CN107164502A - The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair - Google Patents
The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair Download PDFInfo
- Publication number
- CN107164502A CN107164502A CN201710454777.9A CN201710454777A CN107164502A CN 107164502 A CN107164502 A CN 107164502A CN 201710454777 A CN201710454777 A CN 201710454777A CN 107164502 A CN107164502 A CN 107164502A
- Authority
- CN
- China
- Prior art keywords
- cabbage
- molecular labeling
- epidermal hair
- primer
- hair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to technical field of molecular biology, and in particular to whether there is the molecular labeling being closely related and its application with cabbage leaves epidermal hair.The purpose of the present invention is to provide a kind of new selection for head cabbage varieties seed selection.The technical scheme is that cabbage leaves epidermal hair whether there is the molecular labeling Boltrichome caps01 being closely related, with the nucleotide sequence as shown in SEQ ID No.1.The primer for the molecular labeling Boltrichome caps01 being closely related is whether there is present invention also offers cabbage leaves epidermal hair.Present invention also offers the purposes of described molecular labeling and its primer in wild cabbage breeding.The molecular labeling can be applied directly in wild cabbage epidermal hair breeding, and mitigation workload is selected in the early stage identification and assisted Selection by epidermal hair related molecular marker, effectively improves the efficiency and accuracy of selection.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to point being closely related is whether there is with cabbage leaves epidermal hair
Son mark and its application.
Background technology
Plant epidermal hair is the hairy structure extended out from its each organ epidermis, and they exercise a variety of functions, bag
Include the infringement for protecting the plants from pathogen, herbivore, ultraviolet radiation and arid and frost.Epidermal hair is widely present
Some types and kind in rape species, such as Chinese cabbage, cabbage type rape and leaf mustard.Some agriotypes of wild cabbage are (such as
Brassica incana and B.villosa) it is long-term raw in harsh natural environment, also remain the spy of plant epidermal hair
Levy, show positive role of the epidermal hair for its survival ability.But current all cultivation wild cabbage types show as no table
Fur, such as cabbage, cauliflower, broccoli, collard, cabbage mustard, brussels sprout etc..Utilize wild wild cabbage Resource Cultivation
Cultivation wild cabbage with epidermal hair, pest-resistant, disease-resistant, the drought-resistant and freeze injury ability of wild cabbage is cultivated to improving, and reduces the applications of pesticide
Amount and cost input have positive effect.
In the thing arabidopsis of pattern, the formation of epidermal hair is main by the TTG1-GL1-GL3 tripolymer compounding activation factors
Activation, but adjusted simultaneously by some reverse regulatory factors, such as TRY and CPC.Above-mentioned activity factor and the retroregulation factor
Collective effect simultaneously forms a feedback regulation circulative metabolism, in this circulation, activates the expression of sub- related gene and can activate
The expression of inhibiting factor, but the regulation and control expressed simultaneously and be suppressed the factor of activation.In addition, in protein level, TRY or
CPC is further substituted GL1 albumen and combined with GL3, so that this compound trimer inactivation.
Have been acknowledged that the TTG1 of Chinese cabbage is the regulatory factor of Chinese cabbage epidermal hair formation by map-based cloning at present
(Zhang et al., 2009), while it has also been found that GL1 genes it is relevant with the epidermal hair of Chinese cabbage and rape leaf (Li et al.,
2011；Gruber et al., 2006), but without the gene of the wild wild cabbage B.incana epidermal hairs of identification control.
The content of the invention
The purpose of the present invention is to provide a kind of new selection for head cabbage varieties seed selection.
The technical scheme is that cabbage leaves epidermal hair whether there is the molecular labeling Boltrichome- being closely related
Caps01, with the nucleotide sequence as shown in SEQ ID No.1.
