CN107177591A - SgRNA sequences using CRISPR technical editor's CCR5 genes and application thereof - Google Patents
SgRNA sequences using CRISPR technical editor's CCR5 genes and application thereof Download PDFInfo
- Publication number
- CN107177591A CN107177591A CN201610133212.6A CN201610133212A CN107177591A CN 107177591 A CN107177591 A CN 107177591A CN 201610133212 A CN201610133212 A CN 201610133212A CN 107177591 A CN107177591 A CN 107177591A
- Authority
- CN
- China
- Prior art keywords
- sgrna
- ccr5
- dna
- sequence
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- AIDS & HIV (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
It the present invention relates to the use of sgRNA sequences of CRISPR technical editor's CCR5 genes and application thereof.The present invention provides the sgRNA sequences for CCR5 genes, and the sgRNA sequences are selected from：CCR5‑sgRNA1：AGGGCAACTAAATACATTCT, CCR5 sgRNA2：TGCCAAAAAATCAATGTGAA, CCR5 sgRNA3：AGTGGGACTTTGGAAATACA, and CCR5 sgRNA4：ATGCACAGGGTGGAACAAGA.DNA sequence dna, the carrier comprising the sgRNA sequences or the DNA sequence dna, the cell comprising the carrier the invention further relates to encode the sgRNA sequences and application thereof.The invention provides safe and efficient sgRNA, it has cutting efficiency high, the advantages of probability that misses the target is small, upper with extensive prospect in the clinical research and application of AIDS gene therapy.
Description
Technical field
The present invention relates to biotechnology and field of gene, more particularly to utilize CRISPR system targeting knock out CCR5 bases
SgRNA sequences of cause and treatment AIDS and application thereof.
Background technology
CRISPR/Cas systems are that a kind of adaptive immunity for the degraded that bacterium and archeobacteria are used for exogenous genetic material is prevented
Imperial mechanism.In these organisms, the exogenous genetic material from bacteriophage obtains and is integrated into CRISPR sites.This green wood
Material, also referred to as spacer region, set up the fragment to the sequence-specific of phage-infect for future.These sequence-specifics
Fragment is translated into guiding CRISPR RNA (sgRNAs), and its function is the enzymatically active nucleic acid via related (Cas) albumen of CRISPR
Property, encoded and be oriented to by CRISPR sites, complementation intrusion DNA cracking.II type CRISPR system Cas9 nucleases have RNA combinations
Domain, α spirals identification leaf (REC), nucleic acid leaf, including RuvC and HNH DNA cracking and it is preceding between region sequence adjacent to motif
(PAM) site is intersected.SgRNA formation is compound by being attached to bridge spiral in REC leaves with Cas9 nucleases, and forms multiple tools
There are the key salt bridges of sgRNA.
Once sgRNA is attached to Cas9, the conformation of Cas9 nucleases changes, and produces an energy passage, allows DNA more to hold
Easily combine.Cas9/sgRNA complex screen dnas find PAM (5'-NGG) site.Identification PAM sites cause DNA to untwist, and make
SgRNA finds the adjacent DNA complementary strands in PAM sites.When Cas9 is attached to, PAM sites are adjacent, the complementary DNA sequences with sgRNA
On row, bridge spiral and target DNA the formation RNA-DNA heteroduplex structures of REC interlobar parts.The identification in PAM sites includes that target can be made
The activation of the HNH and RuvC nuclear fragmentation of DNA double chain fracture (DSB), and cause DNA degradation.If sgRNA is not complementary with target DNA,
Cas9 will be discharged, and find new PAM sites.It can pass through nonhomologous end after linear target gene group fracture in DNA
The reparation (HDR) of (NHEJ) or homologous mediation is engaged to be repaired.Nonhomologous end engagement (NHEJ) can cause insertion or
Person's deletion error.The reparation (HDR) of homologous mediation can genome specific position combination specific markers.CRISPR/Cas9
Mechanism can be used for including in the genetic engineering of the various systems including mammalian cell.
Nowadays, CRISPR/Cas9 systems yield unusually brilliant results in field of gene, the utilization CRISPR/Cas9 reported recently
It is even more a large amount of in acquisition field that system recovers normal muscle function to the gene editing of congenital muscular dystrophy for patient
Concern.Clinical prospect is applied in CRISPR/Cas9 unanimously to be had an optimistic view of instantly, increasing CRISPR/Cas9 systems
Prioritization scheme is suggested.
In recent years, treating AIDS research achieves breakthrough.2007, a German medical team was by CCR5 bases
Because the HSCT of defect is to an AIDS patient for suffering from leukaemia.Pass through the observation more than 4 years, patient HIV inspections
It is feminine gender to survey result, and there is no leukaemia and HIV sign.The success of this case, it is treating AIDS to point out CCR5
Promising target.Therapeutic strategy using accessory receptor as targeting provides a kind of new approaches for feature treatment of AIDS.Grind
Study carefully and show, the expression for eliminating cell surface CCR5 by genetic modification can reach the purpose that anti HIV-1 virus infects.
The content of the invention
The present invention is directed to CCR5 target spots using CRISPR technologies, designs and screens and obtains safe and efficient sgRNA, and it has
There is cutting efficiency high, the advantages of probability that misses the target is small, with optimum efficiency in terms of gene editing efficiency and safety in utilization, and
The clinical research and application of AIDS gene therapy are upper to have extensive prospect.The site be also gene therapy AIDS most
Good sgRNA sites selection.
In some embodiments, provided herein is the sgRNA sequences for CCR5 genes, the sgRNA sequences are selected from：
CCR5-sgRNA1：AGGGCAACTAAATACATTCT, CR5-sgRNA2：TGCCAAAAAATCAATGTGAA, CCR5-sgRNA3：
AGTGGGACTTTGGAAATACA, and CCR5-sgRNA4：ATGCACAGGGTGGAACAAGA.
In some embodiments, provided herein is the DNA sequence dna for encoding the sgRNA sequences, such as 5'-
TCCCGTTGATTTATGTAAGA-3', 5'-ACGGTTTTTTAGTTACACTT-3', 5'-TCACCCTGAAACCTTTATGT-
3', 5'-TACGTGTCCCACCTTGTTCT-3'.
In some embodiments, provided herein is the carrier for including the sgRNA sequences or DNA sequence dna, such as plasmid.
In some embodiments, provided herein is the cell for including the carrier.In some embodiments, the cell
It is people's cell, nonhuman mammalian cells, stem cell.
In some embodiments, provided herein is for modifying CCR5 genes or regulation CCR5 gene tables in eukaryotic
The method reached, methods described includes introducing the sgRNA sequences, the DNA sequence dna and/or described carrier to eukaryotic,
And the eukaryotic is cultivated so that endonuclease is directed to CCR5 genes by sgRNA.In some embodiments, wherein institute
Stating method, (in vitro) and/or in vitro (ex vivo) is carried out in vitro.In some embodiments, the eukaryotic is
People's cell, nonhuman mammalian cells, stem cell.In some embodiments, the modification reduction CCR5 gene expressions.One
In a little embodiments, the modification knocks out CCR5 genes.
In some embodiments, provided herein is the method for the AIDS for the treatment of subject, methods described is included to tested
Person introduces the sgRNA sequences, the DNA sequence dna, the cell of the carrier and/or the modification, or to the cell of subject
It is middle to introduce the sgRNA sequences, the DNA sequence dna and/or described carrier, and the eukaryotic is cultivated so that sgRNA will
Endonuclease is directed to CCR5 genes, so as to reduce CCR5 gene expressions, or knocks out CCR5 genes.In some embodiments
In, wherein methods described is carried out in vitro and/or in vitro.In some embodiments, the eukaryotic is people's cell, for example
Autologous people's cell or the people's cell from other donors.
In some embodiments, provided herein is the sgRNA sequences, the DNA sequence dna, the carrier and/or described
Cell is preparing the purposes in being used to treat the medicine of the AIDS of subject or kit.
In some embodiments, provided herein is a kind of composition or kit, it includes being selected from the sgRNA sequences,
It is any one or more in the DNA sequence dna, described carrier and/or described cell.In some embodiments, it is described
Composition and/or kit are including the use of specification, and the kit preferably can be used for purposes described herein and method.
In some embodiments, the kit includes being suitable for storing the sgRNA sequences, the carrier, and/or described
The various reagents of DNA molecular such as buffer solution etc..In some embodiments, the kit includes being appropriate for the sgRNA
Sequence, the carrier, and/or the DNA molecular and the various reagents of target gene reaction include enzyme, conversion or transfection reagent
Deng.In some embodiments, the kit includes fitting through the sgRNA sequences, the carrier, and/or the DNA
Molecule adjusts destination gene expression (such as reduction CCR5 gene expressions) reagent by being reacted with target gene.
In some embodiments, provided herein is RNA sequence such as sgRNA sequences and/or DNA sequence dna be separation sequence
Or the sequence of synthesis.
Brief description of the drawings
Fig. 1：Cas9/sgRNA systems transfection 293T cell fluorescences photo (left side is white light, and the right side is green fluorescence).
Fig. 2：The corresponding T7 digestions detection electrophoresis results of 4 sgRNA.
Fig. 3：GRNAT7 digestions result (sgRNA1#-sgRNA16#).
Fig. 4：GRNAT7 digestions result (sgRNA17#-sgRNA33#).
Embodiment
The present invention now is described more fully with reference to accompanying drawing, which describe the present invention a part and not all embodiment party
Case.In fact, these inventions can embody in many different forms, and it should not be construed as by embodiment illustrated herein
Limitation, its modification and other embodiments are also included within scope of the following claims.
1.sgRNA
In general, sgRNA be with target polynucleotide sequence have it is complementary enough so as to target sequence hybridization and
Any polynucleotide sequence for instructing CRISPR compounds to be specifically bound with the target sequence.
In some embodiments, the sgRNA of the present invention can further be modified, so that the sgRNA after modification
With sequence C CR5-sgRNA1 listed above：AGGGCAACTAAATACATTCT, CCR5-sgRNA2：
TGCCAAAAAATCAATGTGAA, CCR5-sgRNA3：AGTGGGACTTTGGAAATACA, and CCR5-sgRNA4：
ATGCACAGGGTGGAACAAGA has about 100%, about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%,
91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 75%, 70%, 65%,
60%, 55%, or 50% homogeneity, but CRISPR compounds and target sequence still can be instructed to specifically bind.For than
Algorithm to sequence is known in the art, including ClustalW, ClustalX, BLAST etc..After above-mentioned sequence modification,
SgRNA sequences with the sequence identity can verify its cutting efficiency by method described herein, miss the target probability, from
And obtain the sequence of modification.In some embodiments, the sgRNA sequences with the sequence identity at least have former sequence
Same activity (such as cutting efficiency).In some embodiments, the sgRNA sequences with the sequence identity, which have, improves
Activity (such as cutting efficiency).In some embodiments, the sgRNA sequences with the sequence identity have the de- of reduction
Target probability.
In some embodiments, the sgRNA of the present invention can further be modified, so that the sgRNA after modification
With sequence C CR5-sgRNA1 listed above：AGGGCAACTAAATACATTCT, CCR5-sgRNA2：
TGCCAAAAAATCAATGTGAA, CCR5-sgRNA3：AGTGGGACTTTGGAAATACA, and CCR5-sgRNA4：
ATGCACAGGGTGGAACAAGA has shorter sequence.Have been found to using the sgRNA (such as 17 for being shorter in length than 20nt
~18nt " truncated sgRNA ") without influenceing its activity, and risk of missing the target may be significantly reduced.In some embodiment party
In case, can use shorter sgRNA, such as 17,18,19nt sgRNA.Obtaining can be by herein after shorter sgRNA
The method validation of description its cutting efficiency, miss the target probability, so as to obtain the sequence of modification.In some embodiments, it is described more
Short sgRNA sequences at least have the same activity (such as cutting efficiency) of former sequence.In some embodiments, it is described shorter
SgRNA sequences have the activity (such as cutting efficiency) improved.In some embodiments, the shorter sgRNA sequences have
The probability that misses the target of reduction.
The sequence-specific knot that sgRNA instructs CRISPR compounds and target sequence can be assessed by suitable determination method
The ability of conjunction.For example, it is sufficient to form the component of the CRISPR systems of CRISPR compounds, including sgRNA to be measured, for example
Transfected and provided in the host cell with corresponding target sequence by using the carrier for the component for encoding the CRISPR sequences,
Then it is estimated by method as described herein.Similarly, existed by providing the target sequence, including sgRNA to be tested
The component of interior CRISPR compounds and the control sgRNA different from test sgRNA, and compare test sgRNA with
The control sgRNA reaction between target sequence at combination or cutting rate, preferred sgRNA can be obtained.
In some embodiments, recombination template is additionally provided.Recombination template can be that another is carried as described herein
The component of body, it is included in a separated carrier, or is provided as a separated polynucleotides.In some embodiments
In, recombination template is designed to be used as the template in homologous recombination, as by the part as CRISPR compounds
Within the target sequence that CRISPR digestions are opened or cut or in its vicinity.In some embodiments, the template polynucleotide and bag
A part of complementation of polynucleotides containing target sequence.
Herein, outer except as otherwise clearly stating, the order of nucleotide sequence each means the order from 5' ends to 3' ends.
Provided herein is sgRNA can be a kind of oligonucleotides.Term " oligonucleotides " refers to by being covalently attached two kinds
The molecule of nucleotides formation above.Term oligonucleotides generally includes few nucleosides, oligonucleotide analogs, oligonucleotides simulation
Thing and these chimeric combination.When referring to nucleotides or sequence monomer, it can be with base sequence, such as, for example, A, T (or U), G
Or the sequence of C or its analog.
" nucleotides " is used herein herein refers to comprising sugared structure division, base structure part and the base of covalent attachment
Group (linking group between such as phosphoric acid or phosphorothioate nucleotides) glucosides, and including naturally occurring nucleotides (such as DNA or
RNA the non-naturally occurring nucleotides of sugar and/or base structure part) and comprising modification, it is also referred to as " nucleosides
Acid-like substance ".Non-naturally occurring nucleotides includes sugared structure division (such as two ring nucleosides acid or the core of 2 ' modifications with modification
Thuja acid, such as 2 ' substitution nucleotides) nucleotides." nucleotide analog " is naturally occurring nucleotides (such as DNA or RNA cores
Thuja acid) utilize the variant of the modification generation in sugar and/or base structure part.Analog can not have to the oligonucleotides
Functional impact or with functional impact.For example, by producing for the increased binding affinity of target and/or increased
The easiness in resistance and/or increased transporte to cells to intracellular nucleic acid enzyme.In some embodiments, it is described
SgRNA includes 1,2,3 or more nucleotide analogs.In some embodiments, the oligomer includes 3-8 core
Thuja acid analog, such as 6 or 7 nucleotide analogs.In some embodiments, the nucleotide analog includes locking core
Sour (LNA).For example, 1 in the nucleotide analog, 2,3 or more nucleotide analogs can be LNA.
The RNA and/or DNA molecular of modification defined herein can contain nucleotide analog/modification, and such as skeleton is repaiied
Decorations, sugar-modified or base modification.Backbone modification can be that the phosphate of the nucleotide backbone included in nucleic acid molecules is chemical.Repair
The bound phosphate groups of the modification skeleton of decorations can substitute one or more oxygen atoms to modify by using different substituents, the example
Including such as thiophosphate.
2.CRISPR enzymes
In some embodiments, the present invention relates to CRISPR enzymes, such as Cas9.In some embodiments, it is of the invention
Be related to endonuclease such as Cas9, its include at least one nuclear localization signal, at least one nuclease domain, and at least one
Interact to target endonuclease into the domain of the specific nucleotide sequences for shearing with sgRNA.In some realities
Apply in scheme, the endonuclease lacks at least one functional nucleic acid enzyme domains through modification.In some embodiments
In, the present invention relates to the nucleic acid of separation, it encodes endonuclease of the present invention.In some embodiments, the core
The translation that acid is directed in mammalian cell carries out codon optimization.In some embodiments, the nucleic acid is thin for people
Translation carries out codon optimization in born of the same parents.In some embodiments, the nucleic acid and promoter sequence of the enzyme are encoded operationally
Connection.
3.Cas9, sgRNA carrier and delivery system
Provided herein is sgRNA carriers.SgRNA carriers are described comprising that can be transcribed into the polynucleotides of sgRNA sequences
SgRNA sequences can enter edlin to target gene.
In some embodiments, the carrier can be viral vector, preferably such as slow virus or baculoviral or adenopathy
Poison/adeno-associated virus (AAV) carrier.
In some embodiments, the carrier includes but is not limited to, single-stranded, double-strand or partially double stranded nucleic acid molecules,
Including DNA, RNA, or both nucleic acid molecules.In some embodiments, the carrier is plasmid.In some embodiments
In, the carrier is viral vector, for example, retrovirus, replication defect type retrovirus, adenovirus, replication defect type
Adenovirus and adeno-associated virus (AAV)) carrier.In some embodiments, the carrier, which is included, is directed to for expression
Host cell and the one or more regulating elements selected, the regulating element are operably coupled to nucleotide sequence to be expressed
Such as sgRNA.The regulating element includes promoter, enhancer, internal ribosome entry site (IRES) and other expression controls
Element (such as transcription stop signals, such as polyadenylation signal and poly U sequences).In some embodiments, carry herein
For the bi-cistronic vectors for sgRNA and Cas9.In some embodiments, sgRNA and Cas9 can be by different promoters
Start, for example, Cas9 is driven by CBh promoters, and sgRNA is driven by U6 promoters.
In some embodiments, carrier may be designed for expressing CRISPR transcriptions in protokaryon or eukaryotic
Thing (such as transcribed nucleic acid thing, protein or enzyme).In some embodiments, using mammalian expression vector, carrier can
The one or more sequences of driving are expressed in mammalian cell.In some embodiments, recombinant mammalian expression vector
It can instruct nucleic acid is preferential to express (for example, carrying out express nucleic acid using organizing specific type regulating element) in particular cell types.
Organizing specific type regulating element is as known in the art.In some embodiments, will drive one of CRISPR systems or
One or more carriers of the expression of multiple element are incorporated into host cell so that the table of these elements of the CRISPR systems
Up to the formation that CRISPR compounds are instructed in one or more target sites.In some embodiments, a carrier includes one
Or multiple insertion points, it may be inserted into two or more sgRNA.
In some embodiments, provided herein is separation or reorganization body polynucleotides, its comprising coding sgRNA RNA or
The various components of DNA sequence dna, sgRNA carriers.Polynucleotides can be RNA or DNA, they can be it is single-stranded or double-stranded, optionally
Ground includes synthesis, non-natural or modified nucleotide base.The polynucleotides of DNA polymer forms can be by cDNA, gene
Group DNA, synthetic DNA or their mixture one or more fragments are constituted.Polynucleotides may include ribonucleotide and
The combination of ribonucleotide and deoxyribonucleotide.The deoxynucleotide and ribonucleotide include naturally occurring molecule
And synthetic analogues.Polynucleotides of the present invention are also covered by the sequence of form of ownership, including but not limited to single stranded form, double-strand
Form, hairpin structure, loop-stem structure etc..Additionally provide the recombination of polynucleotide comprising sgRNA carriers and its different component.Restructuring
Regulation and control and coded sequence that combination such as non-natural of the carrier comprising artificial or heterologous nucleotide sequence coexists.Implement other
In scheme, recombinant vector can include from separate sources regulating and controlling sequence and coded sequence, or from identical source but with
The regulating and controlling sequence and coded sequence arranged different from naturally occurring mode.The carrier can be used alone or make with carrier combinations
With.If using carrier, the selection of carrier depends on the method to convert host cell.Can for example plasmid be used to carry
Body.It can be wrapped on the host cell for including any separating acid fragment of the invention, carrier to successfully convert, screen and breed
The genetic elements contained.Therefore in order to obtain the cell line of the desired expression of display and pattern, can be analyzed by southern blotting technique,
Rna blot analysis, the immunoblotting assay of protein expression or phenotypic analysis etc. are screened.
In some embodiments, one or more sgRNA carriers as described herein can be provided not in expression cassette form
Expressed with cell type.The box may include 5' and 3' regulating and controlling sequences, its by operationally with provided herein is polynucleotides
Connection.In the 5'-3' directions of transcription, the expression cassette may include transcription and translation sintering (i.e. promoter), be carried herein
The recombination of polynucleotide of confession and transcription and translation terminator (i.e. terminator).Many promoters can be used for provided herein is
SgRNA carriers.By using different promoters in sgRNA carriers, time, position and/or the water of sgRNA expression can be adjusted
It is flat.If desired, sgRNA carriers (such as can assign induction type, composing type, environment or growth adjustment containing promoter regulatory region
Or cell or tissue specificity/selective expression regulatory region), transcription initiation starts site, ribosome bind site, RNA
Processing signal, translational termination site and/or polyadenylation signal.
4. the method imported
Provided herein is method include sgRNA vectors into cells.Provided herein is method be not limited to ad hoc approach, only
Polynucleotides are made to enter the inside of at least one cell of host.It is by the method in polynucleotides importing host cell
Method known in the art, including but not limited to virus-mediated.Importing includes referring to enters eucaryon or prokaryotic by nucleic acid integration
In, it can be integrated into the cell amplifying nucleic acid in the genome of cell, and nucleic acid or albumen are supplied to cell including referring to.Conversion
Scheme and it can be changed for polynucleotide sequence to be introduced into intracellular scheme according to the type for being converted cell.One
In a little embodiments, viral vector, preferably such as slow virus or baculoviral or adenovirus/adeno-associated virus (AAV) can be used
Carrier is imported.In some embodiments, other delivery systems can be used, such as Yeast system, microcapsule bubble, particle gun/
Carrier is attached on golden nanometer particle.In the carrier, sgRNA or coding DNA can be operably connected to one and open
Mover, and delivery of nucleic acids is instructed into host cell.
5. composition and/or kit
Provided herein is the composition and/or kit that the method using sgRNA and offer include sgRNA, the sgRNA works as
When introducing cell gene editing can be carried out to target gene.Such method and composition includes sgRNA carriers, and the carrier has
Encode sgRNA polynucleotide sequence.SgRNA carriers are designed to produce sgRNA from the carrier.
Provided herein is composition can comprising separation or substantially purified polynucleotides." separation " or " purifying " is more
Nucleotides, is substantially or essentially normal in naturally occurring environment with polynucleotides or to be interacted therewith without those
Free components.Therefore, separate or purified polynucleotides are substantially free of other cellular materials or when by recombinant skill
Art produce when culture medium or substantially free of the precursor or other chemical substances when by chemical synthesis.At some
In embodiment, naturally occurred in the biological genomic DNA that " separation " polynucleotides are derived from without polynucleotides
The sequence of the polynucleotides both sides (that is, positioned at 5' the and 3' ends of the polynucleotides).
SgRNA, carrier, the cell of the present invention can be used in pharmaceutical preparation and composition, can also be prepared into convenient application
Kit.Suitably, the composition or kit include medicinal solvent, such as water or salt solution, diluent, carrier, salt or
Adjuvant.
Present invention additionally comprises the pharmaceutical composition of the oligonucleotides containing the present invention and preparation.The pharmaceutical composition of the present invention
It can be used for treating disease, such as gene therapy.
In some embodiments, provided herein is composition and/or kit include：
1) sgRNA polynucleotide sequence is encoded, the wherein polynucleotide sequence includes one or more sgRNA, should
SgRNA can be hybridized on the target sequence in eukaryotic,
2) polynucleotide sequence of CRISPR enzymes is encoded.
In transcription, sgRNA guiding CRISPR compounds are combined with the sequence-specific of the target sequence, wherein should
CRISPR compounds are included with hybridizing to sgRNA the and CRISPR enzymes on the target sequence.
In some embodiments, the polynucleotides are included in the carrier system containing one or more carriers.
6. application method
In some embodiments, provided herein is for modifying CCR5 genes or regulation CCR5 gene tables in eukaryotic
The method reached, methods described includes introducing the sgRNA sequences, the DNA sequence dna and/or described carrier to eukaryotic,
And the eukaryotic is cultivated so that endonuclease is directed to CCR5 genes by sgRNA.
In some embodiments, provided herein is the method for the AIDS for the treatment of subject, methods described is included to tested
Person introduces the sgRNA sequences, the DNA sequence dna, described carrier and/or the cell of the modification, or to the thin of subject
Introduce the sgRNA sequences, the DNA sequence dna, described carrier in born of the same parents, and cultivate the eukaryotic so that sgRNA is by core
Sour restriction endonuclease is directed to CCR5 genes, so as to reduce CCR5 gene expressions, or knocks out CCR5 genes.
In some embodiments, provided herein is method include：1) polynucleotide sequence for encoding sgRNA is provided, its
In the polynucleotide sequence can be hybridized on the target sequence in eukaryotic comprising one or more sgRNA, the sgRNA, 2)
The polynucleotide sequence of CRISPR enzymes is encoded, the CRISPR enzymes optionally include at least one or more nuclear localization sequence.Turning
During record, sgRNA guiding CRISPR compounds are combined with the sequence-specific of the target sequence, and wherein the CRISPR compounds are included
With hybridizing to sgRNA the and CRISPR enzymes on the target sequence.
In some embodiments, the polynucleotide sequence of coding CRISPR enzymes is DNA or RNA.
In some embodiments, the coding polynucleotide sequence of CRISPR enzymes, sgRNA any one or can be all
RNA。
In some embodiments, the coding sequence of CRISPR enzymes, sgRNA can be RNA and can via liposome,
Nano-particle, microcapsule bubble or particle gun are delivered.In some embodiments, the polynucleotides are comprised in retouches above
In the one or more carriers stated.
In some embodiments, provided herein is method be in vitro (in vitro) and/or in vitro (ex vivo)
Carry out.In some embodiments, methods described includes induced expression.In some embodiments, the carrier is virus
Carrier, including AAV or slow virus carrier.In some embodiments, the CRISPR enzymes are Cas9.In some embodiments
In, sgRNA expression is under the control of T7 promoters and driven by the expression of T7 polymerases.
In some embodiments, provided herein is method include delivering CRISPR enzymes, for example by cell deliver compile
The mRNA of the code CRISPR enzymes is carried out.
In some embodiments, method of the invention includes：
1) (i) at least one CRISPR enzymes comprising at least one nuclear localization signal are introduced to eukaryotic or encoded at least
A kind of nucleic acid of the CRISPR enzymes comprising at least one nuclear localization signal, at least one sgRNA of (ii) at least one coding RNA
Or DNA, and
2) target site that the eukaryotic make it that CRISPR enzymes are directed in chromosome sequence by sgRNA is cultivated, wherein
Double-strand break is introduced the target site by the CRISPR enzymes, and the double-strand break causes institute by DNA repair process reparations
Chromosome sequence is stated to be modified.
In some embodiments, the CRISPR enzymes come from Cas9.
In some embodiments, the nucleic acid for encoding the CRISPR enzymes is mRNA.
In some embodiments, the nucleic acid for encoding the CRISPR enzymes is DNA.
In some embodiments, the DNA is a part for carrier, and the carrier is further comprising coding sgRNA's
Sequence.
In some embodiments, the eukaryotic includes people's cell and nonhuman mammalian cells, stem cell.
In some embodiments, provided herein is sgRNA sequence informations it is as follows：
CCR5-sgRNA1：AGGGCAACTAAATACATTCT,
CCR5-sgRNA2：TGCCAAAAAATCAATGTGAA,
CCR5-sgRNA3：AGTGGGACTTTGGAAATACA,
CCR5-sgRNA4：ATGCACAGGGTGGAACAAGA.
In some embodiments, (1) sgRNA1 passes through the DNA sequence dna (5'-TCCCGTTGATTTATGTAAGA- that is transferred to
3') carry out transcription synthesis, or be directly transferred to sgRNA sequences (AGGGCAACTAAATACATTCT), by with Cas9 albumen knots
Close and form cutting complex, sgRNA sequences are by recognizing strictly complementary sequence, so as to navigate to No. 3 chromosomes of human genome
In CCR5 gene orders (NC_000003.12 (46370142..46376206)), high is completed to the gene target sequence specific site
Effect cutting.
In some embodiments, (2) sgRNA2 passes through the DNA sequence dna (5'-ACGGTTTTTTAGTTACACTT- that is transferred to
3') carry out transcription synthesis, or be directly transferred to sgRNA sequences (TGCCAAAAAATCAATGTGAA), by with Cas9 albumen knots
Close and form cutting complex, sgRNA sequences are by recognizing strictly complementary sequence, so as to navigate to No. 3 chromosomes of human genome
In CCR5 gene orders (NC_000003.12 (46370142..46376206)), high is completed to the gene target sequence specific site
Effect cutting.
In some embodiments, (3) sgRNA3 passes through the DNA sequence dna (5'-TCACCCTGAAACCTTTATGT- that is transferred to
3') carry out transcription synthesis, or be directly transferred to sgRNA sequences (AGTGGGACTTTGGAAATACA), by with Cas9 albumen knots
Close and form cutting complex, sgRNA sequences are by recognizing strictly complementary sequence, so as to navigate to No. 3 chromosomes of human genome
In CCR5 gene orders (NC_000003.12 (46370142..46376206)), high is completed to the gene target sequence specific site
Effect cutting.
In some embodiments, (4) sgRNA1 passes through the DNA sequence dna (5'-TACGTGTCCCACCTTGTTCT- that is transferred to
3') carry out transcription synthesis, or be directly transferred to sgRNA sequences (ATGCACAGGGTGGAACAAGA), by with Cas9 albumen knots
Close and form cutting complex, sgRNA sequences are by recognizing strictly complementary sequence, so as to navigate to No. 3 chromosomes of human genome
In CCR5 gene orders (NC_000003.12 (46370142..46376206)), high is completed to the gene target sequence specific site
Effect cutting.
In some embodiments, in the sgRNA, the genome species are people, and the position exists
In CCR5 genes, described sequence information is respectively：AGGGCAACTAAATACATTCT；TGCCAAAAAATCAATGTGAA；
AGTGGGACTTTGGAAATACA；ATGCACAGGGTGGAACAAGA, sequence is write according to the rule at 5' ends to 3' ends.At some
In embodiment, sgRNA sequence locations information includes the corresponding RNA sequence information of DNA sequence dna information.
In some embodiments, provided herein is the side that CRISPR/sgRNA carriers are prepared with any sgRNA sequences
Method.In some embodiments, methods described may include steps of：
1) the sgRNA carriers according to needed for the sgRNA sequences Designs synthesize CRISPR systems；
2) use step 1) obtain carrier carry out CCR5 gene editing.
In some embodiments, described CRISPR/sgRNA carriers include DNA vector and RNA carriers.
In some embodiments, methods described carries out gene editing, required targeting guiding with CRISPR technologies
Carrier include provided herein is sgRNA sequences.
An object of the present invention is to design the multiple of suitable CRISPR technologies gene editing on CCR5 gene
SgRNA sites.
In some embodiments, provided herein is sgRNA design methods, methods described includes：
According to the design rule of the sgRNA to CRISPR/Cas9, the not homotype on multiple extrons of CCR5 gene
Enclose the interior multiple possible sgRNA of design.In some embodiments, methods described, which is included in the design of primer, finds corresponding
PAM sequences.In some embodiments, found near required cutting position after PAM sequences, by 18-23bp adjacent thereto
Fragment can be alternative as possible sgRNA.In some embodiments, sgRNA selection position is then distributed on CCR5
In multiple extrons.An object of the present invention also resides in offer and gene editing safety is filtered out in the sgRNA of above-mentioned design
The method in the high sgRNA sites of property.In some embodiments, the high security sgRNA screening techniques include：Above-mentioned many
On the basis of the sgRNA of individual design, using a variety of forecasting softwares, such as CRISPR Design Tool predict that each sgRNA is produced
The possibility missed the target.Different software misses the target according to different principle predictions.In some embodiments, consider multiple soft
Selected after the scoring of part and the relatively low sgRNA that misses the target is predicted in multiple softwares.In screening process, with CRISPR Design
Tool is Primary Reference, and we set following standard：Cutting efficiency is judged should be more than 50；Site highest scoring miss the target not
It can exceed that 3 points；More than 1 point of site of missing the target is no more than 1；New site of missing the target is not detected using CCTop instruments.
In some embodiments, the sgRNA sequences filtered out are connected to the corresponding of vector plasmid by way of design of primers primer
Position, production of plasmid carries out internal test by way of PCR.In some embodiments, used in building process
The PrimeSTAR enzymes of Takara companies, use 50ul reaction system.Low missed the target designed in the design of primer
SgRNA sequence is added in end, is replaced new 20bp sgRNA sequences to the relevant position of carrier by way of PCR.
In some embodiments, GFP fluorescin sequence is inserted on the test for convenience of after, the Cas9 carriers of selection simultaneously
Row.Transfect second day observation fluorescence intensity after 293T cells (see Fig. 1).
By the above method, inventor devises different sgRNA on CCR5 gene extron, and to miss the target site and
The probability that misses the target is analyzed and (see the table below 1-5).
May miss the target site and the probability score that misses the target on table 1.CCR5-sgRNA1 extrons
May miss the target site and the probability score that misses the target on table 2.CCR5-sgRNA2 extrons
| sequence | score | mismatches | locus |
| TTTACATTCATTTTTTGGTATGG | 0.6 | 3MMs[3:9:19] | chr17:+62865344 |
| TTCCCACCCATTTTTTGGCAGGG | 0.6 | 4MMs[4:7:8:9] | chr1:-184677338 |
| TTAATTTTTATTTTTTGGCAGAG | 0.5 | 4MMs[3:5:6:9] | chr22:-43219702 |
| TTAAGATTCATTTTTTGGTATGG | 0.3 | 4MMs[3:5:9:19] | chr8:+87153638 |
| CTCACAGAGATTTTGTGGCAGGG | 0.3 | 4MMs[1:7:8:15] | chr14:-95107782 |
| TTCACAGTGATTTTTTAGAAAAG | 0.2 | 3MMs[7:17:19] | chr9:-17299443 |
| TTCACATGGATTTTTTCACAGAG | 0.2 | 3MMs[8:17:18] | chr17:-12901819 |
| TTAACATTGAGATTTTGGCCTGG | 0.2 | 4MMs[3:11:12:20] | chr16:+21664069 |
| TTCATATACATTTTTTGCCAAAG | 0.2 | 4MMs[5:8:9:18] | chr1:+121312867 |
| TTCATATACATTTTTTGCCAAAG | 0.2 | 4MMs[5:8:9:18] | chr5:-49692828 |
| TTCACTTAGACTCTTTGGCAGAG | 0.2 | 4MMs[6:8:11:13] | chr16:+11650266 |
| GTGACACTGATTTCTTGGCAGGG | 0.2 | 4MMs[1:3:7:14] | chr3:-15298856 |
| TTCACCTTGTTTCTTTGGCCAAG | 0.1 | 4MMs[6:10:13:20] | chr1:-192128429 |
| TCCACATTTATTGTTTGGAAAGG | 0.1 | 4MMs[2:9:13:19] | chr2:+170062975 |
| TTCAGTTTCATTTTTGGGCAGAG | 0.1 | 4MMs[5:6:9:16] | chr22:+30489822 |
| TCCACACTGATCTCTTGGCATGG | 0.1 | 4MMs[2:7:12:14] | chr10:+25889757 |
| TTCAGATTAATTTTTTTCCAGAG | 0.1 | 4MMs[5:9:17:18] | chr4:+129793538 |
| TTCACATGGATTCTATGGCTTGG | 0.1 | 4MMs[8:13:15:20] | chr2:+210889782 |
| TTTACATTCATTTTTTGATATGG | 0.1 | 4MMs[3:9:18:19] | chr17:-44617453 |
| TTTACATTCATTTTTTGATATGG | 0.1 | 4MMs[3:9:18:19] | chr17:-44399599 |
| TTCAGATTGATCTTTCTGCATGG | 0 | 4MMs[5:12:16:17] | chr4:+81967055 |
| TTCACATTGATGTTTTCGTCCAG | 0 | 4MMs[12:17:19:20] | chrX:-46457538 |
| TTGACATTGATCTTGAGGCAGAG | 0 | 4MMs[3:12:15:16] | chr1:-36379536 |
May miss the target site and the probability score that misses the target on table 3.CCR5-sgRNA3 extrons
May miss the target site and the probability score that misses the target on table 4.CCR5-sgRNA4 extrons
| sequence | score | mismatches | locus |
| ATCCACAGGAAGGAACAAGAAGG | 1.3 | 3MMs[3:10:11] | chr19:-43990455 |
| AGGGACAGGGTGGAAAAAGAGAG | 0.5 | 3MMs[2:4:16] | chr11:-86126410 |
| ATTCACAGCCTGGAACAAAAGAG | 0.3 | 4MMs[3:9:10:19] | chr17:+3527515 |
| AAGCTCAGGGAGGAGCAAGATGG | 0.2 | 4MMs[2:5:11:15] | chr10:-104374957 |
| GTGCTCAGGGTGGAACCAAAGAG | 0.2 | 4MMs[1:5:17:19] | chr2:-220470931 |
| CTGGACAGGGTGGACCAAGTAAG | 0.2 | 4MMs[1:4:15:20] | chr2:-54159878 |
| CTGCTCAGGGTGGATCCAGAGAG | 0.2 | 4MMs[1:5:15:17] | chr6:-689106 |
| AAGCACACGGTTGAAAAAGAAGG | 0.1 | 4MMs[2:8:12:16] | chr3:-37547441 |
| TTGCACAGTGTGTAACAAAAAAG | 0.1 | 4MMs[1:9:13:19] | chr1:-155889682 |
| CTGCAGAGTGTGGAACAGGAAAG | 0.1 | 4MMs[1:6:9:18] | chr3:-52873581 |
| ATGCTCTGGGGGGAAAAAGAAAG | 0.1 | 4MMs[5:7:11:16] | chrX:-41029225 |
| ACGCACCGGGTGGAAGTAGATGG | 0.1 | 4MMs[2:7:16:17] | chr22:+50688848 |
| ATGAAGAGGGTGAAACAGGAAAG | 0.1 | 4MMs[4:6:13:18] | chr1:+233397754 |
| ATGCCCAGAGTGTAACACGATGG | 0.1 | 4MMs[5:9:13:18] | chr1:+186113596 |
| ATTCACAGGGAGGCACAGGACAG | 0 | 4MMs[3:11:14:18] | chr6:-166354166 |
| ATGCACAGGCTGGCACCGGAAGG | 0 | 4MMs[10:14:17:18] | chr9:+139903922 |
The low gRNA screenings of missing the target of table 5.
In some embodiments, an object of the present invention is to provide and further screened in the above sgRNA
Go out the method in the sgRNA sites with high efficiency gene editor.Methods described includes obtaining a series of low sgRNA missed the target, connection
Onto respective carrier, these sgRNA cutting efficiency is detected.There is related article to report CRISPR/Cas9 cutting effect before this
Rate largely receives sgRNA influence.In some embodiments, apply 293T cells be tested it is above-mentioned
The sgRNA of high security after screening.
In some embodiments, the sgRNA screening techniques of described high efficiency gene editor are as follows：
After each sgRNA fluorescence data is obtained, every kind of sgRNA cutting efficiency further have detected.Will transfection
After the 293T cells cultivated are collected, genome is extracted using QIAGEN boxes.Using different sgRNA CCR5 diverse location
It is upper that the sequence for containing expected cleavage site is expanded by PCR.
After PCR primer is reclaimed using TIANGEN kits, NEB T7 restriction enzyme cleavages are used.This enzyme
Imperfect identical position on meeting Non-specific cleavage DNA.If CRISPR/Cas9 effect under, target location be possible to by
Cutting, then can produce the mismatch sequence that can be recognized by T7 again in the presence of NHEJ, so as to be cut.Such as Fig. 2.
Pass through above-mentioned detection method, 33 groups of gRNA cutting efficiencies related data such as table 6 below of inventor's test：
Table 6：GRNA cutting efficiencies
Four groups of gRNA cuttings of 12# (gRNA1) as can be seen from the above table, 17# (gRNA2), 9# (gRNA3), 19# (gRNA4)
Efficiency highest (T7 digestion results are shown in Fig. 3, Fig. 4), be above 70% cutting efficiency.
In cutting process, 20ul system can have been used, which includes 2ul 10X NEB Buffer2,
1000ng DNA, and supply the deionized water of system.In order to ensure the effect of digestion, before T7 enzymes are added, PCR primer warp
Cycle of annealing is crossed.Then agarose electrophoresis identification is carried out after 1 hour of T7 digestions.
In order to further determine that selected sgRNA cutting efficiency, to there is the PCR primer of clear T7 cuttings, connect
It is sequenced on the Blunt simple carriers of transgene companies production.And choose 30 to 100 clones and be sequenced,
It is determined that cutting ratio and cutting mode.
By the method for the present invention, global alignment cell mortality, consideration convey efficiency, and after cutting efficiency, can
Obtain the sgRNA of efficient, low efficiency of missing the target.
7. application
The oligonucleotides of the present invention may be used as investigational agent, for example, for diagnosing, treating and preventing.Under study for action, institute
State oligonucleotides can be used for specifically bind purpose, edlin can be entered to the gene, for example reduce its expression or by its
Knock out, thus promote to the functional selection of target or to its assessment as the target of Results.
For therapeutic agent, the subject with AIDS can be by being controlled using oligonucleotides of the present invention
Treat.Further provide for treatment and suspect the method for suffering from or tending to the mammal (such as treatment people) with AIDS, it is described logical
Cross the oligonucleotides or composition for the one or more present invention that effective dose is treated or prevented by applying.Widow of the present invention
Nucleotides or pharmaceutical composition are typically applied with effective dose.
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
The structure of 1.sgRNA plasmid vectors
(1) design of primers and synthesis
We since first extron of CCR5 gene untill the position of CCR5- Δs 32, with reference to sgRNA design rules
SgRNA primers all on positive and negative adopted chain are found, by bioinformatics opinion, the low sgRNA missed the target is screened and sets
Corresponding primer is counted, primer Synesis Company is sent to and is synthesized.
(2) dissolving of sgRNA primers and annealing
Company's synthetic primer, 3000rpm centrifugation 5min, plus TE is taken to be dissolved to 200uM, 37 DEG C of placement 15min.Take 5 μ l's
Forward Primer and corresponding Reverse Primer are mixed in PCR pipe.
Cycle of annealing:
95℃ X 10min
95 DEG C of X 1s (- 2.0 DEG C/cycle), Go To 2,4times
85 DEG C of X 1s (- 0.2 DEG C/cycle), Go To 4,299times
25℃ X 1min
(3) connection of sgRNA Insert Fragments and carrier
1) 30ug Insert Fragments and 5ug sgRNA carriers are gone to be made into connection mixed liquor (systems of Solution I), 37 DEG C of companies
Connect 1 hour.
2) full formula gold Trans5 α or T1 competence bacterias are used, 25 μ l competence bacterium solutions are added into each pipe, are put on ice
Put 30min.
3) 42 DEG C of water-bath 90s, recovery 3min on ice, adds 100 μ l non-resistant LB culture mediums afterwards.Recovered in 37 DEG C of shaking tables
15min-30min。
4) 65 μ l in 125 μ l bacterium solutions are applied on 0.001%Amp LB flat boards, are put into 37 DEG C of incubators and cultivate 12h-
16h。
5) each 4 clones of flat board picking, are dissolved in 100 μ lAmpLB culture mediums.37 DEG C of shaking table culture 3-10h.Sequencing mirror
Make correct clone.
2.sgRNA plasmid vectors it is highly purified
The carrier it is highly purified, using QIAGEN go endotoxin be set with middle extraction reagent kit, it extracts DNA total amounts every time
Can be in 50-100 μ g.
(1) bacterium solution that extracting TALEN plasmids needs prepares
1) configuration 100ml 0.001%Amp LB culture mediums, 50 μ l in strain are put into conical flask, in 37 DEG C of shaking tables
In shake 16h.
2) multiple 50ml centrifuge tubes are taken out, bacterium solution is poured into 50ml centrifuge tubes in three times, 12000rpm/min centrifugations
7min, outwells supernatant.
(2) process is put forward in QIAGEN kits
1) the P1 solution that 4ml has added RNaseA, resuspended bacterium solution are added into every pipe.
2) add 4ml P2 solution, reverse mixing for several times, room temperature place 3-5 minutes, now solution thick thing occurs
Simultaneously blueness is presented in matter.
3) add blueness in 10ml P3 solution, solution to decorporate, white flock precipitate occur, reverse mixing causes it for several times
Uniformly, 4 DEG C of centrifuge 20000xg are put into centrifuge 30 minutes, supernatant is transferred in a new 50ml pipe, are noted as far as possible not
Pour out white depositions.
4) 840 μ l endotoxic removal buffer are added into each 50ml centrifuge tubes, 30min is placed on ice.
5) using the 4ml Buffer QBT balance adsorption columns of QIAGEN-tip 100.
6) by the mixed liquor containing plasmid by syringe and filter membrane, inject liquid into adsorption column.
7) adsorption columns of QIAGEN-tip 100 are washed twice using 10ml QC Buffer.
8) by absorption pylon on a new centrifuge tube, with 5ml Buffer QF eluted dnas.
9) 3.5ml isopropanols are added into new centrifuge tube, 4 DEG C of centrifuge 20000xg are put into, centrifuged 30 minutes, are removed
Supernatant.
10) washing of the ethanol of 2ml 70% is added into new centrifuge tube, 4 DEG C of centrifuge 20000xg are put into, 30 points are centrifuged
Clock.
11) iuntercellular is transferred to, supernatant is removed, dries, plasmid is dissolved with 40-100 μ l sterilized waters or TE eluents, puts
Put 5min.
12) dispense, the absorbance and concentration of plasmid solution are determined using NanoDrop, it is however generally that A260/A280 is more than
1.9, A260/A230 are close or larger than 2, and concentration, which is more than 500ng/ μ l, can carry out next step experiment.
3.sgRNA plasmids sun turns and purifying
(1) positive transformants of sgRNA plasmids
1) full formula gold Trans5 α or T1 competence bacterias are used, 25 μ l competence bacterium solutions are added into each pipe, are put on ice
Put 30min.
2) 42 DEG C of water-bath 90s, recovery 3min on ice, adds 100 μ l non-resistant LB culture mediums afterwards.Recovered in 37 DEG C of shaking tables
15min-30min。
3) 65 μ l in 125 μ l bacterium solutions are applied on 0.001%Amp LB flat boards, are put into 37 DEG C of incubators and cultivate 12h-
16h。
4) each 2 clones of flat board picking, are dissolved in 100 μ lAmpLB culture mediums.37 DEG C of shaking table culture 3-10h.
(2) extraction of sgRNA plasmids
Mode identical extracting mode is carried according to Unit Assembling plasmids are small, and conservation and extracting is shaken after positive transformants
Plasmid in the competence Escherichia coli got up.
4. sgRNA efficiency screenings are carried out on 293T cells
293T cells are easy to survival, and fast growth, genomic states more relax, notable for bacterial endotoxin resistance
It is better than mankind's CD34+ cell masses.It is suitable for the test experience.
Plasmid before transfectional cell will carry out sterilization treatment, and the possibility of its contamination of cells is eliminated as far as possible.
(1) sedimentation and sterilizing of plasmid
1) it will purify and two volumes absolute ethyl alcohol and the 3M sodium acetates of 1/10 volume added in sgRNA plasmid vectors, mixed
Close uniform, be put into sedimentation more than 30min in -20 DEG C.
2) 4 DEG C of 12000rpm/min centrifugation 15min, now visible white pellet, removes supernatant, adds 1ml
70% ethanol is washed.
3) 4 DEG C of 12000rpm/min centrifugation 15min, are transferred to iuntercellular super-clean bench, tube wall sprinkling alcohol.
4) 70% ethanol is removed, residual liquid is dried up, 10-20 μ l sterilized waters dissolving 5-10min is added.
5) it is transferred out of in 1 μ l to a new tubule, surveys concentration and A260/A280, A260/A230, it is desirable to reach concentration
＞ 300ng/ μ l, A260/A280 ＞ 1.9, A260/A230 are approached or ＞ 2.0.
(2) liposome transfection sgRNA and Cas9 plasmids enter 293T cells
1) 293T cell attachment situations are observed, it is uniform for growing, it is non-overlapping, and covering culture dish 70-80% areas
293T cells suitably carry out transfection experiment.
2) according to the size of orifice plate and cell quantity, LTX mixed liquors and plasmid-plus mixed liquors are prepared, according to
The table that Invitrogen companies provide is prepared (table 7, modified).
Generally, according to 1 × 106Cell transfecting 1.5 μ g of one side or 2 μ gTALEN (totally 4 μ g), transfect 2 μ g.
3) the DNA-Plus mixed liquors mixed are slowly added in LTX mixed liquors, rapid oscillation is mixed.
4) mix and Vortex vibrations are reused after all pipes, mixed liquor is slowly added to be covered with to the hole of 293T cells
In, in Microscopic observation cell state and the granular size and uniformity coefficient of mixing.
5) it is placed in 37 DEG C of CO2gas incubators, rocks uniform, culture.
6) state in GFP plasmids hole is observed after 12h, transfection efficiency is judged.Culture medium is changed, cell is placed back in 37 DEG C
In CO2gas incubator, to the 72nd hour.
(3) 293T cellular genomes are extracted
Using TIANGEN cellular genome extracts kits, 293T cellular genomes are extracted.
1) 293T cell pretreatments：The medium component on 293T cells upper strata is siphoned away, it is appropriate (1ml pairs using trypsase
Answer 6 orifice plates, 500 μ l correspondences, 12 orifice plates), digest 3min in 37 DEG C of incubators.
2) molecule experiments area is transferred to from iuntercellular by orifice plate, hole inner cell is transferred in 1.5ml tube,
12000rpm/min centrifuges 2min, removes supernatant.
3) orifice plate is washed with 1ml PBS, and cleaning solution is transferred in tube, 12000rpm/min
2min is centrifuged, supernatant is removed.
4) according to 200 μ l GA, 20 μ l Proteinase Ks (kit is carried), 4 μ l RNaseA (kit is carried) configuration mixing
Re-suspension liquid, is added in tube and cell mass is resuspended to no agglomerate.
5) 200 μ l GB are added, are mixed, 70 DEG C of placement 15min are every the reverse mixings of 5min once, limpid to solution.
6) 200 μ l absolute ethyl alcohols are added, it is of short duration to be centrifuged off the tube wall globule.
7) mixed liquor is added in the CB3 posts being inserted into collecting pipe, 12000rpm/min centrifugation 30s outwell receipts
Waste liquid in collector.
8) 600 μ lGD are added in CB3 posts, 12000rpm/min centrifugation 30s outwell the waste liquid in collecting pipe.
9) 700 μ l PW are added in CB3 posts, 12000rpm/min centrifugation 30s outwell the waste liquid in collecting pipe.
10) repeat 9).
11) 12000rpm/min centrifuges 2min, dries PW in order to avoid it produces influence to subsequent reactions, CB3 posts are inserted into
In one clean 1.5ml tube, room temperature places 5min.
12) eluent TE is put in 65 DEG C of air baths and heated.
13) 35 μ l elution buffers TE, 12000rpm/min centrifugation 30s are added to CB3 posts center.
14) elution buffer in 1.5ml tube is added in CB3 posts again, 12000rpm/min centrifugations 30s.
15) absorbance and concentration of plasmid solution are determined using NanoDrop, it is however generally that A260/A280 is dense more than 1.8
Degree, which is more than 10ng/ μ l, can carry out next step experiment.
16) extract 5 μ l or so carrier and carry out 1% agarose gel electrophoresis identification, have single band and its size exists
15000bp's or so or more carries out next step experiment.
(4) PCR reactions obtain the fragment near specific cut portion
Design primer so that the size of PCR primer is between 500-1500, while the sequence that sgRNA is covered can be covered
Row scope, primer respectively has more than 200bp distance apart from sgRNA cleavage sites.Because the site of some sgRNA effects is in gene
Concentration is compared in position in group, therefore can be with general primer, then primer quantity is substantially reduced than sgRNA quantity, and table 8 lists part most
Conventional detection primer and its sgRNA that can be detected (by Shanghai, Sheng Gong companies synthesize).Order substantially represents primer and often uses journey
Degree.
PCR reacts
It is as follows using Takara PrimeStar systems：
Total PCR system size：50 μ l (generally two pipes)
Reacted in PCR instrument using following PCR programs：
98 DEG C of 5min, 98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 50s) circulate 35 times；72℃10min；4℃forever.
1) 1% agarose gel electrophoresis is used, judges whether band is single and whether there is the band of correct size.If band list
One and size is correct, using PCR primer electrophoresis QIAquick Gel Extraction Kit；If bar is correct but not single with size, using agarose
Gel reclaims kit.
2) fragment for recovery using NanoDrop detects its concentration and absorbance, general and A260/A280 is more than
1.8, concentration, which is more than 20ng/ μ l, can carry out next step experiment.
(5) T7 restriction endonucleases I detects mutant fragments
T7 restriction endonucleases I can recognize the part of the Incomplete matchings such as double-stranded DNA neck ring or balloon-shaped structure, and be cut into two
Part.Because Cas9/sgRNA effects can trigger genome nonhomologous end repair mechanism and produce different random reparation pieces
Section, when the PCR primer for being mixed with various treated fragments carries out Gradient annealing together, fragment experience constantly " unwind-
With reference to " process so that two ends are matched but the increase of the unmatched fragment ratio in Cas9/sgRNA active regions, and this fragment just may be used
To be cut by T7 restriction endonucleases I, two band are produced.
1) PCR primer is mixed with NEB Buffer 2 and water according to following formula：
| H2O | Up to |
| Buffer 2 | 2μl |
| PCR | 500μ |
It is put into PCR instrument, multiple gradients annealing is carried out with following program：95℃5min；95 DEG C -85 DEG C, decline within every 3 seconds
2℃；85℃1min；85 DEG C -25 DEG C, decline 0.3 DEG C each second, whenever 5X DEG C stops 1min；25℃ forever.
2) 1 μ l T7 Endonuclease are added into treated PCR primer mixed liquor, 37 DEG C are put into.
Warm bath 2h in PCR instrument.
3) Ago-Gel of configuration 2%, 10 × Loading of Takara are added into PCR primer.
4) electrophoretogram is exported, efficiency characteristics of the Cas9/sgRNA in 293T cell lines is judged.
Claims (10)
1. for the sgRNA sequences of CCR5 genes, the sgRNA sequences are selected from：
CCR5-sgRNA1：AGGGCAACTAAATACATTCT,
CCR5-sgRNA2：TGCCAAAAAATCAATGTGAA,
CCR5-sgRNA3：AGTGGGACTTTGGAAATACA, and
CCR5-sgRNA4：ATGCACAGGGTGGAACAAGA.
2. encode the DNA sequence dna of the sgRNA sequences described in claim 1.
3. the carrier comprising the sgRNA sequences described in claim 1 or the DNA sequence dna described in claim 2.
4. include the cell of the carrier described in claim 3.
5. for modifying CCR5 genes or the method for adjusting CCR5 gene expressions in eukaryotic, methods described is included to eucaryon
Cell introduces the sgRNA sequences described in claim 1, the load described in DNA sequence dna and/or claim 3 described in claim 2
Body, and the eukaryotic is cultivated so that endonuclease is directed to CCR5 genes by sgRNA.
6. the method described in claim 5, wherein methods described are carried out in vitro and/or in vitro.
7. the method described in claim 5 or 6, wherein the eukaryotic is people's cell, nonhuman mammalian cells, does thin
Born of the same parents.
8. the method any one of claim 5-7, wherein the modification reduction CCR5 gene expressions, preferably described modification
Knock out CCR5 genes.
9. the sgRNA sequences described in claim 1, carrier described in DNA sequence dna, claim 3 described in claim 2 and/
Or the cell described in claim 4 is preparing the purposes in being used to treat the medicine of the AIDS of subject or kit.
10. a kind of composition or kit, it includes the sgRNA sequences selected from claim 1, DNA sequences described in claim 2
It is any one or more in carrier described in row, claim 3 and the cell described in claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610133212.6A CN107177591A (en) | 2016-03-09 | 2016-03-09 | SgRNA sequences using CRISPR technical editor's CCR5 genes and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610133212.6A CN107177591A (en) | 2016-03-09 | 2016-03-09 | SgRNA sequences using CRISPR technical editor's CCR5 genes and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107177591A true CN107177591A (en) | 2017-09-19 |
Family
ID=59830024
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610133212.6A Pending CN107177591A (en) | 2016-03-09 | 2016-03-09 | SgRNA sequences using CRISPR technical editor's CCR5 genes and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107177591A (en) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858373A (en) * | 2017-11-16 | 2018-03-30 | 山东省千佛山医院 | Endothelial cell conditionity knocks out the construction method of CCR5 genetic mouse models |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| CN108570479A (en) * | 2017-12-06 | 2018-09-25 | 内蒙古大学 | A method of mediate down producing goat VEGF is gene site-directed to knock in based on CRISPR/Cas9 technologies |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
-
2016
- 2016-03-09 CN CN201610133212.6A patent/CN107177591A/en active Pending
Cited By (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN107858373A (en) * | 2017-11-16 | 2018-03-30 | 山东省千佛山医院 | Endothelial cell conditionity knocks out the construction method of CCR5 genetic mouse models |
| CN107858373B (en) * | 2017-11-16 | 2020-03-17 | 山东省千佛山医院 | Construction method of endothelial cell conditional knockout CCR5 gene mouse model |
| CN108570479B (en) * | 2017-12-06 | 2020-04-03 | 内蒙古大学 | Method for mediating down producing goat VEGF gene fixed-point knock-in based on CRISPR/Cas9 technology |
| CN108570479A (en) * | 2017-12-06 | 2018-09-25 | 内蒙古大学 | A method of mediate down producing goat VEGF is gene site-directed to knock in based on CRISPR/Cas9 technologies |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107177591A (en) | SgRNA sequences using CRISPR technical editor's CCR5 genes and application thereof | |
| CN105112445B (en) | A kind of miR-205 gene knockout kits based on CRISPR-Cas9 gene Knockouts | |
| US9879283B2 (en) | CRISPR oligonucleotides and gene editing | |
| JP2023123561A (en) | CRISPR/CAS-related methods and compositions for improving transplantation | |
| Liu et al. | Preparation of fluorescence starch-nanoparticle and its application as plant transgenic vehicle | |
| CN109475109A (en) | The method for destroying immunological tolerance for using multiple guidance RNA | |
| CN113939591A (en) | Methods and compositions for editing RNA | |
| US11834652B2 (en) | Compositions and methods for scarless genome editing | |
| CA3151336A1 (en) | Compositions and methods for identifying regulators of cell type fate specification | |
| CN115768886A (en) | Genome editing system and method | |
| CN101979547B (en) | Identification of isolation cloning and core region of promoters suitable for gene expression of skeletal muscles in pigs | |
| CN112941072B (en) | Nucleic acid self-assembly structure and preparation method and application thereof | |
| CN102453716A (en) | Clone and application of pig skeletal muscle specificity expression gene alpha-actin promoters | |
| US20210024915A1 (en) | Method for activating p21 gene expression | |
| CN111868243A (en) | Systems and methods for treating high IgM syndrome | |
| WO2023193616A1 (en) | Method for repairing hba2 gene mutations by single base editing and use thereof | |
| CN110551722B (en) | Nucleic acid compound and preparation method and application thereof | |
| US11624067B2 (en) | In-vitro induction of adult stem cell expansion and derivation | |
| CN109055433B (en) | Method for activating expression of endogenous Ngn3 and MAFA genes | |
| CA3236802A1 (en) | Serine recombinases | |
| EP3818158A1 (en) | In-vitro induction of adult stem cell expansion and derivation | |
| WO2023025767A1 (en) | Method for cas9 nickase-mediated gene editing | |
| CN109456995A (en) | Gene knockout plasmid, cell line and preparation method and application | |
| CN111926018B (en) | Application of substance for reducing USP1 expression in preparation of medicine for treating children T-line acute lymphoblastic leukemia | |
| WO2022267843A1 (en) | Library construction method based on long overhang sequence ligation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170919 |
|
| WD01 | Invention patent application deemed withdrawn after publication |