP beads are entered to the obtained joint connection products of 50ul above-mentioned 2；
(3) mixed 10 times with pipettor, room temperature places 5min；
(4) magnetic bead is placed in magnetic frame absorption 2min, discards supernatant；
(5) add fresh 80% ethanol of 200ul to magnetic bead and rinse magnetic bead, room temperature places 30sec, and magnet adsorption removes supernatant；
(6) step 1 time in repetition；
(7) uncap placement 10min；
(8) magnetic bead is removed from magnet and adds 50ul DEPC water, is mixed 10 times with pipettor；
(9) magnetic bead is placed in magnet~5min；
(10) 50ul supernatants are taken into a new EP pipe；
(11) vortex oscillation mixes AMPure XP beads；
(12) step 50ul eluted products enter 50ul AMPure XP beads upwards；
(13) mixed 10 times with pipettor, room temperature places 5min；
(14) magnetic bead is placed in magnetic frame absorption 2min, abandons supernatant；
(15) add fresh 80% ethanol of 200ul to magnetic bead and rinse magnetic bead, room temperature places 30sec, and magnet adsorption removes supernatant；
(16) step 1 time in repetition；
(17) uncap placement 10min；
(18) magnetic bead is removed from magnet and adds 40ul DEPC water, is mixed 10 times with pipettor；
(19) magnetic bead is placed in magnet~5min；
(20) about 40ul supernatants are drawn into a new EP pipe, joint connection product after purification is obtained.
4th, joint connection product PCR is expanded
(1) following reaction is prepared：
Table 8
Primer mPF
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Primer mRPI1
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
Synthesized by Shanghai Jierui Biology Engineering Co., Ltd.
KAPA HIFi archaeal dna polymerases：Kapa Biosystems, catalog number (Cat.No.)：KK2102
(2) mixing is gently blown and beaten using pipettor, of short duration centrifugation collects reaction solution to ttom of pipe.
Reaction tube is placed in PCR instrument, run：Response procedures are：94℃3min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 15 Individual circulation；72℃10min；4 DEG C of preservations.
Amplified production is carried out 2% agarose gel electrophoresis, as a result as shown in Fig. 2 M:20bp DNA Ladder；1：Text Storehouse amplified production, it can be seen that obtain amplified library product.
5th, pcr amplification product is purified
(1) band needed for above-mentioned 4 electrophoresis is cut, with the Ago-Gel DNA of Shanghai Jierui Biology Engineering Co., Ltd QIAquick Gel Extraction Kit (centrifugation column type)：GK2042-50 carries out gel receipts.
(2) 400 μ LBinding Solution are added into gel, are placed in 50 DEG C of water-baths, to blob of viscose dissolving.
(3) shaken at intervals of two minutes once during.
(4) solvent blob of viscose is transferred in silicagel column, room temperature is placed 2 minutes, and 6000 revs/min centrifuge 1 minute, abandon useless Liquid.
(5) 500 μ LWashing Solution are added into silicagel column, room temperature is placed 3 minutes.
(6) 12000 revs/min centrifuge 1 minute, abandon waste liquid.
(7) (6) are repeated once.
(8) 12000 revs/min centrifuge 1 minute, and transfer silicagel column is into new 1.5mL centrifuge tubes
(9) water that 30 μ L are free of nuclease is added into silicagel column, room temperature is placed 2 minutes.
(10) 12000 revs/min centrifuge 1 minute, collect supernatant, obtain pcr amplification product after purification.
Electrophoresis detection will be carried out by pcr amplification product after purification, as a result as shown in figure 3, M:20bp DNA Ladder；1：Text Storehouse glue reclaim product, it can be seen that obtain high-throughput sequencing library.
6th, library detection is captured
(1) PCR reaction systems are prepared
The library quality inspection reaction system of table 9
Component Volume (μ L)
Water without nuclease 16.2
10×PCR Buffer 2.5
MgCl2:25mM 2.5
10mM dNTP Mix 0.5
Taq archaeal dna polymerases 0.3
5 obtained pcr amplification products after purification 1
Cumulative volume 23μL
Taq DNA Polymerase are the product of Promega companies, and catalog number is M1665S；
Reaction system is prepared according to sample size to manage with 23 μ L/, is dispensed into 0.2mL PCR pipe, is respectively labeled as 1- 10, adding into PCR pipe different upstream and downstream primers again respectively, (upstream and downstream primer is used to expand size for 100-300bp pieces Sectionization product, each pair primer pair answers a 100-300bp fragment, randomly selects wherein 10 pairs primers), it is as follows：
Table 10
(2) response procedures：Response procedures are：94℃3min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 22 circulations；72℃ 10min；4 DEG C of preservations
(3) amplified production carries out 2% agarose gel electrophoresis, as a result as shown in figure 4,20bp DNA Ladder；1： rs55906931；2：rs4986850；2：rs799917；4：rs80357280；5：rs56012641；6：rs1800704；7： rs80357420；8：rs1799950；9：rs4986852；10：rs16941；As can be seen that amplifying purpose band, show The extron size for having BRCA1 in capture sequence is that 100-300bp fragmentation products and BRCA2 extron size are 100- 300bp fragmentation products.
7th, high-flux sequence and data analysis
The library that step 4 is built is taken to be sequenced with the platforms of Hiseq 3000, to sequencing data FASTX-Toolkit 0.0.13 (network address is software：http://hannonlab.cshl.edu/fastx_toolkit/) in fastq_quality_ Trimmer modules remove low quality Reads, and joint sequence is removed with fastx_clipper modules, separate the read number containing N, carry Take the pairing read after separating；
Sequencing data is pretreated to the results are shown in Table 11.
The sequencing data quality preprocessed data statistical result of table 11
The reference gene group mapping for having gene reference is carried out using bwa-0.7.15.Finally, library ratio is captured To the read number ratio x in reference gene group more than 84%, wherein paired youngster reads compare ratio about 83%, as a result Normally.
Statistical result after being compared with reference gene group is shown in Table 12.
The reference gene group of table 12 compares overall condition statistics
With bwa-0.7.15 softwares, (network address is：https://sourceforge.net/projects/bio-bwa/ Files/) valid data are compared with genomic DNA, with samtools-0.1.9 softwares, (network address is：https:// Sourceforge.net/projects/samtools/files/samtools/0.1.19/) the sam forms of comparison are changed Into bam forms, with bedtools-2.17.0 softwares, (network address is：https://github.com/arq5x/bedtools/ Releases/tag/v2.17.0 the coverage modules in) calculate the coverage rate of target region.
The coverage rate of target region is shown in Table 13；
The bioaccumulation efficiency of table 13
Target sequence captures library Coverage rate (%)
S 96.58%
According to formula
With TEQC3.16.0 softwares, (network address is：https://bioconductor.org/packages/release/ Bioc/html/TEQC.htm the bioaccumulation efficiency of target region) is calculated, the bioaccumulation efficiency of target region is shown in Table 14.
The bioaccumulation efficiency statistical result of the target region of table 14
The above results show that Crispr probe combinations provided by the present invention can be used for building capture library, further profit Genome target sequence is captured with the library.Therefore, method provided by the present invention, can prepare the capture library of target sequence.
Sequence table
<110>Suzhou Ji Sai gene sequencing Science and Technology Ltd.
<120>A kind of method of capture genome target sequence based on Crispr/cas9 and its answering in high-flux sequence With
<160> 333
<170> PatentIn version 3.5
<210> 1
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
taatacgact cactataggc aaacttaggt attggaaccg ttttagagct agaaatag 58
<210> 2
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 2
taatacgact cactataggt tcttcacagt gcagtgaatg ttttagagct agaaatag 58
<210> 3
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 3
taatacgact cactatagga tataccttct cagtctactg ttttagagct agaaatag 58
<210> 4
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 4