The molecular labeling overall length 659bp, SNP appear in 378bp, and underscore show SNP, and hairless wild cabbage is A, and hairiness is sweet
Indigo plant is G.Restriction enzyme site is between 373-374bp.The amplified production of the molecular labeling used restriction enzyme in digestion
Enzyme is XagI (being called EcoNI).
TTAAAATTTGGAAGATGGAGGCAAGAAATGTGTGTTGTTTCTCATGATCCAATATCTCTCTATCTCCACAGCTTTTC
TTCCCGGTACTCTTCCTGCTATTATTTCCCACCTGGTATTTTGCAAGAAAACATTTTTCTCTCTAAGAATGGAAATA
CA TAAGTAAATAATAAAATGTTTGATACAAGTGATTAGCTTGGATCCCATTCTGCTTATTAAGCTAAGAAGTCCCT
AAGCGTAGCAAAAAGTTAAAAAAAAAAACACCTAGACACTAAAACTTAGGTCTAGTAGTTCCTAATTAATGAAACTA
CGTACAAACTATAACTAATTAGAACAAGAACATGAAGCAGCAATTGAAAGATCAAGTAGGCCTAAGAGAGAGCAAGG
ACACTTAGACCAGAAGGCGATGGTGATTCAAAAGGTCACTCTGAAACGACAAGAACGATTTTCTTCATCATCAGGAG
ATGGTTATTTTTTTTTTTTGTTTGTTCAACAGATCATCAGGCGATGGTAAGCGTAAGAATATAAGTACATTCCTATG
TCATATGTTTTGTGGTAAAGTCGTTACATCTAATTTTGGGAGAGAAAGAAATTAAAAGAAGATACGTACCTATCGCC
TACGAGTCTGTACATTCTTAAGATGAGATCTTCCTCCTGTTGGC
The molecular labeling Boltrichome-caps01 being closely related is whether there is present invention also offers cabbage leaves epidermal hair
Forward primer, its forward primer sequence have as shown in SEQ ID No.2 nucleotide sequence (5 '-
TTAAAATTTGGAAGATGGAGGC-3 '), reverse primer sequences have as shown in SEQ ID No.3 nucleotide sequence (5 '-
GCCAACAGGAGGAAGATCTCA-3’)。
Present invention also offers the authentication method of head cabbage varieties, comprise the following steps：With the genomic DNA of kind to be identified
For template, amplifier molecule mark Boltrichome-caps01, using restriction enzyme XagI digestion amplified productions, digestion knot
Fruit carries out electrophoresis, occur after electrophoresis 659-bp single band for the homozygosis kind without epidermal hair, there is 276-bp and 373-
The bands of bp two are the homozygosis kind for having epidermal hair, at the same occur tri- kinds of bands of 659-bp, 276-bp and 373-bp for without epidermis
The heterozygosis kind of hair；The primer pair of described amplifier molecule mark has the core as shown in SEQ ID No.2 and SEQ ID No.3
Nucleotide sequence.
Present invention also offers purposes of the described molecular labeling in wild cabbage breeding.
Present invention also offers purposes of the described molecular labeling in the head cabbage varieties of seed selection skin factor of different hair character.
Present invention also offers purposes of the described molecular labeling primer in wild cabbage breeding.
Present invention also offers use of the described molecular labeling primer in the head cabbage varieties of seed selection skin factor of different hair character
On the way.
Present invention also offers purposes of the authentication method of the head cabbage varieties in wild cabbage breeding.
Present invention also offers the authentication method of the head cabbage varieties in the head cabbage varieties of seed selection skin factor of different hair character
Purposes.
Beneficial effects of the present invention：
The molecular labeling can be applied directly in wild cabbage epidermal hair breeding.Reflected by the early stage of epidermal hair related molecular marker
Determine and assisted Selection, the hairiness individual of homozygosis can be confirmed as early as possible, and select heterozygous individual and enter next round selection, mitigate field
The planting scale and later stage appraisal of material, effectively improve the efficiency and accuracy of selection.
Brief description of the drawings
Fig. 1 is wild cabbage epidermal hair character SNP chip analysis result and candidate gene position
Upper figure represents Δ (SNP-index) distribution situation of C01 chromosomes, and red dotted line represents the P=0.001 levels of signifiance
When threshold value；The position of figure below displaying epidermal hair candidate interval (grey) and candidate gene BoTRY on C01 chromosomes.
Fig. 2 is by restriction enzyme site schematic diagram of the functional label using restriction enzyme XagI；Sequence is gene in figure
Part sequence containing SNP in BoTRY, this SNP presence is just digested out this section of sequence of hairiness, and hairless
Can not be cut open.
C01 (hairiness) AAAGATCAAGTAGGCCTAAGAGAGGGCAAGGACACTTAGACCAGAAGGCG C41 (hairless)
AAAGATCAAGTAGGCCTAAGAGAGAGCAAGGACACTTAGACCAGAAGGCG
C01 is hairiness wild cabbage parent, and C41 is hairless wild cabbage parent, and white background represents parents' SNP site, line in sequence
Bar indicator sequence is the base sequence that XagI can recognize that, black inverted triangle represents restriction enzyme site.
Fig. 3 is detection case schematic diagram of the functional label in hairiness and hairless wild cabbage
M represents marker, and C01 represents hairiness wild cabbage parent, and C41 represents hairless wild cabbage parent, F1 generation table Hybrids F1,
Undigested represents not to be digested.
Embodiment
Be a kind of embodiment of the inventive method below, but be not the restriction to the inventive method, it is any not
Surpass the conversion from substantive content of the present invention, protection scope of the present invention should be belonged to.
The acquisition of the molecular labeling of embodiment 1
A hairless wild cabbage C41 (B.oleracea var.alboglabra, from the collection of Dutch germplasm resource bank, compile by collection
Number CGN17275) (collected with the wild wild cabbage B.incana of a hairiness from German plant genetic and crop research institute, collection numbering
BRA1166) exemplified by the F2 segregating populations of development, the method for obtaining and accurate related molecular marker being whether there is with epidermal hair is described in detail,
It is specific as follows：
(1) informative population and phenotypic evaluation：
F1 generation, F1 generation selfing again, plantation are produced with the wild wild cabbage B.incana hybridization of a hairless wild cabbage and a hairiness
In crop field, F2 is obtained for plant.The 10 leaf phases of plant observe by the naked eye the presence or absence of first leaf upper table fur.
(2) SNP chip is analyzed
94 parts of F2 plant are randomly choosed, young leaflet tablet is gathered in seedling stage, DNA (Doyle, 1991) is extracted using CTAB methods,
Rape 60K SNP chips analysis (Illumina Inc., CA, USA) is carried out after purification, and the SNP of acquisition is corresponded into wild cabbage reference
Genome (http://brassicadb.org/brad/index.php), and (the Takagi et carried out according to Takagi methods
Al., SNP results and epidermal hair phenotype 2013) are associated analysis, a significant pass is detected from C01 chromosomes
Connection is interval, the interval span 1.04Mb (such as Fig. 1).
(3) candidate gene approach：
From public database (http://brassicadb.org/brad/index.php) the above-mentioned 1.04-Mb intervals of inquiry
Interior all wild cabbage genes, according to corresponding function annotation and the existing literature relevant with plant epidermal hair, screen one and table
Fur develops relevant gene BoTRY (such as Fig. 1).
(4) functional label conversion and detection：
DNA is extracted to hairless wild cabbage parent and hairiness wild cabbage parent, entered using the microarray datasets of Illumina HiSeq 2500
Row weight sequencing analysis, it is found that both BoTRY genes have SNP in code area.According to wild cabbage BoTRY gene orders, design can
The primer of above-mentioned SNP site is amplified, its forward primer sequence is 5 '-TTAAAATTTGGAAGATGGAGGC-3 ', reverse primer
Sequence is 5 '-GCCAACAGGAGGAAGATCTCA-3 '.According to above-mentioned SNP types and neighbouring sequence, it is determined that its base can be distinguished
The restriction enzyme of type is XagI (such as Fig. 2).
Enter performing PCR amplification and XagI digestions, digestion products in hairless and hairiness parent, F1 plant and 19 F2 materials
After being separated through 1.5% agarose gel electrophoresis, it is found that hairless parent and 7 parts of hairless F2 659-bp single band only occur (no
Can digestion type)；There are two kinds of specific bands of 276-bp and 373-bp (can digestion type) in hairiness parent and 7 parts of hairiness F2 plant；F1
And there are tri- kinds of bands (heterozygous) of 659-bp, 276-bp and 373-bp simultaneously in 5 parts of hairless F2 plant, determine that it is heterozygous genes
Type plant (such as Fig. 3).
The application of molecular labeling described in embodiment 2
It is a kind of to whether there is application of the molecular labeling being closely related in wild cabbage breeding, its step with cabbage leaves epidermal hair
It is：
It is (non-with 50 parts of F2 plant of hairless wild cabbage C41 and hairiness wild cabbage C01 (material source be the same as Example 1) hybridization development
It is used for the material that SNP chip is analyzed in embodiment 1) it is research material, there are 17 parts of performance hairiness, 33 parts of performances in the plant part
It is hairless.Identified that step is as follows using the mark developed in embodiment 1：
1) using wild cabbage individual plant DNA as template；
2) performing PCR process is entered using following primer：
The positive sequence of primer is：5’-TTAAAATTTGGAAGATGGAGGC-3’
Primer reverse sequence is：5’-GCCAACAGGAGGAAGATCTCA-3’；
3) PCR reaction systems：Cumulative volume is 10 μ L, specific composition such as following table：
The amplification system of table 1
4) PCR amplification programs：94 DEG C of 5min, [94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min] × 35 are circulated, 72 DEG C of 10min.
Run and preserved after finishing under the conditions of 4 DEG C.
5) digestion of pcr amplification product：Every 10 μ l handle 1h with 2.5U Restriction Enzyme XagI under the conditions of 37 DEG C；
4) after digestion products are separated through 1.5% agarose gel electrophoresis, the single bands of 659-bp only occur (can not digestion
Type) have 14 parts of materials, its performance is hairless；Only there is having for two kinds of specific bands of 276-bp and 373-bp (can digestion type)
17, be hairiness individual；Occur tri- kinds of bands (heterozygous) of 659-bp, 276-bp and 373-bp simultaneously has 19 parts of materials,
Show as hairless, thus it is speculated that it is heterozygous genotypes plant.
5) select 3 parts of the material (hairless) of the single bands of 659-bp occur in above-mentioned " 4) ", 276-bp and 373- only occur
3 parts of the material (hairiness) of two kinds of specific bands of bp, while there is the hybrid material of tri- kinds of bands of 659-bp, 276-bp and 373-bp
3 parts (hairless), respectively selfing produces F2：3 familys, are planted in investigation seedling stage epidermal hair phenotype behind crop field.It was found that preceding 2 class material
Phenotype is not separated, and consistent with previous generation's phenotype；The previous generation shows as 3 parts of three kinds of bands without batt material, its F2:3 familys
There is the segregation phenomenon of epidermal hair character.The concrete outcome sees attached list 1.
The digestion result of table 1
6) to 258 parts of F2 in table 1:3 plant carry out molecular markers for identification, on all one's life on behalf of can digestion type and can not digestion
The plant of type, its F2:The digestion result of 3 plant is identical from generation to generation with upper one；On plant all one's life on behalf of heterozygous, it is produced
97 parts of F2:The digestion result of 3 plant is separated, wherein 19 parts of hairiness individual is digested (be can digestion type), remaining
In 78 parts of hairless individuals, there are 23 parts can not be digested (be can not digestion type), 55 parts show as heterozygous.
Above-mentioned qualification result shows, identifies that, with screening, 276-bp only occurs in reservation by Functional marker in breeding
Material with two kinds of specific bands of 373-bp is that homozygosis has batt material；Retain and 659-bp, 276-bp and 373-bp occur simultaneously
The material of three kinds of bands, can improve the efficiency and accuracy of next round selection, mitigate the workload of later stage Screening and Identification (in theory
It can reduce 33%), accelerate breeding process.
SEQUENCE LISTING
<110>Southwestern University
<120>The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair
<130> 2017
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 659
<212> DNA
<213> artificial
<220>
<223>Molecular labeling Boltrichome-caps01
<220>
<221>SNP site
<222> (378)..(378)
<223>N is a or g
<400> 1
ttaaaatttg gaagatggag gcaagaaatg tgtgttgttt ctcatgatcc aatatctctc 60
tatctccaca gcttttcttc ccggtactct tcctgctatt atttcccacc tggtattttg 120
caagaaaaca tttttctctc taagaatgga aatacataag taaataataa aatgtttgat 180
acaagtgatt agcttggatc ccattctgct tattaagcta agaagtccct aagcgtagca 240
aaaagttaaa aaaaaaaaca cctagacact aaaacttagg tctagtagtt cctaattaat 300
gaaactacgt acaaactata actaattaga acaagaacat gaagcagcaa ttgaaagatc 360
aagtaggcct aagagagngc aaggacactt agaccagaag gcgatggtga ttcaaaaggt 420
cactctgaaa cgacaagaac gattttcttc atcatcagga gatggttatt tttttttttt 480
gtttgttcaa cagatcatca ggcgatggta agcgtaagaa tataagtaca ttcctatgtc 540
atatgttttg tggtaaagtc gttacatcta attttgggag agaaagaaat taaaagaaga 600
tacgtaccta tcgcctacga gtctgtacat tcttaagatg agatcttcct cctgttggc 659
<210> 2
<211> 22
<212> DNA
<213> artificial
<220>
<223>Forward primer
<400> 2
ttaaaatttg gaagatggag gc 22
<210> 3
<211> 21
<212> DNA
<213> artificial
<220>
<223>Reverse primer
<400> 3
gccaacagga ggaagatctc a 21
Claims (9)
1. cabbage leaves epidermal hair whether there is the molecular labeling Boltrichome-caps01 being closely related, it is characterised in that：Have
Nucleotide sequence as shown in SEQ ID No.1.
2. cabbage leaves epidermal hair whether there is the primer for the molecular labeling Boltrichome-caps01 being closely related, its feature exists
In：Its forward primer sequence has the nucleotide sequence as shown in SEQ ID No.2, and reverse primer sequences have such as SEQ ID
Nucleotide sequence shown in No.3.
3. the authentication method of head cabbage varieties, it is characterised in that：Comprise the following steps：Using the genomic DNA of kind to be identified as mould
Plate, amplifier molecule mark Boltrichome-caps01, using restriction enzyme XagI digestion amplified productions, digestion result is entered
Occur after row electrophoresis, electrophoresis 659-bp single band for the homozygosis kind without epidermal hair, there is 276-bp and 373-bp two
Band is the homozygosis kind for having epidermal hair, at the same occur tri- kinds of bands of 659-bp, 276-bp and 373-bp for without epidermal hair
Heterozygosis kind；The primer pair of described amplifier molecule mark has the nucleotides as shown in SEQ ID No.2 and SEQ ID No.3
Sequence.
4. purposes of the molecular labeling in wild cabbage breeding described in claim 1.
5. purposes of the molecular labeling in the head cabbage varieties of seed selection skin factor of different hair character described in claim 1.
6. purposes of the molecular labeling primer in wild cabbage breeding described in claim 2.
7. purposes of the molecular labeling primer in the head cabbage varieties of seed selection skin factor of different hair character described in claim 2.
8. purposes of the authentication method of the head cabbage varieties described in claim 3 in wild cabbage breeding.
9. use of the authentication method of the head cabbage varieties described in claim 3 in the head cabbage varieties of seed selection skin factor of different hair character
On the way.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710454777.9A CN107164502B (en) | 2017-06-15 | 2017-06-15 | Molecular marker closely related to existence of skin hair of cabbage leaf and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710454777.9A CN107164502B (en) | 2017-06-15 | 2017-06-15 | Molecular marker closely related to existence of skin hair of cabbage leaf and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107164502A true CN107164502A (en) | 2017-09-15 |
| CN107164502B CN107164502B (en) | 2020-09-08 |
Family
ID=59819280
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710454777.9A Expired - Fee Related CN107164502B (en) | 2017-06-15 | 2017-06-15 | Molecular marker closely related to existence of skin hair of cabbage leaf and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107164502B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108103162A (en) * | 2018-01-12 | 2018-06-01 | 中国农业科学院蔬菜花卉研究所 | The core SNP marker identified for cabbage hybrid and its application based on KASP technological development |
| CN108300801A (en) * | 2018-04-25 | 2018-07-20 | 西南大学 | The molecular labeling and application that a kind of and rape grain weight and Pod length are closely related |
| CN108546775A (en) * | 2018-07-04 | 2018-09-18 | 山东省农业科学院蔬菜花卉研究所 | The InDel labels and its detection primer of a kind of Chinese cabbage burr and application |
| CN109706266A (en) * | 2019-03-12 | 2019-05-03 | 西南大学 | Identify wild cabbage epidermal hair whether there is or not molecular labeling and its development approach and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2385130A1 (en) * | 2010-05-03 | 2011-11-09 | Université de Picardie Jules Verne | Method for producing recombinant proteins from plant hairy roots |
| CN103789343A (en) * | 2008-06-26 | 2014-05-14 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and method for making the same |
| CN104611404A (en) * | 2015-01-15 | 2015-05-13 | 甘肃农业大学 | Method for identifying hybrid seeds of winter cole-wort and mustard type winter rape |
| CN106497971A (en) * | 2017-01-13 | 2017-03-15 | 扬州大学 | A kind of cabbage type rape hairy root induction and cultural method rapidly and efficiently |
-
2017
- 2017-06-15 CN CN201710454777.9A patent/CN107164502B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789343A (en) * | 2008-06-26 | 2014-05-14 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and method for making the same |
| EP2385130A1 (en) * | 2010-05-03 | 2011-11-09 | Université de Picardie Jules Verne | Method for producing recombinant proteins from plant hairy roots |
| CN104611404A (en) * | 2015-01-15 | 2015-05-13 | 甘肃农业大学 | Method for identifying hybrid seeds of winter cole-wort and mustard type winter rape |
| CN106497971A (en) * | 2017-01-13 | 2017-03-15 | 扬州大学 | A kind of cabbage type rape hairy root induction and cultural method rapidly and efficiently |
Non-Patent Citations (2)
| Title |
|---|
| FENG LI, ET AL.: "Association of sequence variation in Brassia GLABRA1 orthologs with leaf hairiness.", 《MOL BREEDING》 * |
| MULU AYELE, ET AL.: "Whole genome shotgun sequencing of Brassica oleracea and its application to gene discovery and annotation in Arabidopsis.", 《GENOME RESEARCH》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108103162A (en) * | 2018-01-12 | 2018-06-01 | 中国农业科学院蔬菜花卉研究所 | The core SNP marker identified for cabbage hybrid and its application based on KASP technological development |
| CN108103162B (en) * | 2018-01-12 | 2021-06-29 | 中国农业科学院蔬菜花卉研究所 | Core SNP marker for cabbage hybrid identification based on KASP technology development and application thereof |
| CN108300801A (en) * | 2018-04-25 | 2018-07-20 | 西南大学 | The molecular labeling and application that a kind of and rape grain weight and Pod length are closely related |
| CN108300801B (en) * | 2018-04-25 | 2021-11-16 | 西南大学 | Molecular marker closely related to rape grain weight and silique length and application |
| CN108546775A (en) * | 2018-07-04 | 2018-09-18 | 山东省农业科学院蔬菜花卉研究所 | The InDel labels and its detection primer of a kind of Chinese cabbage burr and application |
| CN108546775B (en) * | 2018-07-04 | 2022-03-18 | 山东省农业科学院蔬菜花卉研究所 | InDel mark of Chinese cabbage burrs as well as detection primer and application thereof |
| CN109706266A (en) * | 2019-03-12 | 2019-05-03 | 西南大学 | Identify wild cabbage epidermal hair whether there is or not molecular labeling and its development approach and application |
| CN109706266B (en) * | 2019-03-12 | 2022-04-01 | 西南大学 | Molecular marker for identifying existence of cabbage epidermal hair and development method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107164502B (en) | 2020-09-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chung et al. | Chromosomal polymorphism of ribosomal genes in the genus Oryza | |
| Fall et al. | Genetic diversity in cowpea [Vigna unguiculata (L.) Walp.] varieties determined by ARA and RAPD techniques | |
| CN105349684B (en) | With the molecular labeling of the anti-rough dwarf disease main effect QTL compact linkage of corn | |
| CN107164502A (en) | The molecular labeling being closely related and its application are whether there is with cabbage leaves epidermal hair | |
| Sharma et al. | Development and validation of heat-responsive candidate gene and miRNA gene based SSR markers to analysis genetic diversity in wheat for heat tolerance breeding | |
| CN105907884B (en) | Rice blast resistant gene Pita specific molecular marker primer and application | |
| CN110305978A (en) | SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association | |
| CN104611332B (en) | Rice blast resistant gene Piz t specificity SNP marker primers and application | |
| Yang et al. | Methods for developing molecular markers | |
| CN108384875A (en) | A kind of and the relevant insertion/deletion site of capsicum mellow fruit color gene, molecular labeling, molecular labeling primer and application | |
| CN105802960B (en) | Molecular labeling and its application | |
| Kumar et al. | Identification and validation of informative SSR markers suitable for ensuring the genetic purity of brinjal (Solanum melongena L.) hybrid seeds | |
| CN103866006B (en) | Molecular marker M3B-1a and M3B-2a of Semen Tritici aestivi anti growing out QTL site QPhs.sicau-3B.1 and application thereof | |
| CN109688805A (en) | The method for generating gray leaf spot resistance maize | |
| CN106498048A (en) | A kind of QTL related to soybean nodulation number, SNP marker and application | |
| CN109371160A (en) | SNP marker relevant to Salt Resistance of Rice and Low DO tolerance and its application | |
| Alhasnawi et al. | Application of inter simple sequence repeat (ISSR) for detecting genetic analysis in rice (Oryza sativa L.) | |
| CN104928299B (en) | Leaf Spot Caused by Corynespora cassiicola on Cucumber disease-resistant gene Cca and its encoding proteins and application | |
| CN104946630B (en) | Disease-resistant linkage molecular marker for cucumber target spot disease and special primer and application thereof | |
| CN107586881B (en) | Corn molecular marker and application thereof in detecting corn flowering phase related traits | |
| Hamon et al. | Coffea genome organization and evolution | |
| CN109680097A (en) | The molecular labeling and application that a kind of and sclerotinia sclerotiorum stem resistance is closely related | |
| CN108588261A (en) | A kind of identification is located at InDel primers and its application of the late bolting QTL on radish R02 chromosomes | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN107988337A (en) | A kind of labeling method and its application of rice blast resistant rice identification method and gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200908 Termination date: 20210615 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |