CN107164554B

CN107164554B - Application of ASPRV1 as biomarker in diagnosis and treatment of laryngeal squamous cell carcinoma

Info

Publication number: CN107164554B
Application number: CN201710593760.1A
Authority: CN
Inventors: 常鹏; 台德强
Original assignee: Qingdao Yangshen Biomedical Co Ltd
Current assignee: Qingdao Yangshen Biomedical Co Ltd
Priority date: 2017-07-20
Filing date: 2017-07-20
Publication date: 2020-03-31
Anticipated expiration: 2037-07-20
Also published as: CN107164554A

Abstract

The invention discloses application of ASPRV1 as a biomarker in diagnosis and treatment of laryngeal squamous cell carcinoma, and the invention discovers that ASPRV1 is up-regulated in laryngeal squamous cell carcinoma tissues through a high-throughput sequencing technology, further verifies that the gene and protein expressed by the gene are significantly and highly expressed in laryngeal squamous cell carcinoma patients through experiments, and prompts that ASPRV1 can be used as a diagnostic marker in clinical diagnosis of laryngeal squamous cell carcinoma. In-vitro cell experiments further prove that the change of the expression level of ASPRV1 can inhibit the proliferation, migration and invasion of cells, and the ASPRV1 can be used as a possible potential target to be applied to the clinical treatment of laryngeal squamous cell carcinoma.

Description

Application of ASPRV1 as biomarker in diagnosis and treatment of laryngeal squamous cell carcinoma

Technical Field

The invention belongs to the field of biological medicines, and relates to application of ASPRV1 as a biomarker in diagnosis and treatment of laryngeal squamous cell carcinoma.

Background

Laryngeal carcinoma is one of the most common malignant tumors in ear, nose, throat, head and neck surgery, and accounts for 5.7% -7.6% of the cancers of the whole body. Between 96% and 98% of laryngeal cancers are squamous cell carcinomas, other pathological types such as: adenocarcinoma and sarcoma are less common. Laryngeal carcinoma develops well in the ages of forty to sixty years, with most male patients. In recent years, the economic efficiency has been gradually improved, the living environment has been deteriorated, the life style of people has been changed, and the incidence of laryngeal cancer has been gradually increased. The surgical resection of the tumor is the first choice for the treatment of the laryngeal cancer, and the cooperation of radiotherapy, chemotherapy, gene targeting therapy and the like is added, so that the 5-year survival rate and the recovery of the laryngeal function of patients with the laryngeal cancer are greatly improved, but the treatment effect of patients with the advanced laryngeal cancer is not ideal, once the patients are accompanied by cervical lymph node metastasis, the 5-year survival rate is 50 percent, the tumor metastasis to the distant place is only about 20 percent. In recent decades, the diagnosis concept of laryngeal cancer has changed greatly, and the choice of the diagnosis scheme depends on the stage of the disease. The causes of laryngeal cancer are still unclear, because they are related to poor lifestyle habits (smoking and drinking), adult laryngeal papilloma virus, long-term exposure to radiation, deficiency of some trace elements, and the like. Therefore, how to elucidate the occurrence and development mechanism of laryngeal squamous cell carcinoma on a molecular level and search for an ideal molecular marker for early diagnosis of laryngeal carcinoma patients is very important for the prognosis effect of the treatment.

With the development of biological technology, the appearance of high-throughput technology provides a more comprehensive and rapid analysis means for the research of disease pathogenesis, and a new way is provided for realizing accurate treatment of diseases by adopting a high-throughput sequencing technology combined with bioinformatics analysis, searching important genes related to the occurrence and development of diseases and combining with directional biological experiments.

Disclosure of Invention

In order to make up for the defects of the prior art, the invention aims to provide a biomarker related to occurrence and development of laryngeal squamous cell carcinoma, whether a patient has laryngeal squamous cell carcinoma or has the risk of laryngeal squamous cell carcinoma can be judged by detecting the expression level of the biomarker in a sample, and accurate targeted therapy of the laryngeal squamous cell carcinoma patient can be realized by targeting the biomarker and changing the expression level or activity of the biomarker.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides application of a reagent for detecting ASPRV1 in preparation of a product for diagnosing laryngeal squamous cell carcinoma.

Further, the reagent for detecting ASPRV1 comprises: the reagent for detecting the expression level of ASPRV1 gene in the sample is prepared by sequencing technology, nucleic acid hybridization technology, nucleic acid amplification technology or immunoassay.

Further, the agent is selected from:

a probe that specifically recognizes ASPRV1 gene; or

Primers for specifically amplifying ASPRV1 gene; or

An antibody or ligand that specifically binds to a protein encoded by ASPRV 1.

Further, the reagent at least comprises a pair of primers for specifically amplifying ASPRV1, and in a specific embodiment of the invention, the sequence of the primer for specifically amplifying ASPRV1 gene is shown as SEQ ID No. 3-4.

In the present invention, any method may be used to detect the expression level of ASPRV 1.

The invention provides a product for diagnosing laryngeal squamous cell carcinoma, which comprises a preparation, a chip or a kit for detecting the expression level of ASPRV1 in a sample, wherein the chip comprises a gene chip and a protein chip; the gene chip comprises a solid phase carrier and oligonucleotide probes fixed on the solid phase carrier, wherein the oligonucleotide probes comprise oligonucleotide probes aiming at ASPRV1 gene and used for detecting the transcription level of ASPRV1 gene; the protein chip comprises a solid phase carrier and a specific antibody which is fixed on the solid phase carrier and aims at the ASPRV1 protein; the kit comprises a gene detection kit and a protein detection kit.

The product of the invention can be used for detecting the expression levels of a plurality of genes or gene expression products (a plurality of genes or expression products thereof related to laryngeal squamous cell carcinoma) including ASPRV1, and simultaneously detecting a plurality of markers of the laryngeal squamous cell carcinoma, thereby greatly improving the accuracy of diagnosing the laryngeal squamous cell carcinoma.

The invention provides application of ASPRV1 in screening candidate compounds for preventing or treating laryngeal squamous cell carcinoma.

Further, the step of screening candidate compounds is as follows:

in the test group, adding a test compound in a culture system, and observing the expression amount and/or activity of ASPRV1 in the cells of the test group; in the control group, no test compound was added to the same culture system, and the expression amount and/or activity of ASPRV1 in the cells of the control group was observed;

wherein, if the expression level and/or activity of ASPRV1 in the cells of the test group is lower than that of the control group, the test compound is a candidate compound for treating cancer, which has an inhibitory effect on the expression and/or activity of ASPRV 1.

In the present invention, the steps further include: the obtained candidate compound is subjected to further cell experiments and/or animal experiments to further select and determine a substance useful for preventing, alleviating or treating laryngeal squamous cell carcinoma from the candidate compound.

In the present invention, the system for screening candidate compounds for preventing or treating laryngeal squamous carcinoma is not limited to a cell system, but also includes a cell system, a subcellular system, a solution system, a tissue system, an organ system, an animal system or the like, which is not limited to the above-described forms, as long as the system can detect that a test compound can reduce the expression and/or activity of ASPRV 1.

Such candidate compounds include, but are not limited to: interfering molecules, nucleic acid inhibitors, binding molecules (such as antibodies or ligands), small molecule compounds and the like designed against the ASPRV1 gene or its encoded protein or its upstream or downstream genes or proteins.

The invention provides application of an inhibitor of ASPRV1 functional expression in preparing a pharmaceutical composition for preventing or treating laryngeal squamous cell carcinoma.

Further, the inhibitor of functional expression of ASPRV1 is selected from the group consisting of: nucleic acid inhibitors, protein inhibitors, proteolytic enzymes, protein binding molecules, preferably the inhibitor is a nucleic acid inhibitor siRNA.

In the present invention, the inhibitor of ASPRV1 can also be used to inhibit invasion and proliferation of laryngeal squamous carcinoma cells.

In a specific embodiment of the invention, the sequence of the siRNA is shown in SEQ ID NO. 11-12.

The invention provides a pharmaceutical composition for treating laryngeal squamous carcinoma, which comprises an inhibitor of functional expression of ASPRV 1.

The inhibitor is selected from: an interfering molecule targeting ASPRV1 or its transcript and capable of inhibiting ASPRV1 gene expression or gene transcription, comprising: shRNA (small hairpin RNA), small interfering RNA (sirna), dsRNA, microrna, antisense nucleic acid, or a construct capable of expressing or forming said shRNA, small interfering RNA, dsRNA, microrna, antisense nucleic acid; or a binding molecule that specifically binds to a protein encoded by ASPRV1 (e.g., an antibody or ligand capable of inhibiting the activity of ASPRV1 protein).

Further, the pharmaceutical composition also comprises a pharmaceutically acceptable carrier. Such carriers include, but are not limited to, diluents, excipients, binders, wetting agents, absorption enhancers, surfactants, humectants, adsorptive carriers, lubricants, buffers, stabilizers, bacteriostats, isotonicity agents, chelating agents, pH control agents.

Drawings

FIG. 1 is a graph showing the detection of the expression of ASPRV1 gene in laryngeal squamous cell carcinoma tissues by QPCR;

FIG. 2 is a graph showing the detection of the expression of ASPRV1 protein in laryngeal squamous cell carcinoma tissues using western blot;

FIG. 3 is a graph showing the effect of siRNA transfection on ASPRV1 gene expression in laryngeal squamous cell carcinoma cells using QPCR;

FIG. 4 is a graph showing the effect of siRNA transfection on ASPRV1 protein expression in laryngeal carcinoma cells using western blot;

FIG. 5 is a graph showing the effect of detecting ASPRV1 gene on the proliferation of laryngeal squamous cell carcinoma cells by MTT assay;

FIG. 6 is a graph showing the effect of ASPRV1 gene on apoptosis of laryngeal squamous cell carcinoma cells detected by flow cytometry;

FIG. 7 is a graph of the effect of ASPRV1 on laryngeal squamous cell carcinoma cell migration using a cell scratch assay;

FIG. 8 is a photograph of invasion of laryngeal squamous cell carcinoma cells by ASPRV1 detected using a Transwell chamber.

Detailed Description

The invention is widely and deeply researched, the expression of genes in a laryngeal squamous cell carcinoma specimen in tumor tissues and tissues beside the cancer is detected by a high-throughput sequencing method, the genes with obvious expression difference are found, and the relationship between the genes and the occurrence of the laryngeal squamous cell carcinoma is discussed, so that a better way and a better method are found for the early detection and the targeted treatment of the laryngeal squamous cell carcinoma. Through screening, the invention discovers that ASPRV1 is remarkably upregulated in laryngeal squamous cell carcinoma for the first time. Experiments prove that the growth and invasion of laryngeal squamous cell carcinoma cells can be effectively inhibited by reducing the expression level of ASPRV1, the detection of the expression level of ASPRV1 gene can be one of auxiliary diagnostic indexes for early diagnosis of laryngeal squamous cell carcinoma, and the interference of ASPRV1 gene expression can be a new way for preventing or treating laryngeal squamous cell carcinoma or laryngeal squamous cell carcinoma metastasis.

Marker substance

Markers (used alone or in combination with other qualitative terms such as laryngeal squamous carcinoma markers, laryngeal squamous carcinoma specific markers, control markers, exogenous markers, endogenous markers) refer to parameters that are measurable, calculable or otherwise obtainable, are associated with any molecule or combination of molecules, and can be used as indicators of a biological and/or chemical state. In the present invention, "marker" refers to parameters associated with one or more biomolecules (i.e., "biomarkers"), such as naturally or synthetically produced nucleic acids (i.e., individual genes, as well as coding and non-coding DNA and RNA) and proteins (e.g., peptides, polypeptides). "marker" in the context of the present invention also includes reference to a single parameter which may be calculated or otherwise obtained by taking into account expression data from two or more different markers.

Laryngeal squamous carcinoma markers refer to specific types of markers that can be used (alone or in combination with other markers) as indicators of laryngeal squamous carcinoma in a subject, and in particular embodiments of the invention, laryngeal squamous carcinoma markers can be used to provide markers for clinical assessment of laryngeal squamous carcinoma in a subject (alone or in combination with other markers).

ASPRV1 gene

ASPRV1 is located in region 3 of short arm 1 of human chromosome 2, and ASPRV1 in the present invention includes wild type, mutant or fragment thereof. A nucleotide sequence and an amino acid sequence shown in SEQ ID NO.1 and SEQ ID NO.2 of a representative ASPRV1 gene. The full-length nucleotide sequence of human ASPRV1 or its fragment of the present invention can be obtained by PCR amplification, recombination or artificial synthesis.

Detection techniques (methods)

The genes of the invention are detected using a variety of detection techniques known to those of ordinary skill in the art, including, but not limited to: nucleic acid sequencing, nucleic acid hybridization, nucleic acid amplification technology and immunodetection technology.

Illustrative, non-limiting examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. One of ordinary skill in the art will recognize that RNA is typically reverse transcribed into DNA prior to sequencing because it is less stable in cells and more susceptible to nuclease attack in experiments.

Another illustrative, non-limiting example of a nucleic acid sequencing technique includes next generation sequencing (deep sequencing/high throughput sequencing), which is a unimolecular cluster-based sequencing-by-synthesis technique based on proprietary reversible termination chemical reaction principles. Random fragments of genome DNA are attached to an optically transparent glass surface during sequencing, hundreds of millions of clusters are formed on the glass surface after the DNA fragments are extended and subjected to bridge amplification, each cluster is a monomolecular cluster with thousands of identical templates, and then four kinds of special deoxyribonucleotides with fluorescent groups are utilized to sequence the template DNA to be detected by a reversible edge-to-edge synthesis sequencing technology.

Illustrative, non-limiting examples of nucleic acid hybridization techniques include, but are not limited to, In Situ Hybridization (ISH), microarrays, and Southern or Northern blots. In Situ Hybridization (ISH) is a hybridization of specific DNA or RNA sequences in a tissue section or section using a labeled complementary DNA or RNA strand as a probe (in situ) or in the entire tissue if the tissue is small enough (whole tissue embedded ISH). DNA ISH can be used to determine the structure of chromosomes. RNA ISH is used to measure and locate mRNA and other transcripts (e.g., ncRNA) within tissue sections or whole tissue embedding. Sample cells and tissues are typically treated to fix the target transcript in situ and to increase probe access. The probe is hybridized to the target sequence at high temperature, and then excess probe is washed away. The localization and quantification of base-labeled probes in tissues labeled with radiation, fluorescence or antigens is performed using autoradiography, fluorescence microscopy or immunohistochemistry, respectively. ISH can also use two or more probes labeled with radioactive or other non-radioactive labels to detect two or more transcripts simultaneously.

The present invention can amplify nucleic acids (e.g., ncRNA) prior to or simultaneously with detection. Illustrative non-limiting examples of nucleic acid amplification techniques include, but are not limited to: polymerase Chain Reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), Transcription Mediated Amplification (TMA), Ligase Chain Reaction (LCR), Strand Displacement Amplification (SDA), and Nucleic Acid Sequence Based Amplification (NASBA). One of ordinary skill in the art will recognize that certain amplification techniques (e.g., PCR) require reverse transcription of RNA into DNA prior to amplification (e.g., RT-PCR), while other amplification techniques directly amplify RNA (e.g., TMA and NASBA).

The polymerase chain reaction, commonly known as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase the copy number of the target nucleic acid sequence, transcription-mediated amplification of TMA (autocatalytically synthesizing multiple copies of the target nucleic acid sequence under substantially constant conditions of temperature, ionic strength, and pH, where multiple RNA copies of the target sequence autocatalytically generate additional copies; ligase chain reaction of LCR uses two sets of complementary DNA oligonucleotides that hybridize to adjacent regions of the target nucleic acid; other amplification methods include, for example, nucleic acid sequence-based amplification, commonly known as NASBA, amplification of the probe molecule itself using RNA replicase (commonly known as Q β replicase), transcription-based amplification methods, and self-sustained sequence amplification.

Non-amplified or amplified nucleic acids of the invention can be detected by any conventional means.

Chip and kit

In the present invention, "chip", "microarray", "array" may be equivalently replaced, including but not limited to: DNA microarrays (e.g., cDNA microarrays and oligonucleotide microarrays), protein microarrays, tissue microarrays, transfection or cell microarrays, chemical compound microarrays, and antibody microarrays. DNA microarrays, often referred to as gene chips, DNA chips or biochips, are collections of microscopic DNA spots attached to a solid surface (e.g., glass, plastic, or silicon chips) that form an array for simultaneous expression profiling or expression level monitoring of thousands of genes. The immobilized DNA fragments, called probes, thousands of which can be used in a single DNA microarray. Microarrays can be used to identify disease genes or transcripts (e.g., ncrnas) by comparing gene expression in disease and normal cells. Microarrays can be fabricated using a variety of techniques, including but not limited to: printing onto a glass slide with a fine-pointed needle, photolithography using a pre-fabricated mask, photolithography using a dynamic micro-mirror device, ink-jet printing, or electrochemical methods on a micro-electrode array.

The kit of the present invention can be used for detecting the expression of ASPRV1, and preferably, the kit comprises an effective amount of a reagent for detecting ASPRV1 gene, and one or more substances selected from the following group: container, instructions for use, positive control, negative control, buffer, adjuvant or solvent. For example, a solution for suspending or immobilizing cells, a detectable label or label, a solution for facilitating hybridization of nucleic acids, a solution for lysing cells, or a solution for nucleic acid purification.

The kit of the invention can be also attached with an instruction manual of the kit, wherein the instruction manual describes how to adopt the kit for detection, how to judge the tumor development by using the detection result and how to select a treatment scheme.

With the kit of the present invention, ASPRV1 may be detected by various methods selected from the group consisting of (including but not limited to): real-time quantitative reverse transcription PCR, biochip detection method, southern blotting, northern blotting or in situ hybridization. The detection mode can be adjusted and changed by those skilled in the art according to actual conditions and needs.

Inhibitors and pharmaceutical compositions

Based on the discovery of the inventor, the invention provides application of an inhibitor of ASPRV1 in preparing a pharmaceutical composition for inhibiting laryngeal squamous cell carcinoma. As used herein, the inhibitors of ASPRV1 include, but are not limited to, inhibitors, antagonists, blockers, nucleic acid inhibitors, and the like.

The ASPRV1 gene or protein inhibitor is any substance capable of reducing the activity of ASPRV1 protein, reducing the stability of ASPRV1 gene or protein, reducing the expression of ASPRV1 protein, reducing the effective action time of ASPRV1 protein, or inhibiting the transcription and translation of ASPRV1 gene, and the substances can be used for the invention, and can be used for reducing ASPRV1, thereby being used for preventing or treating laryngeal squamous cell carcinoma. For example, the inhibitor is: nucleic acid inhibitors, protein inhibitors, antibodies, ligands, proteolytic enzymes, protein binding molecules, as long as they are capable of down-regulating the expression of the ASPRV1 protein or its encoding gene at the protein or gene level.

As an alternative of the invention, the inhibitor of ASPRV1 is an antibody that specifically binds to ASPRV 1. The specific antibody comprises a monoclonal antibody and a polyclonal antibody; the invention encompasses not only intact antibody molecules, but also any fragment or modification of an antibody, e.g., chimeric antibodies, scFv, Fab, F (ab') 2, Fv, etc. As long as the fragment retains the ability to bind to the ASPRV1 protein. The preparation of antibodies for use at the protein level is well known to those skilled in the art and any method may be used in the present invention to prepare such antibodies

As a preferred mode of the invention, the inhibitor of ASPRV1 is a small interfering RNA molecule specific for ASPRV 1. As used herein, the term "small interfering RNA" refers to a short segment of double-stranded RNA molecule that targets mRNA of homologous complementary sequence to degrade a specific mRNA, which is the RNA interference (RNA interference) process. Small interfering RNA can be prepared as a double-stranded nucleic acid form, which contains a sense and an antisense strand, the two strands only in hybridization conditions to form double-stranded. A double-stranded RNA complex can be prepared from the sense and antisense strands separated from each other. Thus, for example, complementary sense and antisense strands are chemically synthesized, which can then be hybridized by annealing to produce a synthetic double-stranded RNA complex.

When screening effective siRNA sequences, the inventor finds out the optimal effective fragment by a large amount of alignment analysis. The inventor designs and synthesizes a plurality of siRNA sequences, and verifies the siRNA sequences by transfecting laryngeal squamous cell carcinoma cell lines with transfection reagents respectively, selects siRNA with the best interference effect, has the sequences shown in SEQ ID NO.11 and SEQ ID NO.12 respectively, further performs experiments at a cell level, and proves that the inhibition efficiency is very high for cell experiments.

The nucleic acid inhibitor of the present invention, such as siRNA, can be chemically synthesized or can be prepared by transcribing an expression cassette in a recombinant nucleic acid construct into single-stranded RNA. Nucleic acid inhibitors, such as siRNA, can be delivered into cells by using appropriate transfection reagents, or can also be delivered into cells using a variety of techniques known in the art.

As an alternative of the present invention, the inhibitor of ASPRV1 may also be a "Small hairpin RNA (shRNA)" which is a non-coding Small RNA molecule capable of forming a hairpin structure, the Small hairpin RNA being capable of inhibiting gene expression via an RNA interference pathway. As described above, shRNA can be expressed from a double-stranded DNA template. The double-stranded DNA template is inserted into a vector, such as a plasmid or viral vector, and then expressed in vitro or in vivo by ligation to a promoter. The shRNA can be cut into small interfering RNA molecules under the action of DICER enzyme in eukaryotic cells, so that the shRNA enters an RNAi pathway. "shRNA expression vector" refers to some plasmids which are conventionally used for constructing shRNA structure in the field, usually, a "spacer sequence" and multiple cloning sites or alternative sequences which are positioned at two sides of the "spacer sequence" are present on the plasmids, so that people can insert DNA sequences corresponding to shRNA (or analogues) into the multiple cloning sites or replace the alternative sequences on the multiple cloning sites in a forward and reverse mode, and RNA after the transcription of the DNA sequences can form shRNA (short Hairpin) structure. The "shRNA expression vector" is completely available by the commercial purchase of, for example, some viral vectors.

The invention also provides a pharmaceutical composition which contains an effective amount of the ASPRV1 inhibitor and a pharmaceutically acceptable carrier. The composition can be used for inhibiting laryngeal squamous cell carcinoma. Any of the foregoing inhibitors of ASPRV1 may be used in the preparation of the compositions. Such carriers include, but are not limited to, diluents, excipients, binders, disintegrants, absorption enhancers, surfactants, humectants, adsorptive carriers, lubricants, buffers, stabilizers, bacteriostats, isotonicity agents, chelating agents, pH control agents.

Wherein the diluent is lactose, sodium chloride, glucose, urea, starch, water, etc.; excipients such as lactose, sodium chloride, glucose, urea, starch, water, etc.; binders such as simple syrup, glucose solution, starch solution, cellulose derivatives, alginates, gelatin, and polyvinylpyrrolidone; disintegrating agents such as dry starch, sodium alginate, laminarin powder, agar powder, calcium carbonate and sodium bicarbonate; absorption accelerators quaternary ammonium compounds, sodium lauryl sulfate, and the like; surfactants such as polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, glyceryl monostearate, cetyl alcohol, etc.; humectants such as glycerin, starch, etc.; adsorption carriers such as starch, lactose, bentonite, silica gel, kaolin, and bentonite, etc.; lubricants such as talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, etc.; buffering agents may include boric acid, phosphoric acid, acetic acid, citric acid, glutamic acid, and the corresponding salts (their alkali metal or alkaline rare earth metal salts, such as sodium, potassium, calcium, and magnesium salts); the stabilizer comprises human serum protein, L-amino acid, sugar and cellulose derivative; bacteriostatic agents include, but are not limited to, benzyl alcohol, phenol, m-cresol, chlorobutanol, methyl and/or propyl parabens at effective concentrations (e.g., < 1% w/v); isotonic agents include potassium chloride, sodium chloride, sugars and glycerol; the chelating agent comprises sodium ethylene diamine tetracetate and citric acid;

as used herein, the "effective amount" refers to an amount that produces a function or activity in and is acceptable to humans and/or animals. The effective amount of the inhibitor may vary depending on the mode of administration and the severity of the disease to be treated, etc. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the inhibitor of the ASPRV1 gene such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the weight of the patient, the immune status of the patient, the route of administration, and the like.

The pharmaceutical compositions of the present invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. Oral administration or injection administration is preferred. The pharmaceutical composition of the present invention may contain any of the usual non-toxic pharmaceutically acceptable carriers, adjuvants or excipients.

The pharmaceutical composition of the invention can also be used in combination with other drugs for the treatment of squamous cell carcinoma of the larynx, and the other therapeutic compounds can be administered simultaneously with the main active ingredient, even in the same composition. Other therapeutic compounds may also be administered alone in a composition or dosage form different from the main active ingredient.

Preferably, it can be carried out by means of gene therapy. For example, an inhibitor of ASPRV1 may be administered directly to a subject by a method such as injection; alternatively, expression units carrying an inhibitor of ASPRV1 (e.g., expression vectors or viruses, etc., or siRNA or shRNA) can be delivered to the target in a manner that results in the expression of the active ASPRV1 inhibitor, depending on the type of inhibitor, as is well known to those of skill in the art.

In the present invention, the term "sample" is used in its broadest sense. Any tissue or material derived from a living or dead human, which may include a marker of the present invention, is intended to be included. In particular embodiments of the invention, the sample may be tumor or lung tumor tissue, and may include, for example, any tissue or material containing cells or markers therefrom that are associated with laryngeal tissue.

The present invention will be described in further detail with reference to the accompanying drawings and examples. The following examples are intended to illustrate the invention only and are not intended to limit the scope of the invention. Experimental procedures without specific conditions noted in the examples, generally following conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1 screening of Gene markers associated with laryngeal squamous cell carcinoma

1. Sample collection

Each of 6 laryngeal squamous carcinoma tissues and corresponding normal mucosal tissue samples were collected, and informed consent was obtained from the patients and given consent by the tissue ethics committee.

2. Preparation of RNA samples

1) Adding liquid nitrogen, grinding tissue to powder, adding 1ml TRIzol (Invitrogen) solution, blowing, mixing, fully cracking tissue, and standing for 5 min;

2) centrifuging at 12000rpm at 4 deg.C for 5min, and transferring the supernatant to 1.5ml RNase free EP tube;

3) adding 200 μ l chloroform, shaking vigorously and mixing well for 30s to make the water phase and organic phase contact sufficiently, standing at room temperature for 15 min;

4) separating at 12000g at 4 deg.C for 15min, centrifuging the solution into three layers, transferring RNA to the upper water phase, and transferring to another new RNase free EP tube;

5) adding 0.5ml isopropanol, gently mixing well, standing at room temperature for 10 min;

6) centrifuging at 12000g for 10min at 4 deg.C, precipitating RNA by adding 75% ethanol with the same volume as RNAioso Plus, centrifuging at 7500g at 4 deg.C for 5min, and removing supernatant;

7) washing twice with 75% ethanol, and air drying on a super clean bench; the precipitate was dissolved with 30. mu.l of DEPC water.

8) Mass analysis of RNA samples

The concentration and purity of the extracted RNA were determined using Nanodrop2000, RNA integrity was determined by agarose gel electrophoresis, and RIN was determined by Agilent 2100. The concentration is more than or equal to 200 ng/mul, and the OD260/280 is between 1.8 and 2.2.

3. Removal of rRNA

Ribosomal RNA was removed from total RNA using Ribo-Zero kit.

4. Construction of cDNA library

The construction of cDNA library was carried out using the Truseq RNA sample Prep Kit from Illumina, the detailed procedures were as described in the specification.

5. Sequencing on machine

The cDNA library was sequenced using the Hiseq4000 sequencing platform, the specific procedures were as described in the specification.

6. High throughput transcriptome sequencing data analysis

Bioinformatics analysis is carried out on the sequencing result, RNA-seq reading positioning is carried out by using TopHat v1.3.1, the relative abundance of the transcript is calculated by normalizing the number of RNA-seq fragments by Cufflinks v1.0.3, differential expression is detected by using cuffdiff, and mRNA is considered to be significantly differentially expressed when the p value is less than 0.001, | log2(Fold _ change) normalized | > 2.

7. Results

The RNA-seq results show that 665, 450 up-regulated and 215 down-regulated genes are differentially expressed in laryngeal squamous carcinoma patients, wherein the expression level of the gene ASPRV1 in laryngeal squamous carcinoma tissues is obviously higher than that in normal paracarcinoma mucosal tissues.

Example 2 QPCR sequencing verification of differential expression of the ASPRV1 Gene

1. Large sample QPCR validation was performed on ASPRV1 gene differential expression. 50 cases of the normal paracancerous mucosal tissue and the laryngeal squamous cell carcinoma tissue of the laryngeal squamous cell carcinoma patient were selected in accordance with the sample collection method of example 1.

2. The specific procedure for RNA extraction was as described in example 1.

3. Reverse transcription

3. Reverse transcription: mRNA reverse transcription was performed using the FastQuant cDNA first strand synthesis kit (cat # KR 106). The method comprises the following specific steps:

(1) add 5 Xg DNA Buffer 2.0 u l, total RNA1 u g, RNase Free ddH₂O, heating to 42 ℃ in a water bath for 3min until the total volume is 10 mu l;

(2) a20. mu.l reaction system was constructed, 10 XFast RT Buffer 2.0. mu.l, RT Enzyme Mix 1.0. mu.l, FQ-RT Primer Mix 2.0. mu.l, RNase Free ddH₂Adding O5.0 mul into the mixed solution in the step (1) after mixing, and mixing uniformly;

(3) heating in water bath at 42 deg.C for 15min, heating at 95 deg.C for 3min, and storing at-20 deg.C for use.

4. QPCR amplification

(1) Primer design

QPCR amplification primers were designed based on the coding sequences of ASPRV1 gene and housekeeping GAPDH gene in Genebank and synthesized by Bomaide.

Primer sequence of ASPRV1 gene:

the forward primer sequence is 5'-AACCATTGGGACCATATC-3' (SEQ ID NO. 3);

the reverse primer sequence is 5'-ACTGAGCCTATTGTAGAC-3' (SEQ ID NO. 4).

Primer sequence of GAPDH gene:

the forward primer sequence is 5'-GGAGCGAGATCCCTCCAAAAT-3' (SEQ ID NO. 5);

the reverse primer sequence was 5'-GGCTGTTGTCATACTTCTCATGG-3' (SEQ ID NO. 6).

(2) And (3) PCR reaction system: forward and reverse primers are each 0.6. mu.l, 2 XSuperReal PreMix Plus 10. mu.l, DNA template 2. mu.l, ddH₂O 7.4μl，50×ROX Reference Dye ^△2. mu.l of sterile distilled water, 4.8. mu.l.

(3) And (3) PCR reaction conditions: 95 ℃ for 15min, (95 ℃ for 10s, 55 ℃ for 30s, 72 ℃ for 32s) x 40 cycles, 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s. PCR reaction is carried out on an ABI 7300 type fluorescence quantitative PCR instrument, a target band is determined by melting curve analysis and electrophoresis, and relative quantification is carried out by a delta CT method.

5. Statistical method

The experiments were performed in 3 replicates, the data were presented as mean ± sd, statistically analyzed using SPSS18.0 statistical software, and the paired comparison of cancer to paracancerous tissue was performed using t-test, which was considered statistically significant when P < 0.05.

6. Results

Results as shown in fig. 1, ASPRV1 was up-regulated in laryngeal squamous carcinoma tissue compared to the normal paracancerous mucosal tissue of laryngeal squamous carcinoma, with a statistically significant difference (P <0.05), consistent with high-throughput sequencing results.

Example 3 detection of differential expression of ASPRV1 protein by Western immunoblotting assay

1. Extraction of total tissue protein

Shearing tissue with scissors, placing into a glass homogenizer in ice, mixing RIPA lysate and PMSF at a ratio of 100:1, adding RIPA lysate of corresponding amount into tissue specimen of 20mg per 100 μ l lysate, grinding tissue with glass homogenizer until it is fully lysed, sucking the lysed liquid into EP tube, centrifuging at 14000rpm at 4 deg.C for 5min, and collecting supernatant.

2. Total protein concentration determination

The protein concentration was determined according to the instructions of the BCA protein concentration determination kit.

3. SDS-PAGE electrophoresis

8% of separation gel and 5% of concentrated gel were prepared and electrophoresed according to the instruction of SDS-PAGE gel preparation kit.

4. Western detection

1) Electrotransfer

And (3) putting the PVDF membrane into a methanol solution for activating for 5min, and putting the PVDF membrane into a membrane transferring buffer solution for balancing for 20 min. Taking out the PAGE gel, putting the PAGE gel into a membrane transferring buffer solution, cutting off the corresponding PAGE gel, putting the PAGE gel, the filter paper, the PVDF membrane, the PAGE gel and the filter paper in sequence from bottom to top into a semi-dry membrane transferring instrument, and transferring the membrane for 1.5h at constant pressure of 25V;

2) immunological hybridization

Taking out the PVDF membrane, washing the PVDF membrane by PBS, placing the washed PVDF membrane in a 5% BSA solution, shaking and sealing the PVDF membrane for 2 hours at room temperature, placing the PVDF membrane in a hybridization bag, adding a primary antibody for overnight, washing the PVDF membrane by a TBST buffer solution, adding a corresponding secondary antibody, incubating the PVDF membrane for 2 hours at room temperature, and washing the PVDF membrane by the TBST buffer solution.

3) DAB color development

The method comprises the following steps of dropwise adding a freshly prepared DAB color development solution into a PVDF membrane after the PVDF membrane is slightly dried, scanning and recording after the PVDF membrane develops color, carrying out semi-quantitative gray scale analysis on a strip by using β -actin as an internal reference and adopting a Quantity One gel imaging analysis system, repeating the experiment for 3 times, and taking an average gray scale value as a result;

5. statistical analysis

Statistical analysis was performed using the SPSS18.0 statistical software, with the results data expressed as mean ± standard deviation, and analysis using a wide variety of mean-of-sample variance tests (ANOVA) was considered statistically significant when P < 0.05.

6. Results

The results are shown in fig. 2, the expression level of ASPRV1 protein in laryngeal squamous carcinoma tissue is significantly higher than that in normal paracancerous mucosal tissue.

Example 4 silencing of ASPRV1 Gene

1. Cell culture

Human laryngeal squamous carcinoma cell line Hep2, cultured in RPMI1640 medium containing 10% fetal calf serum and 1% P/S at 37 deg.C and 5% CO₂And culturing in an incubator with relative humidity of 90%. The liquid is changed for 1 time in 2-3 days, the cells grow well and grow in a monolayer adherent manner. Passage was routinely digested with 0.25% EDTA-containing trypsin.

2. Transfection

1) Treatment of cells prior to transfection

Day before transfection, 63-5 multiplied by 10 seeds are planted on the hole culture plate⁵And (3) culturing each cell/hole in an antibiotic-free culture medium for one day, wherein the cell density is 30-50% during transfection, and the cell/hole is replaced by a serum-free culture medium before transfection.

2) Design of siRNA

Negative control siRNA sequence (siRNA-NC):

the sense strand is 5'-UUCUCCGAACGUGUCACGU-3' (SEQ ID NO.7)

The antisense strand is 5'-ACGUGACACGUUCGGAGAA-3' (SEQ ID NO.8)

siRNA1：

The sense strand is 5'-UCAUUGAUGACUUCAAAGCUG-3' (SEQ ID NO.9)

The antisense strand is 5'-GCUUUGAAGUCAUCAAUGACC-3' (SEQ ID NO.10)

siRNA2：

The sense strand is 5'-ACUCUUUCAGGAACCUUAGCU-3' (SEQ ID NO.11)

The antisense strand is 5'-CUAAGGUUCCUGAAAGAGUCC-3' (SEQ ID NO.12)

siRNA3：

The sense strand is 5'-CUAAGGUUCCUGAAAGAGUCC-3' (SEQ ID NO.13)

The antisense strand is 5'-CCUGAAAGGGAAGAAGUUUCG-3' (SEQ ID NO.14)

The experiment was divided into three groups: a control group (Hep2), a negative control group (siRNA-NC) and an experimental group (siRNA1, siRNA2 and siRNA3), wherein the siRNA of the negative control group has no homology with the sequence of the ASPRV1 gene.

3) Transfection

a. Taking 3 mu l of siRNA with the concentration of 50pmol, adding 47 mu l of serum-free culture medium, gently mixing uniformly, and incubating for 5min at room temperature;

b. mu.l of Lipofectamine 2000 was added to 49. mu.l of serum-free medium. Mixing, and incubating at room temperature for 5 min;

c. mixing the above two mixtures (total volume 100 μ l), gently mixing, and incubating at room temperature for 25min to allow complex formation;

d. adding 100 mul of compound and a proper amount of culture medium into each hole of a 6-hole plate, and gently mixing uniformly;

e. and observing the silencing effect of the gene after incubation for 48-96 h.

5. QPCR detection of transcript level of ASPRV1 Gene

5.1 extraction of Total RNA from cells

The RNA in the cells was extracted using Qiagen's cell RNA extraction kit, and the experimental procedures were performed according to the instructions.

5.2 reverse transcription procedure as in example 2.

5.3QPCR amplification step as in example 2.

6. Statistical method

The experiments were performed in 3 replicates, the data were expressed as mean ± sd, and statistically analyzed using SPSS18.0 statistical software, and the differences between the experimental group and the control group of ASPRV1 genes were determined by t-test to be statistically significant when P < 0.05.

7. Results

The results are shown in FIG. 3, wherein the reduction of siRNA2 expression level is most significant in the experimental group compared with the non-transfected group and the transfected siRNA-NC group, and the difference is statistically significant (P < 0.05).

Example 5 Western blot to examine the Effect of transfected siRNA on ASPRV1 protein expression

1. Cell culture and transfection

The procedure is as in example 4

2. Extraction of Total cellular protein

Cells from different treatment groups at log phase were collected and washed with pre-chilled PBS. Mixing RIPA cell lysate and PMSF at a ratio of 100:1, adding 150 μ l of the lysate into cells, standing on ice for 30min, scraping the lysed cells with a cell scraper, sucking the lysed liquid into an EP tube with a pipette, and centrifuging at 14000rpm at 4 ℃ for 5 min. The centrifuged supernatant was carefully collected.

3. Total protein concentration determination

4. SDS-PAGE electrophoresis

5. Western detection

See example 3 for details of the procedure.

6. Statistical analysis

7. Results

As a result, as shown in fig. 4, the expression level of ASPRV1 protein was significantly down-regulated in the cells of the group transfected with siRNA2 compared to the control group.

Example 6 Effect of ASPRV1 Gene on laryngeal squamous carcinoma cell proliferation

MTT experiment is adopted to detect the influence of ASPRV1 gene on the proliferation capacity of laryngeal squamous cell carcinoma.

1. Taking cells with good growth conditions, conventionally digesting the cells into a single cell suspension, counting the cells, and diluting the cells into a cell suspension with proper concentration;

2. inoculating the diluted cells of different treatment groups into 2000 cells per well in 96-well culture plate, setting at least 3 parallel wells, 37 deg.C, 5% CO₂Culturing for 24 h;

3. taking out 3-

well cells

1, 2, 3, 4 and 5 days after inoculation every day, detecting the OD value of 490nm by an MTT method, counting and calculating the average value;

4. removing supernatant before detection, washing with culture solution for 3 times, adding 100 μ l MTT serum-free culture medium solution (0.2mg/ml) into each well, and continuously culturing at 37 deg.C for 4 hr;

5. terminating the culture, carefully removing the supernatant, adding 150. mu.l DMSO into each well, shaking for 10min to dissolve the crystals sufficiently, measuring the Optical Density (OD) value on a microplate reader at 490nm, and plotting the cell growth curve with time as the horizontal axis and optical density as the vertical axis.

6. Statistical analysis

The experiments were performed in 3 replicates using SPSS18.0 statistical software for statistical analysis, and the differences between the two were considered statistically significant when P <0.05 using the t-test.

7. Results

The results are shown in fig. 5, compared with the control, the experimental group has obviously inhibited cell proliferation after being transfected with siRNA2, and the difference has statistical significance (P <0.05), which indicates that ASPRV1 has the effect of promoting cell proliferation.

Example 7 Effect of ASPRV1 Gene on apoptosis of laryngeal squamous cell carcinoma

The effect of ASPRV1 gene on apoptosis was examined using flow cytometry.

1. The cell culture procedure was as in example 3.

2. The cell transfection procedure was as in example 3.

3. Step (ii) of

1) Cells from different treatment groups in the logarithmic growth phase were trypsinized and blown into cell suspensions and counted. Get 10⁶Centrifuging the cell suspension at 1000rpm for 5 min;

2) discarding the supernatant, adding 195. mu.l Annexin V-FITC binding solution to gently resuspend the cells;

3) adding 5 μ l Annexin V-FITC, mixing, and incubating at room temperature in dark for 10 min;

4) centrifuging at 1000rpm for 5min, discarding the supernatant, and adding 190 μ l Annexin V-FITC binding solution to gently resuspend the cells;

5) and adding 10 mu l of Propidium Iodide (PI) staining solution, mixing gently, placing in ice bath and in dark, detecting the apoptosis condition by using a flow cytometer, repeating all experiments for 3 times, and taking an average value of results.

4. Statistical method

5. As a result:

as shown in FIG. 6, there was no significant change in the apoptosis rate of the cells in the experimental group compared to the control group (P < 0.05).

Example 8 cell scratch test

1. Add 1ml of fibronectin 50. mu.g/ml per well to 6 well plates and put in a refrigerator at 4 ℃ overnight;

2. discarding the rest fibronectin solution, washing with serum-free medium, subjecting the cells of different groups to trypsinization and resuspension, inoculating into 6-well plate coated with fibronectin, wherein each group of cells has 2 multiple wells with 5 × 10 wells⁵(ii) individual cells;

3. placing the mixture at 37 ℃ in 5% CO₂Culturing in an incubator overnight;

4. when the cells grow to be about 90 percent fused, drawing a fine trace without the cells by using a Tip head of 10 mul, washing off the fallen cells by using PBS solution, and adding a serum-free culture medium for continuous culture;

5. the healing condition of the cell scratch is observed at 0h and 48h after scratching respectively and photographed. The experiment was repeated 3 times and the results averaged.

6. Statistical method

7. Results

The results are shown in fig. 7, the migration distance of the cells after in vitro scratching is obviously reduced in the cells of the siRNA2 transfected group compared with the control group, and no significant difference exists between the control groups, which indicates that the ASPRV1 overexpression can promote the migration of laryngeal cancer cells.

Example 9 cell invasion assay

1. Transwell cell preparation

50mg/L of Matrigel gel was diluted with 4 ℃ pre-cooled serum-free medium at a ratio of 1:8, mixed well, coated on the upper surface of the bottom membrane of the Transwell chamber, and air-dried at 4 ℃. Mu.l to 80. mu.l of diluted Matrigel gel (3.9. mu.g/. mu.l) was placed on a polycarbonate membrane in a Transwell upper chamber having a pore size of 8 μm so that all micropores on the membrane were covered with Matrigel, and the membrane was allowed to polymerize into a gel at 37 ℃ for 30 min.

2. Preparing a cell suspension

Will be in logarithmic growthAfter the cells of different long-term treatment groups are trypsinized and resuspended in serum-free medium, the cell concentration is adjusted to 5X 10⁴One per ml.

3. Cell seeding

2ml of cell suspension was added to the upper chamber of the Transwell, 1ml of complete medium containing 10% fetal bovine serum was added to the lower chamber, and the mixture was placed in a matched 6-well plate and incubated at 37 ℃ with 5% CO₂Culturing for 20-24h under the condition; the Transwell chamber was removed and the cotton swab wiped to remove Matrigel and non-membrane-penetrating cells from the upper chamber.

4. Dyeing process

After the cell culture is finished, taking out the Transwell chamber, wiping off Matrigel glue on the upper chamber surface and cells which do not penetrate through the membrane with a cotton swab, fixing the lower chamber surface with 95% alcohol for 15min, staining with hematoxylin for 2min, and randomly taking 5 high-power lenses under an inverted microscope for visual field observation, counting and photographing. Counting the number of cells on the lower surface of the chamber, namely the number of cells penetrating the Matrigel gel, taking the average number as an experimental result, representing the invasiveness of the tumor cells by the number of the cells, repeating the experiment for 3 times, and arranging 3 compound holes in each group of the cells.

5. Statistical method

6. Results

As shown in FIG. 8, the number of cells passing through the polycarbonate membrane of the Transwell chamber was significantly reduced in the experimental group compared to the control group, while there was no significant difference between the control groups, indicating that the over-expression of ASPRV1 promotes the invasion of laryngeal squamous cell carcinoma.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

SEQUENCE LISTING

<110> Beijing, the deep biometric information technology GmbH

Application of <120> ASPRV1 as biomarker in diagnosis and treatment of laryngeal squamous cell carcinoma

<160>14

<170>PatentIn version 3.5

<210>1

<211>1032

<212>DNA

<213> human source

<400>1

atggggagcc caggggccag cctaggcatc aaaaaggctc tgcagagtga acaggccaca 60

gcactgcctg cctctgcccc agcagtcagc cagccgaccg cgcctgctcc ctcctgcttg 120

cccaaggccg ggcaagtcat ccccactctg cttcgagagg ccccgttttc cagcgtgatt 180

gcgccgacac tgctctgtgg gtttctcttc ttggcgtggg ttgctgctga ggttccagag 240

gagagcagca ggatggccgg gagcggagcc aggagtgagg aaggccgccg gcagcatgcc 300

ttcgtcccgg aaccttttga tggggccaat gtcgtcccaa acctctggct gcacagcttt 360

gaagtcatca atgacctcaa ccattgggac catatcacca agctaaggtt cctgaaagag 420

tccctcagag gagaggccct gggtgtctac aataggctca gtccccagga ccagggagac 480

tatgggactg tgaaagaggc cctcctgaag gcctttgggg tccctggggc tgcccccagc 540

cacctgccca aagagatcgt ctttgccaac agcatgggta agggctacta tctcaagggg 600

aagattggca aagtgcccgt gaggttcctg gtggactctg gggcccaggt ctctgtggtc 660

cacccaaact tgtgggagga ggtcactgat ggcgatctgg acaccctgca gccctttgag 720

aatgtggtaa aggtggccaa tggtgctgaa atgaagatcc tgggtgtctg ggatacagcg 780

gtgtccctag gcaagctgaa gctgaaggca cagttcctag tggccaatgc gagtgccgag 840

gaagccatca ttggcactga tgtgctccag gaccacaatg ctatcctgga ctttgagcac 900

cgcacatgca ccctgaaagg gaagaagttt cgccttctgc ctgtgggagg gtccctggaa 960

gatgagtttg acctggagct catagaggag gacccctcct cagaagaagg gcggcaggag 1020

ctatcccact ga 1032

<210>2

<211>343

<212>PRT

<213> human source

<400>2

Met Gly Ser Pro Gly Ala Ser Leu Gly Ile Lys Lys Ala Leu Gln Ser

1 5 10 15

Glu Gln Ala Thr Ala Leu Pro Ala Ser Ala Pro Ala Val Ser Gln Pro

20 25 30

Thr Ala Pro Ala Pro Ser Cys Leu Pro Lys Ala Gly Gln Val Ile Pro

35 40 45

Thr Leu Leu Arg Glu Ala Pro Phe Ser Ser Val Ile Ala Pro Thr Leu

50 55 60

Leu Cys Gly Phe Leu Phe Leu Ala Trp Val Ala Ala Glu Val Pro Glu

65 70 75 80

Glu Ser Ser Arg Met Ala Gly Ser Gly Ala Arg Ser Glu Glu Gly Arg

85 90 95

Arg Gln His Ala Phe Val Pro Glu Pro Phe Asp Gly Ala Asn Val Val

100 105 110

Pro Asn Leu Trp Leu His Ser Phe Glu ValIle Asn Asp Leu Asn His

115 120 125

Trp Asp His Ile Thr Lys Leu Arg Phe Leu Lys Glu Ser Leu Arg Gly

130 135 140

Glu Ala Leu Gly Val Tyr Asn Arg Leu Ser Pro Gln Asp Gln Gly Asp

145 150 155 160

Tyr Gly Thr Val Lys Glu Ala Leu Leu Lys Ala Phe Gly Val Pro Gly

165 170 175

Ala Ala Pro Ser His Leu Pro Lys Glu Ile Val Phe Ala Asn Ser Met

180 185 190

Gly Lys Gly Tyr Tyr Leu Lys Gly Lys Ile Gly Lys Val Pro Val Arg

195 200 205

Phe Leu Val Asp Ser Gly Ala Gln Val Ser Val Val His Pro Asn Leu

210 215 220

Trp Glu Glu Val Thr Asp Gly Asp Leu Asp Thr Leu Gln Pro Phe Glu

225 230 235 240

Asn Val Val Lys Val Ala Asn Gly Ala Glu Met Lys Ile Leu Gly Val

245 250 255

Trp Asp Thr Ala Val Ser Leu Gly Lys Leu Lys Leu Lys Ala Gln Phe

260 265 270

Leu Val Ala Asn Ala Ser Ala Glu Glu Ala Ile IleGly Thr Asp Val

275 280 285

Leu Gln Asp His Asn Ala Ile Leu Asp Phe Glu His Arg Thr Cys Thr

290 295 300

Leu Lys Gly Lys Lys Phe Arg Leu Leu Pro Val Gly Gly Ser Leu Glu

305 310 315 320

Asp Glu Phe Asp Leu Glu Leu Ile Glu Glu Asp Pro Ser Ser Glu Glu

325 330 335

Gly Arg Gln Glu Leu Ser His

340

<210>3

<211>18

<212>DNA

<213> Artificial Synthesis

<400>3

aaccattggg accatatc 18

<210>4

<211>18

<212>DNA

<213> Artificial Synthesis

<400>4

actgagccta ttgtagac 18

<210>5

<211>21

<212>DNA

<213> Artificial Synthesis

<400>5

ggagcgagat ccctccaaaa t 21

<210>6

<211>23

<212>DNA

<213> Artificial Synthesis

<400>6

ggctgttgtc atacttctca tgg 23

<210>7

<211>19

<212>RNA

<213> Artificial Synthesis

<400>7

uucuccgaac gugucacgu 19

<210>8

<211>19

<212>RNA

<213> Artificial Synthesis

<400>8

acgugacacg uucggagaa 19

<210>9

<211>21

<212>RNA

<213> Artificial Synthesis

<400>9

ucauugauga cuucaaagcu g 21

<210>10

<211>21

<212>RNA

<213> Artificial Synthesis

<400>10

gcuuugaagu caucaaugac c 21

<210>11

<211>21

<212>RNA

<213> Artificial Synthesis

<400>11

acucuuucaggaaccuuagc u 21

<210>12

<211>21

<212>RNA

<213> Artificial Synthesis

<400>12

cuaagguucc ugaaagaguc c 21

<210>13

<211>21

<212>RNA

<213> Artificial Synthesis

<400>13

cuaagguucc ugaaagaguc c 21

<210>14

<211>21

<212>RNA

<213> Artificial Synthesis

<400>14

ccugaaaggg aagaaguuuc g 21

Claims

1. Application of a reagent for specifically detecting ASPRV1 in preparation of a product for diagnosing laryngeal squamous cell carcinoma.

2. The use according to claim 1, wherein the reagent for the specific detection of ASPRV1 comprises: the reagent for detecting the expression level of ASPRV1 gene in the sample is prepared by sequencing technology, nucleic acid hybridization technology, nucleic acid amplification technology or immunoassay.

3. Use according to claim 2, wherein said agent is selected from:

a probe that specifically recognizes ASPRV1 gene; or

Primers for specifically amplifying ASPRV1 gene; or

An antibody or ligand that specifically binds to a protein encoded by ASPRV 1.

4. The use according to claim 3, wherein the reagents comprise at least one pair of primers for specific amplification of ASPRV1, the sequence of the primers being shown in SEQ ID No. 3-4.

5. The use of claim 1, wherein the product comprises a formulation, chip or kit for detecting the expression level of ASPRV1 in a sample, wherein the chip comprises a gene chip, a protein chip; the kit comprises a gene detection kit and a protein detection kit.

Use of an inhibitor of functional expression of ASPRV1 in the preparation of a pharmaceutical composition for the prevention or treatment of laryngeal squamous carcinoma, wherein the inhibitor is a nucleic acid inhibitor siRNA.