taatacgact cactataggg ttagatgatg gtgaaataag ttttagagct agaaatag 58
<210> 5
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 5
taatacgact cactataggg aatgctatgc ttagattagg ttttagagct agaaatag 58
<210> 6
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 6
taatacgact cactataggt ctgctagagg aaaactttgg ttttagagct agaaatag 58
<210> 7
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 7
taatacgact cactatagga ctgcaggctt tcctgtggtg ttttagagct agaaatag 58
<210> 8
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 8
taatacgact cactataggt cgggaaacaa gcatagaaag ttttagagct agaaatag 58
<210> 9
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 9
taatacgact cactatagga gcagtatttc attggtaccg ttttagagct agaaatag 58
<210> 10
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 10
taatacgact cactataggg aaggtaaaga acctgcaacg ttttagagct agaaatag 58
<210> 11
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 11
taatacgact cactataggt gaggaggaag tcttctaccg ttttagagct agaaatag 58
<210> 12
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 12
taatacgact cactatagga ctcctgaaat gataaatcag ttttagagct agaaatag 58
<210> 13
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 13
taatacgact cactatagga ctggccagtg atcctcatgg ttttagagct agaaatag 58
<210> 14
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 14
taatacgact cactataggg agatactgaa gatgttcctg ttttagagct agaaatag 58
<210> 15
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 15
taatacgact cactatagga gacagaatga atgtagaaag ttttagagct agaaatag 58
<210> 16
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 16
taatacgact cactataggt gcttgtgaat tttctgagag ttttagagct agaaatag 58
<210> 17
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 17
taatacgact cactataggc ttcagtcctt ctactgtccg ttttagagct agaaatag 58
<210> 18
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 18
taatacgact cactataggc tctaatcaat cgactccgtt ttagagctag aaatag 56
<210> 19
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 19
taatacgact cactataggc atgtacctgt gctatatggt tttagagcta gaaatag 57
<210> 20
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 20
taatacgact cactatagga gcattcaaag tgtcaaagtg ttttagagct agaaatag 58
<210> 21
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 21
taatacgact cactataggc tacagtaggg gcatccatag ttttagagct agaaatag 58
<210> 22
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 22
taatacgact cactatagga ccctacactc tccggatgag ttttagagct agaaatag 58
<210> 23
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 23
taatacgact cactatagga tctgaggaac ccccatcgtg ttttagagct agaaatag 58
<210> 24
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 24
taatacgact cactataggt ccaatgtcca gaacactacg ttttagagct agaaatag 58
<210> 25
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 25
taatacgact cactatagga gtgctagata ctttcacacg ttttagagct agaaatag 58
<210> 26
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 26
taatacgact cactatagga gcagacacgt catatttagt tttagagcta gaaatag 57
<210> 27
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 27
taatacgact cactatagga ggatcatcaa gaattatgcg ttttagagct agaaatag 58
<210> 28
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 28
taatacgact cactatagga gcgattcaca aaagagcacg ttttagagct agaaatag 58
<210> 29
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 29
taatacgact cactataggc acctaacgtt taacacctag ttttagagct agaaatag 58
<210> 30
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 30
taatacgact cactataggt tacactccca agatcaatcg ttttagagct agaaatag 58
<210> 31
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 31
taatacgact cactataggc caccgtgcct cgcctcatgg ttttagagct agaaatag 58
<210> 32
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 32
taatacgact cactataggt gcacgttcta cacgtgtccg ttttagagct agaaatag 58
<210> 33
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 33
taatacgact cactataggt tgttaagtct tagtcattgt tttagagcta gaaatag 57
<210> 34
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 34
taatacgact cactataggc cccagagtca gctcgtgtgt tttagagcta gaaatag 57
<210> 35
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 35
taatacgact cactataggt gggtacatga atacagtgtg ttttagagct agaaatag 58
<210> 36
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 36
taatacgact cactataggt tagatgtact agtctatcag ttttagagct agaaatag 58
<210> 37
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 37
taatacgact cactatagga ccacctatca tctaatgatg ttttagagct agaaatag 58
<210> 38
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 38
taatacgact cactataggt caaccctgac atattggcgt tttagagcta gaaatag 57
<210> 39
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 39
taatacgact cactataggc atgttgtagc ttatgttatg ttttagagct agaaatag 58
<210> 40
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 40
taatacgact cactataggc ttctggattc tggcttatag ttttagagct agaaatag 58
<210> 41
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 41
taatacgact cactatagga gacagatgct agcaccaaag ttttagagct agaaatag 58
<210> 42
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 42
taatacgact cactatagga caactaatat accagtcagg ttttagagct agaaatag 58
<210> 43
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 43
taatacgact cactataggt gctttgttct ggatttcgcg ttttagagct agaaatag 58
<210> 44
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 44
taatacgact cactatagga attgaaatca cctagtagtt ttagagctag aaatag 56
<210> 45
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 45
taatacgact cactatagga ggtagtatga gttccatcag ttttagagct agaaatag 58
<210> 46
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 46
taatacgact cactataggt ttaaggtgaa gcagcatctg ttttagagct agaaatag 58
<210> 47
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 47
taatacgact cactatagga ttactggtgg acttacttcg ttttagagct agaaatag 58
<210> 48
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 48
taatacgact cactataggc tctgtcaaat gtcgtggtag ttttagagct agaaatag 58
<210> 49
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 49
taatacgact cactataggt tcttgatctc ccacactatg ttttagagct agaaatag 58
<210> 50
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 50
taatacgact cactatagga aatggttgct gggcacgggt tttagagcta gaaatag 57
<210> 51
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 51
taatacgact cactataggt ataggtaaac acacgacttg ttttagagct agaaatag 58
<210> 52
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 52
taatacgact cactataggt tctgaagata ccgttaatag ttttagagct agaaatag 58
<210> 53
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 53
taatacgact cactataggt taaaggcatg ggcttcgccg ttttagagct agaaatag 58
<210> 54
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 54
taatacgact cactatagga gtgaatttta tgagccctag ttttagagct agaaatag 58
<210> 55
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 55
taatacgact cactatagga cgtctgtcta cattgaatgt tttagagcta gaaatag 57
<210> 56
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 56
taatacgact cactataggc agctaacatg tatgatgccg ttttagagct agaaatag 58
<210> 57
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 57
taatacgact cactataggc cttagccccc ttagtagcgt tttagagcta gaaatag 57
<210> 58
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 58
taatacgact cactataggt ttctgtagcc catacttgtt ttagagctag aaatag 56
<210> 59
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 59
taatacgact cactatagga gcatacatag ggtttctctg ttttagagct agaaatag 58
<210> 60
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 60
taatacgact cactataggc agcacttgag tgtcattctg ttttagagct agaaatag 58
<210> 61
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 61
taatacgact cactataggc atctgtataa accgtgtgag ttttagagct agaaatag 58
<210> 62
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 62
taatacgact cactatagga tttggtaatg atgctaggtg ttttagagct agaaatag 58
<210> 63
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 63
taatacgact cactataggc catttaaaaa gtaatggcgt tttagagcta gaaatag 57
<210> 64
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 64
taatacgact cactatagga agcattggag gaatatcgtg ttttagagct agaaatag 58
<210> 65
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 65
taatacgact cactatagga caacataatc atcgtttgcg ttttagagct agaaatag 58
<210> 66
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 66
taatacgact cactataggt cactggttaa aactaagggt tttagagcta gaaatag 57
<210> 67
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 67
taatacgact cactatagga gtaatgcaat atggtagacg ttttagagct agaaatag 58
<210> 68
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 68
taatacgact cactataggc agtgagaatg tatatactcg ttttagagct agaaatag 58
<210> 69
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 69
taatacgact cactataggt aatattttgg ctaagagccg ttttagagct agaaatag 58
<210> 70
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 70
taatacgact cactataggt tctcattcat ataaattgtg ttttagagct agaaatag 58
<210> 71
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 71
taatacgact cactataggt tttaccccca gtggtatgtg ttttagagct agaaatag 58
<210> 72
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 72
taatacgact cactataggt agaaatgccc tgatcattag ttttagagct agaaatag 58
<210> 73
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 73
taatacgact cactataggc tatgagcaca gtagaactag ttttagagct agaaatag 58
<210> 74
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 74
taatacgact cactataggt acatttagtg gtagtccagg ttttagagct agaaatag 58
<210> 75
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 75
taatacgact cactataggc ttaagtatag taattagaag ttttagagct agaaatag 58
<210> 76
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 76
taatacgact cactataggc ttagataaat tacagattgt tttagagcta gaaatag 57
<210> 77
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 77
taatacgact cactataggt agtagtcccc ccttatccag ttttagagct agaaatag 58
<210> 78
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 78
taatacgact cactataggt tgcggtaaac cgagatcacg ttttagagct agaaatag 58
<210> 79
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 79
taatacgact cactataggt caggctttac tagaagaacg ttttagagct agaaatag 58
<210> 80
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 80
taatacgact cactatagga atagctgcaa agaccacatg ttttagagct agaaatag 58
<210> 81
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 81
taatacgact cactatagga ttcatcagcg tttgcttcag ttttagagct agaaatag 58
<210> 82
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 82
taatacgact cactataggc aaggaagttg taccgtcttg ttttagagct agaaatag 58
<210> 83
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 83
taatacgact cactataggc agtaaagcag gcaatatcgt tttagagcta gaaatag 57
<210> 84
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 84
taatacgact cactataggt ctgtagcttt gaagaatgcg ttttagagct agaaatag 58
<210> 85
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 85
taatacgact cactatagga catttgcaaa tgctgattcg ttttagagct agaaatag 58
<210> 86
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 86
taatacgact cactatagga gtgacctgat tctaaacacg ttttagagct agaaatag 58
<210> 87
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 87
taatacgact cactataggc caggagttcg agactagccg ttttagagct agaaatag 58
<210> 88
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 88
taatacgact cactataggt gtcccaaaag agctagttag ttttagagct agaaatag 58
<210> 89
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 89
taatacgact cactataggt ccacttttga atgttgtacg ttttagagct agaaatag 58
<210> 90
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 90
taatacgact cactatagga aaatgtcaga caagctcaag ttttagagct agaaatag 58
<210> 91
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 91
taatacgact cactataggt cttccaagta gctaatgaag ttttagagct agaaatag 58
<210> 92
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 92
taatacgact cactatagga ttacatgaac aaatgggcgt tttagagcta gaaatag 57
<210> 93
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 93
taatacgact cactatagga tacagtatta attgactggt tttagagcta gaaatag 57
<210> 94
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 94
taatacgact cactataggt ggtctttaag atagtcatcg ttttagagct agaaatag 58
<210> 95
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 95
taatacgact cactatagga ggggctttta ttctgctcag ttttagagct agaaatag 58
<210> 96
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 96
taatacgact cactatagga ataatattga aatgactacg ttttagagct agaaatag 58
<210> 97
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 97
taatacgact cactatagga ttatctggcc agtttatgag ttttagagct agaaatag 58
<210> 98
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 98
taatacgact cactatagga aaagttatgc aattcttcgt tttagagcta gaaatag 57
<210> 99
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 99
taatacgact cactataggt gggttttcat acagctagcg ttttagagct agaaatag 58
<210> 100
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 100
taatacgact cactataggt tatcacttaa gagcttaggg ttttagagct agaaatag 58
<210> 101
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 101
taatacgact cactatagga caacttgtgt aaaaagctag ttttagagct agaaatag 58
<210> 102
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 102
taatacgact cactatagga tatacctcat cagaatggtg ttttagagct agaaatag 58
<210> 103
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 103
taatacgact cactataggc ctgcatttag gatagccagg ttttagagct agaaatag 58
<210> 104
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 104
taatacgact cactatagga tgtagcacgc attcacatag ttttagagct agaaatag 58
<210> 105
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 105
taatacgact cactataggg atttttagca cagcaaggtt ttagagctag aaatag 56
<210> 106
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 106
taatacgact cactataggt aatgaagcat ctgataccgt tttagagcta gaaatag 57
<210> 107
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 107
taatacgact cactataggc aaagttaagg gagtgttagg ttttagagct agaaatag 58
<210> 108
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 108
taatacgact cactatagga caaacaacag ttggtattgt tttagagcta gaaatag 57
<210> 109
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 109
taatacgact cactatagga gagaatgtgt ggcatgactg ttttagagct agaaatag 58
<210> 110
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 110
taatacgact cactataggc gtatacagat ttgatatctg ttttagagct agaaatag 58
<210> 111
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 111
taatacgact cactatagga ctttactctt tcaaacattg ttttagagct agaaatag 58
<210> 112
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 112
taatacgact cactataggc tgttctccct ctataggtag ttttagagct agaaatag 58
<210> 113
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 113
taatacgact cactataggt gcttgtactg tgagttattg ttttagagct agaaatag 58
<210> 114
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 114
taatacgact cactataggt ttaaacatgt cttaccgaag ttttagagct agaaatag 58
<210> 115
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 115
taatacgact cactatagga tgaagtacta aggttgaggt tttagagcta gaaatag 57
<210> 116
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 116
taatacgact cactataggc agaccctcat ttgctacagt tttagagcta gaaatag 57
<210> 117
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 117
taatacgact cactatagga tgagacactt gattactacg ttttagagct agaaatag 58
<210> 118
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 118
taatacgact cactatagga gttacagcta ctgcttgatg ttttagagct agaaatag 58
<210> 119
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 119
taatacgact cactataggc aatctaggac tgctgttacg ttttagagct agaaatag 58
<210> 120
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 120
taatacgact cactataggt gaggcgggca gatcatctgg ttttagagct agaaatag 58
<210> 121
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 121
taatacgact cactataggc tctgcgtgtt ctcataaacg ttttagagct agaaatag 58
<210> 122
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 122
taatacgact cactataggc cccttgctag gcctgcctcg ttttagagct agaaatag 58
<210> 123
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 123
taatacgact cactataggt agcaggaggc gtataaacgg ttttagagct agaaatag 58
<210> 124
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 124
taatacgact cactataggt ttgtgtagct gtatacgtag ttttagagct agaaatag 58
<210> 125
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 125
taatacgact cactataggt gtctctcgaa ctaaaaagtg ttttagagct agaaatag 58
<210> 126
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 126
taatacgact cactatagga attcagtatc atcctatggt tttagagcta gaaatag 57
<210> 127
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 127
taatacgact cactataggc gtaatcatat acggcagtag ttttagagct agaaatag 58
<210> 128
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 128
taatacgact cactataggt attagcaatc cccaaatagg ttttagagct agaaatag 58
<210> 129
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 129
taatacgact cactatagga tcggctataa aaaagataag ttttagagct agaaatag 58
<210> 130
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 130
taatacgact cactataggt ggggcttcaa gaggtgtacg ttttagagct agaaatag 58
<210> 131
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 131
taatacgact cactataggt taagctcaag aaagatctcg ttttagagct agaaatag 58
<210> 132
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 132
taatacgact cactataggc ttcctcaaaa aatctacagt tttagagcta gaaatag 57
<210> 133
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 133
taatacgact cactatagga gtttggtata ccagcgagcg ttttagagct agaaatag 58
<210> 134
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 134
taatacgact cactatagga gaatcacttg aacccggggt tttagagcta gaaatag 57
<210> 135
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 135
taatacgact cactataggc aagttaattg tatcaggccg ttttagagct agaaatag 58
<210> 136
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 136
taatacgact cactatagga gccttattca ctaaaattcg ttttagagct agaaatag 58
<210> 137
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 137
taatacgact cactataggt atctagggta ttctttttgt tttagagcta gaaatag 57
<210> 138
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 138
taatacgact cactataggt ctcactctgt cacccaatcg ttttagagct agaaatag 58
<210> 139
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 139
taatacgact cactataggt gtcttgttag tgcacgtgag ttttagagct agaaatag 58
<210> 140
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 140
taatacgact cactataggt tcaactatat accgagtagg ttttagagct agaaatag 58
<210> 141
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 141
taatacgact cactataggt agagctcatc ttaagggtgg ttttagagct agaaatag 58
<210> 142
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 142
taatacgact cactataggc aagggatgtc acaaccgtgg ttttagagct agaaatag 58
<210> 143
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 143
taatacgact cactatagga aacagttata ctgagtattg ttttagagct agaaatag 58
<210> 144
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 144
taatacgact cactatagga gtgaaggggc tcccgtggcg ttttagagct agaaatag 58
<210> 145
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 145
taatacgact cactatagga ttagttggag ctaccagtgt tttagagcta gaaatag 57
<210> 146
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 146
taatacgact cactataggc tgaatttggc gaaagctcgt tttagagcta gaaatag 57
<210> 147
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 147
taatacgact cactatagga tttggattct ggtcgccacg ttttagagct agaaatag 58
<210> 148
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 148
taatacgact cactataggc cccatctcct gaggttcatg ttttagagct agaaatag 58
<210> 149
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 149
taatacgact cactataggc atcggcatgt ttgacaatgt tttagagcta gaaatag 57
<210> 150
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 150
taatacgact cactataggt tagttggggt ggaccacttg ttttagagct agaaatag 58
<210> 151
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 151
taatacgact cactataggc tcaaatcatt cctggtacgt tttagagcta gaaatag 57
<210> 152
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 152
taatacgact cactataggt gaagcaagat atgaaactcg ttttagagct agaaatag 58
<210> 153
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 153
taatacgact cactataggc ctaacctatt aggagttagg ttttagagct agaaatag 58
<210> 154
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 154
taatacgact cactataggc agtctactca agaaatccag ttttagagct agaaatag 58
<210> 155
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 155
taatacgact cactataggc tcttttgtct ggttcaacgt tttagagcta gaaatag 57
<210> 156
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 156
taatacgact cactataggc aacataagta ctaatgtggt tttagagcta gaaatag 57
<210> 157
<211> 78
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 157
aagcaccgac tcggtgccac tttttcaagt tgataacgga ctagccttat tttaacttgc 60
tatttctagc tctaaaac 78
<210> 158
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 158
ggcaaacuua gguauuggaa ccguuuuaga gcuagaaaua g 41
<210> 159
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 159
gguucuucac agugcaguga auguuuuaga gcuagaaaua g 41
<210> 160
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 160
ggauauaccu ucucagucua cuguuuuaga gcuagaaaua g 41
<210> 161
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 161
ggguuagaug auggugaaau aaguuuuaga gcuagaaaua g 41
<210> 162
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 162
gggaaugcua ugcuuagauu agguuuuaga gcuagaaaua g 41
<210> 163
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 163
ggucugcuag aggaaaacuu ugguuuuaga gcuagaaaua g 41
<210> 164
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 164
ggacugcagg cuuuccugug guguuuuaga gcuagaaaua g 41
<210> 165
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 165
ggucgggaaa caagcauaga aaguuuuaga gcuagaaaua g 41
<210> 166
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 166
ggagcaguau uucauuggua ccguuuuaga gcuagaaaua g 41
<210> 167
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 167
gggaagguaa agaaccugca acguuuuaga gcuagaaaua g 41
<210> 168
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 168
ggugaggagg aagucuucua ccguuuuaga gcuagaaaua g 41
<210> 169
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 169
ggacuccuga aaugauaaau caguuuuaga gcuagaaaua g 41
<210> 170
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 170
ggacuggcca gugauccuca ugguuuuaga gcuagaaaua g 41
<210> 171
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 171
gggagauacu gaagauguuc cuguuuuaga gcuagaaaua g 41
<210> 172
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 172
ggagacagaa ugaauguaga aaguuuuaga gcuagaaaua g 41
<210> 173
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 173
ggugcuugug aauuuucuga gaguuuuaga gcuagaaaua g 41
<210> 174
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 174
ggcuucaguc cuucuacugu ccguuuuaga gcuagaaaua g 41
<210> 175
<211> 39
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 175
ggcucuaauc aaucgacucc guuuuagagc uagaaauag 39
<210> 176
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 176
ggcauguacc ugugcuauau gguuuuagag cuagaaauag 40
<210> 177
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 177
ggagcauuca aagugucaaa guguuuuaga gcuagaaaua g 41
<210> 178
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 178
ggcuacagua ggggcaucca uaguuuuaga gcuagaaaua g 41
<210> 179
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 179
ggacccuaca cucuccggau gaguuuuaga gcuagaaaua g 41
<210> 180
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 180
ggaucugagg aacccccauc guguuuuaga gcuagaaaua g 41
<210> 181
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 181
gguccaaugu ccagaacacu acguuuuaga gcuagaaaua g 41
<210> 182
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 182
ggagugcuag auacuuucac acguuuuaga gcuagaaaua g 41
<210> 183
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 183
ggagcagaca cgucauauuu aguuuuagag cuagaaauag 40
<210> 184
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 184
ggaggaucau caagaauuau gcguuuuaga gcuagaaaua g 41
<210> 185
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 185
ggagcgauuc acaaaagagc acguuuuaga gcuagaaaua g 41
<210> 186
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 186
ggcaccuaac guuuaacacc uaguuuuaga gcuagaaaua g 41
<210> 187
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 187
gguuacacuc ccaagaucaa ucguuuuaga gcuagaaaua g 41
<210> 188
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 188
ggccaccgug ccucgccuca ugguuuuaga gcuagaaaua g 41
<210> 189
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 189
ggugcacguu cuacacgugu ccguuuuaga gcuagaaaua g 41
<210> 190
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 190
gguuguuaag ucuuagucau uguuuuagag cuagaaauag 40
<210> 191
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 191
ggccccagag ucagcucgug uguuuuagag cuagaaauag 40
<210> 192
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 192
gguggguaca ugaauacagu guguuuuaga gcuagaaaua g 41
<210> 193
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 193
gguuagaugu acuagucuau caguuuuaga gcuagaaaua g 41
<210> 194
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 194
ggaccaccua ucaucuaaug auguuuuaga gcuagaaaua g 41
<210> 195
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 195
ggucaacccu gacauauugg cguuuuagag cuagaaauag 40
<210> 196
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 196
ggcauguugu agcuuauguu auguuuuaga gcuagaaaua g 41
<210> 197
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 197
ggcuucugga uucuggcuua uaguuuuaga gcuagaaaua g 41
<210> 198
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 198
ggagacagau gcuagcacca aaguuuuaga gcuagaaaua g 41
<210> 199
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 199
ggacaacuaa uauaccaguc agguuuuaga gcuagaaaua g 41
<210> 200
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 200
ggugcuuugu ucuggauuuc gcguuuuaga gcuagaaaua g 41
<210> 201
<211> 39
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 201
ggaauugaaa ucaccuagua guuuuagagc uagaaauag 39
<210> 202
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 202
ggagguagua ugaguuccau caguuuuaga gcuagaaaua g 41
<210> 203
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 203
gguuuaaggu gaagcagcau cuguuuuaga gcuagaaaua g 41
<210> 204
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 204
ggauuacugg uggacuuacu ucguuuuaga gcuagaaaua g 41
<210> 205
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 205
ggcucuguca aaugucgugg uaguuuuaga gcuagaaaua g 41
<210> 206
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 206
gguucuugau cucccacacu auguuuuaga gcuagaaaua g 41
<210> 207
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 207
ggaaaugguu gcugggcacg gguuuuagag cuagaaauag 40
<210> 208
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 208
gguauaggua aacacacgac uuguuuuaga gcuagaaaua g 41
<210> 209
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 209
gguucugaag auaccguuaa uaguuuuaga gcuagaaaua g 41
<210> 210
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 210
gguuaaaggc augggcuucg ccguuuuaga gcuagaaaua g 41
<210> 211
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 211
ggagugaauu uuaugagccc uaguuuuaga gcuagaaaua g 41
<210> 212
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 212
ggacgucugu cuacauugaa uguuuuagag cuagaaauag 40
<210> 213
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 213
ggcagcuaac auguaugaug ccguuuuaga gcuagaaaua g 41
<210> 214
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 214
ggccuuagcc cccuuaguag cguuuuagag cuagaaauag 40
<210> 215
<211> 39
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 215
gguuucugua gcccauacuu guuuuagagc uagaaauag 39
<210> 216
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 216
ggagcauaca uaggguuucu cuguuuuaga gcuagaaaua g 41
<210> 217
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 217
ggcagcacuu gagugucauu cuguuuuaga gcuagaaaua g 41
<210> 218
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 218
ggcaucugua uaaaccgugu gaguuuuaga gcuagaaaua g 41
<210> 219
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 219
ggauuuggua augaugcuag guguuuuaga gcuagaaaua g 41
<210> 220
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 220
ggccauuuaa aaaguaaugg cguuuuagag cuagaaauag 40
<210> 221
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 221
ggaagcauug gaggaauauc guguuuuaga gcuagaaaua g 41
<210> 222
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 222
ggacaacaua aucaucguuu gcguuuuaga gcuagaaaua g 41
<210> 223
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 223
ggucacuggu uaaaacuaag gguuuuagag cuagaaauag 40
<210> 224
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 224
ggaguaaugc aauaugguag acguuuuaga gcuagaaaua g 41
<210> 225
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 225
ggcagugaga auguauauac ucguuuuaga gcuagaaaua g 41
<210> 226
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 226
gguaauauuu uggcuaagag ccguuuuaga gcuagaaaua g 41
<210> 227
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 227
gguucucauu cauauaaauu guguuuuaga gcuagaaaua g 41
<210> 228
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 228
gguuuuaccc ccagugguau guguuuuaga gcuagaaaua g 41
<210> 229
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 229
gguagaaaug cccugaucau uaguuuuaga gcuagaaaua g 41
<210> 230
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 230
ggcuaugagc acaguagaac uaguuuuaga gcuagaaaua g 41
<210> 231
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 231
gguacauuua gugguagucc agguuuuaga gcuagaaaua g 41
<210> 232
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 232
ggcuuaagua uaguaauuag aaguuuuaga gcuagaaaua g 41
<210> 233
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 233
ggcuuagaua aauuacagau uguuuuagag cuagaaauag 40
<210> 234
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 234
gguaguaguc cccccuuauc caguuuuaga gcuagaaaua g 41
<210> 235
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 235
gguugcggua aaccgagauc acguuuuaga gcuagaaaua g 41
<210> 236
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 236
ggucaggcuu uacuagaaga acguuuuaga gcuagaaaua g 41
<210> 237
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 237
ggaauagcug caaagaccac auguuuuaga gcuagaaaua g 41
<210> 238
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 238
ggauucauca gcguuugcuu caguuuuaga gcuagaaaua g 41
<210> 239
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 239
ggcaaggaag uuguaccguc uuguuuuaga gcuagaaaua g 41
<210> 240
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 240
ggcaguaaag caggcaauau cguuuuagag cuagaaauag 40
<210> 241
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 241
ggucuguagc uuugaagaau gcguuuuaga gcuagaaaua g 41
<210> 242
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 242
ggacauuugc aaaugcugau ucguuuuaga gcuagaaaua g 41
<210> 243
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 243
ggagugaccu gauucuaaac acguuuuaga gcuagaaaua g 41
<210> 244
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 244
ggccaggagu ucgagacuag ccguuuuaga gcuagaaaua g 41
<210> 245
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 245
ggugucccaa aagagcuagu uaguuuuaga gcuagaaaua g 41
<210> 246
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 246
gguccacuuu ugaauguugu acguuuuaga gcuagaaaua g 41
<210> 247
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 247
ggaaaauguc agacaagcuc aaguuuuaga gcuagaaaua g 41
<210> 248
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 248
ggucuuccaa guagcuaaug aaguuuuaga gcuagaaaua g 41
<210> 249
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 249
ggauuacaug aacaaauggg cguuuuagag cuagaaauag 40
<210> 250
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 250
ggauacagua uuaauugacu gguuuuagag cuagaaauag 40
<210> 251
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 251
gguggucuuu aagauaguca ucguuuuaga gcuagaaaua g 41
<210> 252
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 252
ggaggggcuu uuauucugcu caguuuuaga gcuagaaaua g 41
<210> 253
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 253
ggaauaauau ugaaaugacu acguuuuaga gcuagaaaua g 41
<210> 254
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 254
ggauuaucug gccaguuuau gaguuuuaga gcuagaaaua g 41
<210> 255
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 255
ggaaaaguua ugcaauucuu cguuuuagag cuagaaauag 40
<210> 256
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 256
gguggguuuu cauacagcua gcguuuuaga gcuagaaaua g 41
<210> 257
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 257
gguuaucacu uaagagcuua ggguuuuaga gcuagaaaua g 41
<210> 258
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 258
ggacaacuug uguaaaaagc uaguuuuaga gcuagaaaua g 41
<210> 259
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 259
ggauauaccu caucagaaug guguuuuaga gcuagaaaua g 41
<210> 260
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 260
ggccugcauu uaggauagcc agguuuuaga gcuagaaaua g 41
<210> 261
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 261
ggauguagca cgcauucaca uaguuuuaga gcuagaaaua g 41
<210> 262
<211> 39
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 262
gggauuuuua gcacagcaag guuuuagagc uagaaauag 39
<210> 263
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 263
gguaaugaag caucugauac cguuuuagag cuagaaauag 40
<210> 264
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 264
ggcaaaguua agggaguguu agguuuuaga gcuagaaaua g 41
<210> 265
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 265
ggacaaacaa caguugguau uguuuuagag cuagaaauag 40
<210> 266
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 266
ggagagaaug uguggcauga cuguuuuaga gcuagaaaua g 41
<210> 267
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 267
ggcguauaca gauuugauau cuguuuuaga gcuagaaaua g 41
<210> 268
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 268
ggacuuuacu cuuucaaaca uuguuuuaga gcuagaaaua g 41
<210> 269
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 269
ggcuguucuc ccucuauagg uaguuuuaga gcuagaaaua g 41
<210> 270
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 270
ggugcuugua cugugaguua uuguuuuaga gcuagaaaua g 41
<210> 271
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 271
gguuuaaaca ugucuuaccg aaguuuuaga gcuagaaaua g 41
<210> 272
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 272
ggaugaagua cuaagguuga gguuuuagag cuagaaauag 40
<210> 273
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 273
ggcagacccu cauuugcuac aguuuuagag cuagaaauag 40
<210> 274
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 274
ggaugagaca cuugauuacu acguuuuaga gcuagaaaua g 41
<210> 275
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 275
ggaguuacag cuacugcuug auguuuuaga gcuagaaaua g 41
<210> 276
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 276
ggcaaucuag gacugcuguu acguuuuaga gcuagaaaua g 41
<210> 277
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 277
ggugaggcgg gcagaucauc ugguuuuaga gcuagaaaua g 41
<210> 278
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 278
ggcucugcgu guucucauaa acguuuuaga gcuagaaaua g 41
<210> 279
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 279
ggccccuugc uaggccugcc ucguuuuaga gcuagaaaua g 41
<210> 280
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 280
gguagcagga ggcguauaaa cgguuuuaga gcuagaaaua g 41
<210> 281
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 281
gguuugugua gcuguauacg uaguuuuaga gcuagaaaua g 41
<210> 282
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 282
ggugucucuc gaacuaaaaa guguuuuaga gcuagaaaua g 41
<210> 283
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 283
ggaauucagu aucauccuau gguuuuagag cuagaaauag 40
<210> 284
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 284
ggcguaauca uauacggcag uaguuuuaga gcuagaaaua g 41
<210> 285
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 285
gguauuagca auccccaaau agguuuuaga gcuagaaaua g 41
<210> 286
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 286
ggaucggcua uaaaaaagau aaguuuuaga gcuagaaaua g 41
<210> 287
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 287
gguggggcuu caagaggugu acguuuuaga gcuagaaaua g 41
<210> 288
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 288
gguuaagcuc aagaaagauc ucguuuuaga gcuagaaaua g 41
<210> 289
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 289
ggcuuccuca aaaaaucuac aguuuuagag cuagaaauag 40
<210> 290
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 290
ggaguuuggu auaccagcga gcguuuuaga gcuagaaaua g 41
<210> 291
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 291
ggagaaucac uugaacccgg gguuuuagag cuagaaauag 40
<210> 292
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 292
ggcaaguuaa uuguaucagg ccguuuuaga gcuagaaaua g 41
<210> 293
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 293
ggagccuuau ucacuaaaau ucguuuuaga gcuagaaaua g 41
<210> 294
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 294
gguaucuagg guauucuuuu uguuuuagag cuagaaauag 40
<210> 295
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 295
ggucucacuc ugucacccaa ucguuuuaga gcuagaaaua g 41
<210> 296
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 296
ggugucuugu uagugcacgu gaguuuuaga gcuagaaaua g 41
<210> 297
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 297
gguucaacua uauaccgagu agguuuuaga gcuagaaaua g 41
<210> 298
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 298
gguagagcuc aucuuaaggg ugguuuuaga gcuagaaaua g 41
<210> 299
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 299
ggcaagggau gucacaaccg ugguuuuaga gcuagaaaua g 41
<210> 300
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 300
ggaaacaguu auacugagua uuguuuuaga gcuagaaaua g 41
<210> 301
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 301
ggagugaagg ggcucccgug gcguuuuaga gcuagaaaua g 41
<210> 302
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 302
ggauuaguug gagcuaccag uguuuuagag cuagaaauag 40
<210> 303
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 303
ggcugaauuu ggcgaaagcu cguuuuagag cuagaaauag 40
<210> 304
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 304
ggauuuggau ucuggucgcc acguuuuaga gcuagaaaua g 41
<210> 305
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 305
ggccccaucu ccugagguuc auguuuuaga gcuagaaaua g 41
<210> 306
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 306
ggcaucggca uguuugacaa uguuuuagag cuagaaauag 40
<210> 307
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 307
gguuaguugg gguggaccac uuguuuuaga gcuagaaaua g 41
<210> 308
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 308
ggcucaaauc auuccuggua cguuuuagag cuagaaauag 40
<210> 309
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 309
ggugaagcaa gauaugaaac ucguuuuaga gcuagaaaua g 41
<210> 310
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 310
ggccuaaccu auuaggaguu agguuuuaga gcuagaaaua g 41
<210> 311
<211> 41
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 311
ggcagucuac ucaagaaauc caguuuuaga gcuagaaaua g 41
<210> 312
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 312
ggcucuuuug ucugguucaa cguuuuagag cuagaaauag 40
<210> 313
<211> 40
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 313
ggcaacauaa guacuaaugu gguuuuagag cuagaaauag 40
<210> 314
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 314
acgttggatg acctatcgga agaaggcaag 30
<210> 315
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 315
acgttggatg cgctcttgta ttatctgtgg 30
<210> 316
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 316
acgttggatg taacttcagc tctgggaaag 30
<210> 317
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 317
acgttggatg ctggagccaa gaagagtaac 30
<210> 318
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 318
acgttggatg agagtgggca gagaatgttg 30
<210> 319
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 319
acgttggatg aaggtttcaa agcgccagtc 30
<210> 320
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 320
acgttggatg tgtctaagaa cacagaggag 30
<210> 321
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 321
acgttggatg aggtgatgtt cctgagatgc 30
<210> 322
<211> 31
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 322
acgttggatg ctcattctga atagaatcac c 31
<210> 323
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 323
acgttggatg aacggagcag aatggtcaag 30
<210> 324
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 324
acgttggatg acggctaatt gtgctcactg 30
<210> 325
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 325
acgttggatg gctagaggaa aactttgagg 30
<210> 326
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 326
acgttggatg ctctgggtcc ttaaagaaac 30
<210> 327
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 327
acgttggatg acaggcttga tattagactc 30
<210> 328
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 328
acgttggatg agatctgaat gctgatcccc 30
<210> 329
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 329
acgttggatg ctaggattct ctgagcatgg 30
<210> 330
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 330
acgttggatg acagtgagca caattagccg 30
<210> 331
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 331
acgttggatg ttagtactgg aacctacttc 30
<210> 332
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 332
acgttggatg ttagtactgg aacctacttc 30
<210> 333
<211> 30
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 333
acgttggatg acagtgagca caattagccg 30

Claims (10)

1. a kind of method for capturing target gene sequence from genomic DNA based on Crispr/cas9 systems, including following step Suddenly：
1) multiple gRNA, are synthesized according to target gene sequence design；
Each gRNA can with reference to and recognize the different target regions of the target gene sequence；
The fragmentation that the target gene sequence can guide cas9 enzymes to be cut into multiple 100-300bp by the gRNA is produced Thing；
2) cleavage reaction is carried out to the genomic DNA with the multiple gRNA and the cas9 enzymes, obtained containing multiple 100- The cleaved products of 300bp fragmentation products；
3) multiple 100-300bp of the target gene sequence in capture cleaved products fragmentation products.
2. according to the method described in claim 1, it is characterised in that：
Step 1) in, the multiple gRNA of design synthesis method is following a or b：
Method shown in a comprises the following steps：
(1) multiple gRNA are designed according to the target gene sequence, is used to prepare it further according to gRNA design synthesis The primer pair of correspondence transcription templates, obtains the corresponding primer pair of multiple gRNA transcription templates；
(2) the corresponding primer pair of multiple gRNA transcription templates is subjected to PCR respectively, obtains corresponding many The individual gRNA transcription templates,
(3) corresponding multiple gRNA transcription templates are transcribed, multiple gRNA are obtained；
Method shown in b comprises the following steps：
(1) multiple gRNA are designed according to the target gene sequence, further according to the corresponding transcription of gRNA design synthesis Template, obtains multiple gRNA transcription templates；
(2) the multiple gRNA transcription templates are transcribed, multiple gRNA are obtained.
3. method according to claim 1 or 2, it is characterised in that：
The multiple gRNA transcription templates of transcription are transcribed jointly again to transcribe or mixing respectively multiple gRNA transcription templates；
Or the method for the capture is paramagnetic particle method.
4. according to any described method in claim 1-3, it is characterised in that：
The genomic DNA is the genomic DNA of human or animal or the cell of other species；
The target gene sequence is the extron of BRCA1 genes and the extron of BRCA2 genes；
The corresponding multiple gRNA of extron of BRCA1 genes nucleotide sequence is respectively sequence 158-220；
The corresponding multiple gRNA of extron of BRCA2 genes nucleotide sequence is respectively sequence 221-313；
Or the nucleotide sequence of the sense primer in the corresponding primer pairs of the corresponding multiple gRNA of extron of the BRCA1 genes Respectively sequence 1- sequences 63, the nucleotides sequence of anti-sense primer is classified as sequence 157；
Or the nucleotide sequence of the sense primer in the corresponding primer pairs of the corresponding multiple gRNA of extron of the BRCA2 genes Respectively sequence 64- sequences 156, the nucleotides sequence of anti-sense primer is classified as sequence 157.
5. application of any described method in prepared by the high-throughput sequencing library of target gene sequence in claim 1-4.
6. application of any described method in the high-flux sequence of target gene sequence in claim 1-4.
7. a kind of high-flux sequence method of target gene sequence, comprises the following steps：
1) any described method captures multiple 100-300bp of target gene sequence fragmentation in claim 1-4 Product；
2) high-throughput sequencing library is prepared with the multiple 100-300bp fragmentation products；
3) high-throughput sequencing library described in high-flux sequence, realizes the high-flux sequence of target gene sequence.
8.Crispr/cas9 systems are captured or separated in genomic DNA or assemble the application in target gene sequence；
The Crispr/cas9 systems include multiple gRNA and cas9 enzymes；
The multiple gRNA guides the CAS9 enzymes that the target gene sequence is cut into multiple sizes for 100-300bp fragments Change product.
9. a kind of kit for being used in genomic DNA capture target gene sequence, including the institute in being applied described in claim 8 State Crispr/cas9 systems.
10. a kind of kit of high-flux sequence target gene sequence, including described in being applied described in claim 8 Reagent needed for prepared by Crispr/cas9 systems and sequencing library.
CN201710589991.5A 2017-07-19 2017-07-19 A kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence Pending CN107190008A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710589991.5A CN107190008A (en) 2017-07-19 2017-07-19 A kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710589991.5A CN107190008A (en) 2017-07-19 2017-07-19 A kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence

Publications (1)

Publication Number Publication Date
CN107190008A true CN107190008A (en) 2017-09-22

Family

ID=59882651

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710589991.5A Pending CN107190008A (en) 2017-07-19 2017-07-19 A kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence

Country Status (1)

Country Link
CN (1) CN107190008A (en)

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
CN109182454A (en) * 2018-08-22 2019-01-11 杭州恺思医疗器械有限公司 A method of capture genome specific DNA fragments
CN109355289A (en) * 2018-12-24 2019-02-19 人和未来生物科技（长沙）有限公司 For being enriched with kit, the preparation method and application of target sequence from pre- library
CN109652861A (en) * 2018-12-22 2019-04-19 阅尔基因技术（苏州）有限公司 A kind of biochemical reagents box and its application method
CN109652497A (en) * 2018-12-24 2019-04-19 人和未来生物科技（长沙）有限公司 A kind of methods and applications being enriched with target sequence from pre- library
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
CN110205318A (en) * 2019-05-15 2019-09-06 杭州杰毅生物技术有限公司 Macro Extraction Methods of Genome based on CRISPR-Cas removal host genome DNA
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
CN111471745A (en) * 2020-03-30 2020-07-31 华中农业大学 DNA targeting capture method based on CRISPR/Cas9 system mediation
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
CN111910001A (en) * 2020-07-16 2020-11-10 河南金泰生物技术股份有限公司 Primer group and kit for detecting SNP site rs1799950 genotyping of BRCA1 gene
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
CN113106144A (en) * 2020-12-30 2021-07-13 中南大学湘雅二医院 DNA fragment targeted enrichment method and application thereof in genome targeted sequencing
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140357523A1 (en) * 2013-05-29 2014-12-04 Agilent Technologies, Inc. Method for fragmenting genomic dna using cas9
CN107406875A (en) * 2014-12-20 2017-11-28 阿克生物公司 Use the composition and method of CRISPR/Cas systematic proteins targeting abatement, enrichment and segmentation nucleic acid
CN108138176A (en) * 2015-08-19 2018-06-08 阿克生物公司 Use the system acquisition nucleic acid of the nuclease guided based on nucleic acid
CN109182454A (en) * 2018-08-22 2019-01-11 杭州恺思医疗器械有限公司 A method of capture genome specific DNA fragments
CN109790576A (en) * 2016-09-27 2019-05-21 优比欧迈公司 The method and system of library preparation and sequencing based on CRISPR

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140357523A1 (en) * 2013-05-29 2014-12-04 Agilent Technologies, Inc. Method for fragmenting genomic dna using cas9
CN107406875A (en) * 2014-12-20 2017-11-28 阿克生物公司 Use the composition and method of CRISPR/Cas systematic proteins targeting abatement, enrichment and segmentation nucleic acid
CN108138176A (en) * 2015-08-19 2018-06-08 阿克生物公司 Use the system acquisition nucleic acid of the nuclease guided based on nucleic acid
CN109790576A (en) * 2016-09-27 2019-05-21 优比欧迈公司 The method and system of library preparation and sequencing based on CRISPR
CN109182454A (en) * 2018-08-22 2019-01-11 杭州恺思医疗器械有限公司 A method of capture genome specific DNA fragments

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
温旺荣: "《临床分子诊断学》", 31 March 2014, 广东科技出版社 *
邵志敏: "《乳腺癌 基础与临床的转化 上》", 30 September 2016, 上海交通大学出版社 *

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
CN109182454A (en) * 2018-08-22 2019-01-11 杭州恺思医疗器械有限公司 A method of capture genome specific DNA fragments
CN109652861A (en) * 2018-12-22 2019-04-19 阅尔基因技术（苏州）有限公司 A kind of biochemical reagents box and its application method
CN109652497A (en) * 2018-12-24 2019-04-19 人和未来生物科技（长沙）有限公司 A kind of methods and applications being enriched with target sequence from pre- library
CN109355289A (en) * 2018-12-24 2019-02-19 人和未来生物科技（长沙）有限公司 For being enriched with kit, the preparation method and application of target sequence from pre- library
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
CN110205318A (en) * 2019-05-15 2019-09-06 杭州杰毅生物技术有限公司 Macro Extraction Methods of Genome based on CRISPR-Cas removal host genome DNA
CN111471745A (en) * 2020-03-30 2020-07-31 华中农业大学 DNA targeting capture method based on CRISPR/Cas9 system mediation
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
CN111910001A (en) * 2020-07-16 2020-11-10 河南金泰生物技术股份有限公司 Primer group and kit for detecting SNP site rs1799950 genotyping of BRCA1 gene
CN113106144A (en) * 2020-12-30 2021-07-13 中南大学湘雅二医院 DNA fragment targeted enrichment method and application thereof in genome targeted sequencing

Similar Documents

Publication Publication Date Title
CN107190008A (en) A kind of method of capture genome target sequence based on Crispr/cas9 and its application in high-flux sequence
CN108103055B (en) Method for reverse transcription of single-cell RNA and construction of library
JP6483249B2 (en) Isolated oligonucleotides and their use in sequencing nucleic acids
Carlile et al. Pseudo-Seq: genome-wide detection of pseudouridine modifications in RNA
CN109666662A (en) Application of the novel ScCas12a in terms of detection of nucleic acids
CN102181943B (en) Paired-end library construction method and method for sequencing genome by using library
CN112680797B (en) Sequencing library for removing high-abundance RNA and construction method thereof
CN108138365A (en) A kind of unicellular transcript profile banking process of high throughput
CN112384620A (en) Method for screening and identifying functional lncRNA
CN106967716A (en) Double gRNA, double gRNA libraries, double gRNA vector libraries and its preparation method and application
CN107828858B (en) Method for developing Bidens bipinnata SSR primers based on transcriptome sequencing
CN110951827B (en) Rapid construction method and application of transcriptome sequencing library
CN109750092B (en) Method and kit for targeted enrichment of target DNA with high GC content
CN113638055B (en) Method for preparing double-stranded RNA sequencing library
CN108166069A (en) A kind of novel methylate banking process and its application
CN102797044A (en) Fast and efficient construction method of normalized full-length cDNA library
CN108342385A (en) A kind of connector and the method that sequencing library is built by way of high efficiency cyclisation
CN107794258A (en) A kind of method and its application in constructed dna large fragment library
EP3615683B1 (en) Methods for linking polynucleotides
CN110218811A (en) A method of screening rice mutant
CN106636069B (en) Construction method of wild rice cDNA library
CN104694630B (en) Preparation method of probe for multiplex ligation-dependent probe amplification
CN107794573A (en) A kind of method and its application in constructed dna large fragment library
WO2022199242A1 (en) Set of barcode linkers and medium-flux multi-single-cell representative dna methylation library construction and sequencing method
CN111979226B (en) Method capable of carrying out in-vitro off-target detection and sgRNA screening in batch

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination