CN107176991B - Application of recombinant protein rPbG37 of plasmodium berghei gametophyte in malaria transmission blocking - Google Patents

Abstract

The invention belongs to the field of immunology, and particularly relates to a plasmodium berghei gametophyte recombinant protein (rPbG37), a preparation method thereof and application thereof in malaria transmission blocking. The amino acid sequence of the recombinant protein of the plasmodium bovieri gametophyte (rPbG37) is SEQ ID NO: 1; or an amino acid sequence which has 95 to 100 percent of homology with the amino acid sequence defined by the sequence SEQ ID No.1 and encodes the same functional protein; or a protein derived from the amino acid sequence shown in SEQ ID No.1 by adding, deleting or replacing one or more amino acids and having the same activity. The recombinant protein is a novel recombinant protein with a transmission blocking effect, and can further improve the transmission blocking effect of malaria.

Description

Application of recombinant protein rPbG37 of plasmodium berghei gametophyte in malaria transmission blocking

Technical Field

The invention belongs to the field of immunology, and particularly relates to a plasmodium berghei gametophyte recombinant protein (rPbG37), a preparation method thereof and application thereof in a malaria transmission blocking process.

Background

Malaria is an infectious parasitic disease that severely threatens human health and is transmitted by plasmodium via the vector anopheles mosquito, and recent WHO global malaria reports indicate that about 429000 people still die of malaria globally in 2015 alone. In the high-density endemic areas of malaria, the currently available anti-malaria approaches have been insufficient to block malaria transmission, and the increasing and prevalence of drug-resistant mosquitoes and plasmodia has increased the difficulty of controlling malaria. Therefore, the international committee for malaria elimination (MalERA) has considered that a key measure to control malaria transmission is the development of a new control method that effectively blocks malaria transmission, while vaccines are undoubtedly the best weapon to accomplish this. Malaria vaccines fall into three main categories: pre-erythroid vaccines, and Transmission Block Vaccines (TBVs); wherein: the pre-erythrocytic vaccine and the erythrocytic vaccine can reduce the infection rate and clinical morbidity of malaria, but candidate antigens of the pre-erythrocytic vaccine and the erythrocytic vaccine are exposed to a human immune system and are influenced by factors such as human immune pressure, the candidate antigens have wide gene polymorphism, the transmission blocking vaccine can block the transmission of malaria epidemiology, and the candidate antigens are mainly expressed on the surface of plasmodium at a mosquito stage, are not influenced by the selection pressure of the vertebrate immune system, show lower polymorphic level, have no antigen variation and are more favorable for the immune effect of the vaccine. TBVs are therefore considered as new strategies to accelerate malaria control and ultimately eradicate it.

The effector mechanism of TBVs is that specific parasite surface proteins expressed by mosquito stage plasmodium are used as antigens to stimulate the organism to produce specific antibodies against mosquito stage plasmodium surface proteins. When the mosquito inhales the immunized human blood, the specific antibody of the surface protein of the plasmodium in the anti-mosquito stage is specifically combined with the plasmodium developing in the midgut of the mosquito, and further the further development of the plasmodium in the mosquito body is blocked. Thus, TBVs can block anopheles transmission of plasmodium from one host to another.

TBVs candidate antigens are expressed predominantly in the sexual reproduction stage of plasmodium, i.e., the gametophytic to zygotic development stage. At present, TBVs candidate antigens found by research are very limited, such as P230, P48/45, P25 and P28. However, specific antibodies induced by candidate antigens of several plasmodium sexual stage vaccines cannot achieve a satisfactory transmission blocking effect. Therefore, the key strategy for malaria prevention and control is urgent need to screen and increase novel plasmodium sexual stage candidate antigens and prepare recombinant proteins, so as to provide effective targets for the subsequent development of efficient and safe TBV vaccines.

Disclosure of Invention

In view of the above problems, the present invention aims to provide a recombinant protein of plasmodium berghei gametophyte (rPbG37), a preparation method thereof and an application thereof in malaria transmission blocking.

In order to achieve the above object, the present invention provides the following embodiments.

The amino acid sequence of the recombinant protein (rPbG37) of the gametophyte of the plasmodium brevicompactum is SEQ ID NO: 1; or an amino acid sequence which has 95 to 100 percent of homology with the amino acid sequence defined by the sequence SEQ ID No.1 and encodes the same functional protein; or a protein derived from the amino acid sequence shown in SEQ ID No.1 by adding, deleting or replacing one or more amino acids and having the same activity. The recombinant protein for coding the gametophyte of the plasmodium burgeri synthesized has 63 amino acids, is positioned at the 26 th to 88 th amino acid residue positions of PbG37 full-length protein, and has the amino acid sequence of SEQ ID No. 1: Lys-Gln-Asp-Val-Tyr-Leu-Asp-Asp-Glu-Phe-Lys-Ser-Phe-Thr-Phe-Phe-Phe-Ala-Ser-Pro-Ser-Ala-Asn-Phe-Leu-Ser-Arg-Ile-Val-His-Ser-Asn-Glu-Ala-Lys-Phe-Thr-Gln-Ile-Lys-Asn-Lys-Thr-Asp-Ile-Trp-Asn-Lys-Thr-Ile-Asp-Lys-Ala-Tyr-Ser-Ile-Asn-Gln-Val-Ser-Asn-Asn.

The invention also provides a gene for coding the recombinant protein of the plasmodium berghei gametophyte, and a recombinant expression vector containing a gene pair for coding the recombinant protein also belongs to the scope of the invention, wherein the recombinant expression vector consists of a gene prokaryotic expression vector containing the recombinant protein blocked by malaria transmission, and the prokaryotic vector is a pET-32a expression vector.

The nucleotide for coding the recombinant protein is 189bp, and the nucleotide sequence is SEQ ID NO: 2: AAACAGGATG TTTATTTGGA TGATGAATTC AAAAGTTTCA CGTTTTTTTT TGCTTCTTCC CCATCGGCTAATTTTTTGTC CCGGATTGTC CATAGCAATG AAGCGAAATT TACCCAAATA AAAAACAAAA CAGATATATGGAACAAAACA ATAGACAAAG CATACTCAAT TAATCAGGTT TCAAATAAT are provided.

Preferably, the recombinant expression vector is an Escherichia coli DH-5 α expression strain.

In order to achieve the above object, the present invention also provides a preparation method of the above recombinant protein, which comprises the steps of primer design, target gene amplification, recombinant expression vector construction, recombinant protein expression and purification.

The application of the recombinant protein PbG37 of the gametophyte of the plasmodium brevicompactum in preparing a vaccine for blocking malaria transmission.

The invention has remarkable effect.

The invention aims to provide a novel recombinant protein with a transmission blocking effect through the analysis of bioinformatics and the experimental verification of molecular biology so as to further improve the transmission blocking effect of malaria.

The recombinant protein is obtained by carrying out bioinformatics analysis on plasmodium brevium, predicting a surface protein expressed by a gametophyte, designing a truncated fragment, carrying out induced expression and purification in escherichia coli, carrying out animal immunization, obtaining immune serum, and verifying the transmission blocking effect of the immune serum. In order to further determine the functions of the antibodies, corresponding antibodies and gene knockdown strains are prepared, and the transmission blocking effect of the antibodies and the gene knockdown strains is determined through functional experiments.

It should be clear that one skilled in the art can obtain a mutant sequence of the protein by substituting, lacking and/or adding one or more amino acids to the amino acid sequence of SEQ ID No.1 disclosed in the invention without affecting the biological activity of the protein, wherein the protein has an alignment homology of more than 95%. Therefore, the invention also comprises a derivative protein which has high homology, biological activity and the same function by substituting, lacking and/or adding one or more amino acids to the amino acid sequence shown in SEQ ID No. 1. The invention also provides a gene targeting technology for knocking out the plasmodium burgeri gametophyte protein (PbG37) to obtain the insect strain delta pbg 37. The recombinant targeting vector containing homologous arms at both sides of the target gene of the recombinant protein is inserted into the homologous arms at both sides of the target gene respectively, and the hDHFR drug-resistant gene is contained for screening positive clone insect strains. The targeting vector is a PL0034 expression vector. The invention also provides an Escherichia coli TG1 strain containing the recombinant targeting vector.

The invention firstly screens the gametophyte protein of the Plasmodium berghei (Plasmodium berghei Gametocyte 37, PbG37, PBANKA _060330) in a molecular biological mode. And determining the structural characteristics of PbG37 gene expressed by plasmodium in sexual reproduction stage. PbG37 is a conserved membrane protein with the molecular weight of 40207Da, has a signal peptide, two low-degree complex regions and seven transmembrane regions, and is highly homologous with other plasmodium strains. Then, a prokaryotic expression system is used for successfully expressing and purifying the soluble recombinant protein rPbG37, and immune serum is obtained after animal immunization. PbG37 is located by using the serum, and a new theoretical and experimental basis is provided for further functional research. Then PbG37 is knocked out by using a gene targeting technology to obtain pbg37 gene knockout type plasmodium strain delta pbg37, and detailed phenotype and biological function research is carried out on the delta pbg37, so that the influence of pbg37 genes on the life history of plasmodium is determined; and immune serum obtained by using the previously prepared recombinant protein rPbG37 identifies the biological function and the transmission blocking effect of PbG37, and lays a foundation for the development of malaria vaccines.

The gene targeting technology is based on the principle that living cell genome DNA can be homologously recombined with a homologous sequence of exogenous DNA, and a preselected gene is modified at a fixed point to change a specific gene in the genome. The technology has the advantages that the exogenous gene can be introduced into a specific segment of plasmodium genomic DNA, the target gene is knocked out in a targeted mode, and the targeted introduced gene is stably replicated along with the replication of the genomic DNA, so that the function of a specific gene can be studied in vivo, and the function of a corresponding protein of plasmodium can be analyzed in vivo. The experimental procedures of the whole life cycle of the mouse malaria can be manually operated, and the method has obvious usability. The genome of murine malaria has about 80% homology with the genome of human malaria, so that the biological action of the corresponding target gene in human malaria is widely applied by knocking out the target gene in murine malaria and determining the biological function of the target gene.

Drawings

FIG. 1 is a graph showing the results of bioinformatic analysis of PbG37 protein.

FIG. 2 shows the restriction enzyme identification of recombinant plasmid pET32a-PbG 37.

FIG. 3 shows the SDS-PAGE result of the recombinant protein rPbG 37.

FIG. 4 shows the antibody titer levels of antiserum raised against the recombinant protein rPbG37 detected by Elisa.

FIG. 5 shows the specificity of antibody in antiserum measured by Western Blot to identify PbG37 localization stage.

FIG. 6 shows the IFA detection of the ability of an antibody in antisera to recognize a native antigen, identifying PbG37 the localization phase.

FIG. 7 is a schematic diagram of the construction of a knockout vector.

FIG. 8 shows the results of PCR for identifying the knockout genotype.

FIG. 9 shows the identification of phenotype after gene knock-out.

FIG. 10 shows the in vitro and in vivo transmission blocking effect of antiserum obtained by immunizing mice with the recombinant protein rPbG 37.

Detailed Description

The following is a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications can be made without departing from the scope of the present invention, and these modifications are also within the scope of the present invention.

Firstly, testing materials.

1.1 strains and plasmids E.coli DH5 α, M15 and TG1 (from Changchang, Beijing ancient China), E.coli Escherichia coli Rosetta-gami B (DE3) (from Hangzhou Fenghai science and technology Co., Ltd.), prokaryotic expression vector pET32a and targeting vector PL0034 (from Clontech).

1.2 insect strains: p. berghei (p. berghei) (ANKA strain 2.34) was obtained at university of japanese girl of love.

1.3 animals: clean-grade BALB/c mice were purchased from Weitongli, Beijing.

1.4 primer Synthesis service is provided by Shenzhen Hua Daizhi Co.

1.5 Primary reagents and instruments.

The main reagents are as follows: tryptone and yeast extract were obtained from Oxoid, sodium chloride from DM, genome extraction kit from TaKaRa, plasmid extraction kit and gel recovery kit from Tiangen Biochemical technology Ltd, DNA polymerase and Ligation High ligase from TOYOBO, restriction enzymes from NEB, Ni-NTA as Novagen, dialysis bag with minimum cut-off molecular weight of 3500Da from Millipore, HRP-labeled secondary antibody from Beijing Dingguo, murine Alexa-488 fluorescent secondary antibody from Invitrogen, pyrimethamine from Sigma, and quantification kit from Biyun Biotech research institute.

The main instruments are as follows: horizontal and vertical electrophoretics (Shanghai Tianneng technologies, Inc.), enzyme-linked instruments (Thermo, Multiskan MK3), high-speed centrifuges (HITACHI, CR22G III).

The present invention will be described in detail with reference to specific examples.

Example 1.

Determination of malaria transmission blocking vaccine candidate antigen PbG37 and preparation of recombinant protein thereof.

1. The structural features and functions of PbG37 are identified and predicted using molecular bioinformatics techniques.

PbG37(PBANKA _060330) gene is described in the Plasmodium database as a "conserved Plasmodium protein, unknown in function". SMART analysis shows that PbG37 protein contains a signal peptide, two low-complexity regions and seven transmembrane regions, in order to express soluble protein, we obtained a fragment by screening in a B cell epitope-enriched region avoiding the signal peptide and the transmembrane regions, namely 26 th to 88 th amino acid residues from the N terminal, and the total 63 amino acid residues are used as the amino acid sequence of rPbG37 designed by the invention, as shown in figure 1, the protein has a signal peptide, two low-complexity regions and seven transmembrane regions, and the 26 th to 88 th amino acid is the amino acid sequence expressed by the invention.

2. Construction of recombinant protein expression vector pET32a-PbG 37.

2.1 extraction of Plasmodium genomic DNA.

6-8 week female BALB/c mice intraperitoneal injection of 200. mu.l phenylhydrazine (6mg/mL), three days later mice intraperitoneal infection of 1 × 10⁷Detecting malaria blood from the fourth day of infection of red blood cells infected by berghei, and when the malaria blood reaches about 30%, performing anticoagulant taking on heart blood by using heparin sodium, and extracting P. berghei plasmodium genome DNA according to the instruction of a blood genome DNA Extraction Kit TaKaRa DNA Extraction Kit; measuring the extracted DNAAfter concentration, the cells were stored at-20 ℃.

2.2 primer design synthesis.

Primers are designed aiming at a prokaryotic expression vector pET32a (+) by using Primer Premier5 software, restriction enzyme BamHI and NotI restriction sites are respectively introduced into the 5' ends of the upstream and downstream primers, and the sequences of the primers are as follows.

PbG37-F(SEQ ID NO：3)：CTGGATCCAA ACAGGATGTT TATTTGGATG AT。

PbG37-R(SEQ ID NO：4)：CAGCGGCCGC ATTATTTGAA ACCTGATTAA TTGAGT。

2.3 PCR amplification of the target gene.

The primers were diluted and gene fragments were amplified using P.berghei genomic DNA as template and PbG37-F and PbG37-R as primers.

The PCR reaction system specifically comprises: mu.l of 10. mu.M primer PbG 37-F1.5. mu.l, 10. mu.M primer PbG 37-R1.5. mu.l, 2mM dNTPS 5. mu.l, 10 Xbuffer 5. mu.l, 25mM magnesium sulfate 3. mu.l, genomic DNA template 1. mu.l, DNA polymerase 1. mu.l, and ultrapure water to 50. mu.l.

The PCR reaction program is 2min at 98 ℃ to 10sec at 98 ℃, 30sec at 56 ℃, 1min at 68 ℃ and 5min at 35 cycles to 68 ℃.

2.4 recovery of PCR product.

And (3) carrying out agarose gel electrophoresis on the PCR amplification product, cutting off a target gene fragment, and recovering the PCR product according to the operation instruction of the DNA purification kit.

2.5 construction of pET32a-PbG37 vector.

Cloning the obtained recovered product into a pMD18-T vector, transforming host bacteria DH-5 α, identifying positive clones by adopting a thallus PCR method, selecting the positive clones, extracting plasmids, sending the plasmids to a Huada gene company for sequencing, comparing sequencing results by a BLAST tool in an NCBI database, carrying out double enzyme digestion reaction on the plasmids with correct sequencing results and the pET32a vector by using restriction endonucleases BamHI and NotI under the condition of reaction at 37 ℃ for 2h, and recovering and purifying the DNA fragments and the vectors after enzyme digestion.

The enzyme digestion reaction system specifically comprises: PCR product 35. mu.l, BamHI 1. mu.l, Not I1. mu.l, 10 Xdigestion buffer 5. mu.l, ultrapure water 8. mu.l.

pET32a vector restriction system: pET32a 20, 20. mu.l, BamHI 1. mu.l, Not I1. mu.l, 10 Xdigestion buffer 5. mu.l, and ultrapure water 23. mu.l.

Connecting the recovered fragments with a pET32a vector by using Ligation High ligase, connecting for 1h at 16 ℃, transforming the connected product into a host bacterium TG1, identifying positive clones by adopting a thallus PCR method, selecting the positive clones to extract plasmids, preserving strains after double enzyme digestion identification, and referring to figure 2, wherein a lane 1 is a DNA nucleotide size standard (DNA Marker); lane 2 shows the cleavage of plasmid pET32a-PbG 37. The plasmid after enzyme digestion is 5866bp, the target gene fragment is 189bp, and the result is consistent with the expected result.

The linking system is as follows: 9. mu.l of PCR product Bam HI and NotI double-restriction enzyme-cleaved fragments, 1. mu.l of pET32a plasmid Bam HI, NotI double-restriction enzyme-cleaved products, and 10. mu.l of Ligation High.

3. Protein expression, purification and identification.

Selecting a positive colony identified correctly by enzyme digestion, shaking the colony overnight at 37 ℃, extracting a plasmid and transforming the plasmid into a prokaryotic expression strain Escherichia coli Rosetta-gami B (DE 3); taking the successfully transformed bacterial liquid, transferring the successfully transformed bacterial liquid to a fresh LB culture medium according to the proportion of 1:100, shaking the bacterial liquid at 37 ℃ for 2 hours, and then measuring the OD value of the bacterial liquid; when OD value reaches 0.6-0.8, adding IPTG to the final concentration of 1.0mM, and inducing at 20 ℃ for 8 h; centrifuging at 10000rpm for 10min to collect bacteria; adding 1 xNi-NTA binding buffer solution into the thalli for resuspension, carrying out ultrasonic lysis on the thalli (ultrasonic for 2s, interval for 3s, whole time for 30min, ice), centrifuging for 5min at 12000r/min at the temperature of 4 ℃, taking a supernatant sample, and adding the supernatant sample into a 5mL 50% nickel-nitrilotriacetic acid agarose column Ni-NTA His-Bind Superflow to purify protein; putting the purified protein into a dialysis bag, performing gradient dialysis in a PBS buffer solution containing imidazole at 4 ℃, and dissolving the final product in a pure PBS buffer solution; the purification was successfully demonstrated by 10% polyacrylamide gel electrophoresis (molecular weight of the target protein rPbG37 is about 27.9kDa), as shown in FIG. 3, in which lane M is a protein molecular weight standard (protein Marker); lane rPbg37 is a purified His-tagged recombinant protein with a molecular weight of 27.9kDa, and the resulting protein size was consistent with that expected.

Example 2.

Immune serum preparation and protein localization.

1. And (4) preparing immune serum.

6-8 week old BALB/c female mice 10 mice, divided into 2 groups, each group of 5 mice. Group 1 was injected with the recombinant protein prepared in example 1, and group 2 was a PBS control group. The purified recombinant protein (50. mu.g/mouse) was ground into a water-in-oil emulsion with Freund's complete adjuvant, and 100. mu.l/mouse was immunized by subcutaneous injection. Two boosts were administered at week 3 and week 5, respectively, and 25. mu.g of recombinant protein was ground with Freund's incomplete adjuvant to a water-in-oil emulsion, and 100. mu.l/mouse was injected subcutaneously to immunize mice. And (3) collecting mouse serum 10 days after the third immunization, detecting the level of the specific antibody of the mouse serum by ELISA, wherein the level of the antibody is obviously increased (p is less than 0.01) compared with that of a PBS immune group, the antibody titer exceeds 1:64000, and the antibody titer reaches 1:64000 shown in figure 4, thereby proving that the recombinant protein has stronger antigenicity.

Determination of the expression phase of PbG 37.

2.1 Western Blot to identify the expression stage of PbG 37.

The purified merozoites, gametophytes and ookinetes were lysed with 0.15% saponin to remove erythrocytes with a purity of 80% or more, and lysed with a lysis solution (1% Triton X-100, 2% SDS, dissolved in PBS, containing protease inhibitor) for 30 min. 5X 10⁷Lane plasmodium was separated by 10% SDS-PAGE electrophoresis. After the electrophoresis is finished, the membrane is rotated for 3 hours at the constant pressure of 60V at 4 ℃. Blocked overnight at 4 ℃ with 5% skimmed milk powder (TBS solution). TBST (0.1M TBS, pH 7.4, 0.02% Tween 20) was rinsed three times for 5min each. TBST dilution anti-rPbG 37 murine serum (1:500) was combined with PVDF membrane for 3h at room temperature. Mouse anti-rPbHSP 70 protein serum (1:500) was used as a positive control. PVDF membrane was washed three times with TBST, 5min each time. HRP-labeled goat anti-mouse IgG (1:5000) was diluted with TBST and the PVDF membrane was incubated at room temperature for 2 h. TBST was washed three times and detected in a fluorescent image analysis system using ECL luminescence. The results showed a specific band at about 27.9kDa in the gametophyte, zygote and zygote stages, i.e., the anti-rPbG immune serum recognized the protein expressed in the gametophyte, zygote and zygote stages, see FIG. 5, where lane Sch is the merozoite antigen, lane Gam is the gametophyte antigen, lane Zyg is the zygote antigen, and the electrophoresis is performed in the gametophyte, zygote and zygote stagesLane Ook is an ookinete antigen; hsp70 was used as a positive control to quantify the loading of protein. There was no specific band in the merozoite antigen lane, and there was a specific band at around 37.5kDa in the gametophyte, zygote and zygote antigen lanes, demonstrating that PbG37 was expressed predominantly in the sexual stage of Plasmodium.

2.2 IFA identifies the expression stage of PbG 37.

After the purified plasmodium at each stage is washed once by PBS, 4% paraformaldehyde is fixed for 20min at room temperature, and cells are subjected to membrane penetration for 10min with or without 0.1% Triton X-100. After rinsing with 50mM glycine/PBS, the cells were blocked with 5% skim milk powder in PBS for 30min at 37 ℃. anti-rPbG 37 immune serum or anti-Pbs 21 monoclonal antibody (positive control) was added at a 1:500 dilution and incubated at 37 ℃ for 2 h. Goat anti-mouse Alexa-488 fluorescent secondary antibody (1:500 dilution) was added as a stock and incubated at 37 ℃ for 60 min. Staining with DAPI for 30min, and performing anti-quenching sealing agent

Gold antimade reagent mounting, fluorescence microscope observation results, Adobe Photoshop analysis, and results show that immune serum resisting rPbG37 can recognize gametophyte, gamete, zygote, immature zygote and mature zygote cell surface antigen, and indicate that PbG37 is mainly expressed on the surface of sexual reproduction stage of plasmodium, as shown in figure 6, the stages of the plasmodium mainly comprise: female and male gametophytes, zygotes, immature zygotes and mature zygotes; pbs 21-labeled zygotes were used as positive controls; control is a negative Control of a serum-labeled ookinete immunized with PBS. BF is bright field, FITC is green fluorescence, DAPI is nuclear staining, and Merge is a composite image of FITC and DAPI. There is no green fluorescence at the schizont stage, and there is green fluorescence at the female and male gametophytes, female and male gametes, zygotes, immature zygotes, and mature zygotes stages. PbG37 was shown to be expressed primarily in the sexual stage of plasmodium.

Example 3.

Construction of targeting vector and obtaining of delta pbg37 plasmodium.

1. And (3) constructing a targeting vector for gene knockout.

Pbg37 gene is knocked out in a targeted mode by using a double-cross homologous recombination method, and a gene-knocked-out targeting vector is successfully constructed. According to the vector construction flow chart shown in figure 7, PbG37 is a target gene, 5 'UTR and 3' UTR are homologous arms at two sides of the target gene, and P1, P2, P3, P4 and P5 are designed primers for identifying gene knockout genotypes.

Firstly, successfully amplifying a 5 'UTR fragment by using a PCR method, wherein the amplification length is 699bp, and restriction enzyme Hind III and PstI restriction enzyme sites are respectively introduced into the 5' ends of an upstream primer and a downstream primer; the primer sequences are as follows: pbg37-5U-F (SEQ ID NO: 5): CCCAAGCTTG TGTTGAAAAT GCTATCGAAA T, respectively; pbg37-5U-R (SEQ ID NO: 6): AACTGCAGAAAGACCTTTGG ATGATTTG; plasmid PL0034-pbg37-5U was constructed from 5' UTR and PL0034 vectors by HindIII and PstI double digestion.

Subsequently, a 3 'UTR fragment is successfully amplified, the amplification length is 578bp, and restriction enzyme XholI and NotI restriction enzyme sites are respectively introduced into the 5' ends of the upstream primer and the downstream primer. The primer sequences are as follows: pbg37-3U-F (SEQ ID NO: 7): CCGCTCGAGAAGTAAAAGCC AGGGAATGA, respectively; pbg37-3U-R (SEQ ID NO: 8): CAGCGGCCGC CATTATAGCAGTTGCCGATC; the 3' UTR and PL0034-pbg-5U are subjected to double enzyme digestion by XholI and Not I to construct recombinant plasmid PL0034-pbg 37-5U-3U.

The recombinant plasmid is sequenced by a company, and the sequencing result is consistent with the published sequence of a plasmodium website of Plasmodib.

P. berghei schizont culture and isolation.

P. berghei infected phenylhydrazine treated BALB/c mice, when the infection rate reached 5-10%, ether anesthetized mice, heart blood was collected and blood was placed in schizont medium (RPMI 1640 containing 20% (v/v) Fetal Bovine Serum (FBS),50mg/l penicillin and streptomycin, 50mL medium/0.5 mL blood), cultured at 37 ℃ for 16 hours at 100 rpm. The culture was centrifuged with 55% Nycodenz density gradient, the intermediate grey-white layer schizonts were collected, washed 2 times with PBS, and l μ l was stained with Giemsa and the content and purity of schizonts were counted under the light microscope.

3. Preparation, screening and identification of gene knockout plasmodium delta pbg 37.

PL0034-pbg37-3U-5U targeting plasmid was extracted in bulk and digested with HindIII and Not I to completely linearize the plasmid. The purified linearized plasmid was electroporated into purified schizonts and injected via tail vein into mice. Pbg37 gene is replaced by hDHFR and yfcu gene of drug pressure selection marker in PL0034 carrier, that is, pbg37 gene is completely knocked out by homologous recombination double crossing method. 24h after the plasmodium was electrotransfected with the linearized plasmid, mice were given pyrimethamine (0.07mg/mL) in drinking water for drug screening. Taking tail vein blood from day 6, preparing a blood sheet, observing and monitoring whether plasmodium appears in peripheral blood or not under a Giemsa staining optical microscope, taking a small amount of tail blood to carry out PCR identification on the genotype of the peripheral blood after the plasmodium is found, and designing PCR identification primers as follows: p1 and P2 amplified are wild type; the primers P1 and P3 amplify sequences which are successfully recombined by 5' UTR homologous; primers P4 and P5 amplified sequences that were successful in homologous recombination of the 3' UTR. The sequence is as follows:

P1(SEQ ID NO：9)：GGAAGGTATT AAGCAAGGGG。

P2(SEQ ID NO：10)：ATCATCCAAA TAAACATCCT GT。

P3(SEQ ID NO：11)：CTGGTGCTTT GAGGGGTGAG。

P4(SEQ ID NO：12)：TTTTTCCTTC AATTTCGGG。

P5(SEQ ID NO：13)：TAAGTTTGAG ATGCCCCTGC。

after PCR identification of the recombinant plasmodium-containing genotypes, when the malaria hematopathy reaches 1-3%, the tail vein of the mouse is bled, and the blood of the mouse is diluted by physiological saline, wherein the final dilution amount is 1 iRBC/100 mu l. The diluted Plasmodium was cloned by tail vein injection into 10 BALB/c mice (100. mu.l/mouse). Mice were drunk with pyrimethamine water, peripheral blood was monitored for the presence of drug-resistant strains on day 6 after infection, and the results of identifying PCR by PCR of mouse tail blood after infection with plasmodium showed that we succeeded in knocking out pbg37 genes, see FIG. 8, WT and Δ pbg37 are genomes of wild-type plasmodium and knocked-out plasmodium, respectively, wherein P1 and P2 amplify wild-type genotypes (1902bp), P1 and P3 amplify genotypes (1828bp) successful in 5 'UTR recombination, and P4 and P5 amplify genotypes (1552bp) successful in 3' UTR recombination. The PCR result shows that the gene knockout is successful.

Example 4.

Knock-out plasmodium delta pbg37 phenotype and function analysis.

6-8 week-old female BALB/c mice were divided into two groups of 5 mice each, and the mice treated with phenylhydrazine were infected with 5X 10 mice, respectively⁶A population of Δ pbg37 or wild-type plasmodium, was initially evaluated for malaria blood, gametophytic blood to male and female gametophytic ratio, on day three post-infection. Meanwhile, 10 mul of blood is taken from tail vein and placed in 40 mul of animal zygote culture solution, plasmodium is cultured for 15min at 25 ℃, and gamete filament output number is observed by a common microscope within 10 min. The cultures were further incubated at 19-20 ℃ for 24h, the cultures were labeled with anti-Pbs 21 antibody and goat anti-mouse Alexa-488 fluorescent secondary antibody, and the zygotes, immature zygotes and mature zygotes were counted under a fluorescent microscope. On the third day after infection, the mice suck blood for 30min by anopheles mosquitoes hungry for 12h, at least 30 anopheles mosquitoes are used for each group of the experimental group and the control group, the anopheles mosquitoes after blood suction are dissected on the 14 th day, and the number of oocysts on the walls of the stomachs of the mosquitoes and the infection rate of the mosquitoes are counted. There was no significant difference in the erythrocyte infection rate of the delta pbg37 type plasmodium compared to the Wild Type (WT) plasmodium, suggesting that PbG37 did not play a significant role in the asexual stage of plasmodium, consistent with PbG37 not being expressed in the schizont stage. The delta pbg37 type plasmodium had 70.8% lower gametophemia than the wild type, and the male-female gametophyte ratio was changed to 6:1, suggesting a significant reduction in male gametophytes. The yield of the delta pbg37 gametophyte of the knockout strain delta pbg37 plasmodium is obviously reduced by 36 percent (p) under the condition that the delta pbg37 plasmodium and the wild plasmodium contain equal amount of male gametophyte<0.01); the number of mobile zygotes is reduced by 45% (p)<0.01). After the anopheles sinensis is infected by delta pbg37 type plasmodium, the number of oocysts is reduced by 90.4 percent compared with the wild type (p)<0.01), the mosquito infection rate decreased by 23.8%, and the difference was statistically significant, as shown in fig. 9. In FIG. 9, a is gametophyte rate, b is male-female gametophyte ratio, c is male gametophyte silk output number, d is in vitro culture zygote, immature zygote and mature zygote number, and e is mosquito stomach wall oocyst number. The results show that after gene knockout, the gametophyte rate is reduced, the proportion of male and female gametophytes is increased, and the silk output, the formation number of ookinetes and the formation number of oocysts of male gametophytes are reduced. Gene knockout of plasmodium and wild-type plasmodiumThe number of oocysts and the mosquito infection rate are shown in table 1. The result shows that the number of oocysts is obviously reduced after gene knockout, and the mosquito infection rate is also obviously reduced.

Table 1 number of oocysts formed in mosquito stomach wall and mosquito infection rate of knockout strain Δ pbg 37.

Thus, PbG37 is crucial to the emergence of male gametes, the development of zygotes, and the formation of oocysts.

Example 5.

anti-rPbG 37 antibody was evaluated for transmission blocking effect.

1. In vitro propagation blocking-inhibition of gametophyte filament yield and ookinete formation rate.

BALB/c female mice were intraperitoneally injected with 1X 10⁶Berghei infected erythrocytes, infection day 3, tail vein blood sampling to detect gametocyte silk output, taking 10 μ l of blood to place in 90 μ l of animal zygote culture solution, adding diluted recombinant protein/control immune mouse serum (1:5/1:10/1:50), culturing at 25 ℃ for 15min, and observing gametocyte silk output number within 10min by using a common microscope. The culture medium was further incubated at 19-20 ℃ for 24h, and the cultures were labeled with anti-Pbs 21 antibody and goat anti-mouse Alexa-488 fluorescent secondary antibody and observed for the rate of formation of the mobile zygotes under a fluorescent microscope. The rPbG37 immune serum was co-cultured with Plasmodium to reduce both gametophyte filament output and zygote formation in an antibody dose-dependent manner. Compared with the control group, when the animal zygote culture solution contains 1:5,1:10 and 1:50 immune serum respectively, the gametophyte silk yield is reduced by 70 percent, 65 percent and 60 percent respectively (p is<0.05); the formation rates of mobile zygote are reduced by 71%, 58% and 52% (p) respectively<0.05) indicating that rPbG37 immune serum can significantly block gametophyte filament and zygote formation in an antibody dose-dependent mode, see FIG. 10, a for the ability of antiserum to block male gametophyte filament at dilutions of 1:5,1:10 and 1:50, and b for the ability of antiserum to block zygote formation at dilutions of 1:5,1:10 and 1: 50.

2. In vivo propagation blocking-direct membrane chromatography experiments.

Mice immunized with rPbG37/PBS were injected intraperitoneally at 1X 10 days after immunization⁶P. berghei infected erythrocytes, day 3 of infection, tail vein blood sampling to detect gametocyte silking, sucking mouse blood with at least 50 anopheles mosquitoes for 30min, and checking the number of oocyst formation on the stomach wall of the mosquito on day 14 after blood sucking, see c in fig. 10. The results of table 2 show that the formation amount of oocysts in the mosquito stomach wall of the recombinant protein immunized group is reduced by 49.1% and the infection rate of mosquitoes is reduced by 9.2% compared with the control group.

Table 2: rPbG37 immunizes mice with the formation amount of oocysts in the stomach wall of the mosquito and the infection rate of the mosquito.

The examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Sequence listing

<110> university of Chinese medical science

<120> a recombinant protein of plasmodium berghei gametophyte (rPbG37), its preparation method and application in malaria transmission blocking

<160>13

<210>1

<211>63

<212>PRT

<213> Artificial Synthesis

<400>1

Lys Gln Asp Val Tyr Leu Asp Asp Glu Phe Lys Ser Phe Thr Phe Phe Phe Ala Ser Ser

1 5 10 15 20

Pro Ser Ala Asn Phe Leu Ser Arg Ile Val His Ser Asn Glu Ala Lys Phe Thr Gln Ile

21 25 30 35 40

Lys Asn Lys Thr Asp Ile Trp Asn Lys Thr Ile Asp Lys Ala Tyr Ser Ile Asn Gln Val

41 45 50 55 60

Ser Asn Asn

61 63

<210>2

<211>189

<212>DNA

<213> Artificial Synthesis

<400>2

aaacaggatg tttatttgga tgatgaattc aaaagtttca cgtttttttt tgcttcttcc ccatcggcta 70

attttttgtc ccggattgtc catagcaatg aagcgaaatt tacccaaata aaaaacaaaa cagatatatg 140

gaacaaaaca atagacaaag catactcaat taatcaggtt tcaaataat 189

<210>3

<211>32

<212>DNA

<213> Artificial Synthesis

<400>3

ctggatccaa acaggatgtt tatttggatg at 32

<210>4

<211>36

<212>DNA

<213> Artificial Synthesis

<400>4

cagcggccgc attatttgaa acctgattaa ttgagt 36

<210>5

<211>31

<212>DNA

<213> Artificial Synthesis

<400>5

cccaagcttg tgttgaaaat gctatcgaaa t 31

<210>6

<211>28

<212>DNA

<213> Artificial Synthesis

<400>6

aactgcagaa agacctttgg atgatttg 28

<210>7

<211>29

<212>DNA

<213> Artificial Synthesis

<400>7

ccgctcgaga agtaaaagcc agggaatga 29

<210>8

<211>30

<212>DNA

<213> Artificial Synthesis

<400>8

cagcggccgc cattatagca gttgccgatc 30

<210>9

<211>20

<212>DNA

<213> Artificial Synthesis

<400>9

ggaaggtatt aagcaagggg 20

<210>10

<211>22

<212>DNA

<213> Artificial Synthesis

<400>10

atcatccaaa taaacatcct gt 22

<210>11

<211>20

<212>DNA

<213> Artificial Synthesis

<400>11

ctggtgcttt gaggggtgag 20

<210>12

<211>19

<212>DNA

<213> Artificial Synthesis

<400>12

tttttccttc aatttcggg 19

<210>13

<211>20

<212>DNA

<213> Artificial Synthesis

<400>13

taagtttgag atgcccctgc 20

Claims (1)

1. The application of the recombinant protein PbG37 of the gametophyte of the plasmodium bereudii in preparing the malaria transmission blocking vaccine is characterized in that the amino acid sequence of the recombinant protein is SEQ ID NO: 1.

Images