CN107164463B

CN107164463B - SNP marker for determining and/or genetically improving growth traits of pigs

Info

Publication number: CN107164463B
Application number: CN201710288567.7A
Authority: CN
Inventors: 黄路生; 麻骏武; 李景; 彭颂; 钟烈鹏; 周李生; 杨斌
Original assignee: Jiangxi Agricultural University
Current assignee: Jiangxi Agricultural University
Priority date: 2017-04-27
Filing date: 2017-04-27
Publication date: 2020-06-26
Anticipated expiration: 2037-04-27
Also published as: CN107164463A

Abstract

The present application relates to a SNP marker for determining and/or genetically modifying pig growth traits. The SNP markers include at least one of 14 SNP markers, which are respectively located at 16806345 th site, 16940077 th site, 17473931 th site, 17013787 th site, 17096014 th site, 17007981 th site, 16916995 th site, 17102194 th site, 17114026 th site, 16682972 th site, 16765047 th site, 16788727 th site, 16767555 th site and 17472686 th site on chromosome 17 of the 10.2 version international pig genome.

Description

SNP marker for determining and/or genetically improving growth traits of pigs

Technical Field

The present application relates to a SNP marker for determining and/or genetically modifying pig growth traits.

Background

The growth traits are important indexes in pig economic traits, so the growth traits are important production traits in pig genetic improvement research, and mainly comprise one or more of pig carcass length, carcass oblique length, carcass weight, chest and back fat thickness, total cervical vertebra length and the like. The traditional pig breeding method is to eliminate unqualified pigs after artificial measurement and visual observation of pig breeds. The traditional breeding method has certain effect, but the real valuable breeding pigs are easily eliminated by mistake, the continuity is not strong, and long-term planning is not available. The genetic improvement method based on the major gene molecular marker is scientific, long-acting, economical and rapid, and is a necessary supplement for traditional pig breeding.

The long history of farming and unique dietary culture in China cause the preference of people in China for pork, and the pig is the head of six livestock and the food pig is said to be in good weather. In the recent years, due to severe market fluctuation, the quantity of live pigs stored in the pigsty of China is reduced, and the pork yield is reduced to a small extent. Therefore, by technological innovation, excellent breeds are cultivated, the pig raising production efficiency is improved, and promotion of industrial upgrading and technological progress is a necessary way for ensuring sustainable growth of the pig raising industry.

Most of domestic pigs which are listed in the market of China at present are Du-growing three-way hybrid pigs, but so far, major genes and molecular markers related to the growth traits of the pigs are not identified by scientific and technical means.

Disclosure of Invention

One of the present applications provides a SNP marker for pigs, which includes at least one of the following 14 SNP markers,

first SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 16806345 from the 5' end¹Nucleotide Y corresponding to position 346 from the 5' end of SEQ ID NO. 1¹Said Y is¹Selected from G or A;

second SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 16940077 from the 5' end²Nucleotide Y corresponding to position 578 from the 5' end of SEQ ID NO. 2²Said Y is²Selected from C or T;

the third SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 17473931 from the 5' end³Nucleotide Y corresponding to the 501 th site from the 5' end on SEQ ID NO. 3³Said Y is³Selected from G or A;

the fourth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 17013787 from the 5' end⁴Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 4⁴Said Y is⁴Selected from C or T;

the fifth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 17096014 from the 5' end⁵Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 5⁵Said Y is⁵Selected from G or A;

sixth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 17007981 from the 5' end⁶Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO 6⁶Said Y is⁶Is selected from A or G;

seventh SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 16916995 from the 5' end⁷Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 7⁷Said Y is⁷Selected from C or T;

eighth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 17102194 from the 5' end⁸Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 8⁸Said Y is⁸Selected from C or T;

ninth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 17114026 from the 5' end⁹Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 9⁹Said Y is⁹Selected from G or A;

tenth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 16682972 from the 5' end¹⁰Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 10¹⁰Said Y is¹⁰Selected from G or C;

eleventh SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 16765047 from the 5' end¹¹Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 11¹¹Said Y is¹¹Selected from G or A;

twelfth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 16788727 from the 5' end¹²Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 12¹²Said Y is¹²Selected from G or T;

thirteenth group of inventionsSNP markers: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 16767555 from the 5' end¹³Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO 13¹³Said Y is¹³Is selected from A or G;

the fourteenth SNP marker: 10.2 version of the International porcine genome No. 17, nucleotide Y at position 17472686 from the 5' end¹⁴Nucleotide Y corresponding to position 301 from the 5' end of SEQ ID NO. 14¹⁴Said Y is¹⁴Is selected from G or C.

In a specific embodiment, the SNP marker is selected from at least one of a first SNP marker, a second SNP marker, a third SNP marker, a fourth SNP marker, a fifth SNP marker, a sixth SNP marker, a seventh SNP marker, and an eighth SNP marker.

The second application provides a nucleic acid sequence comprising the SNP marker as described in the first application, the nucleic acid sequence being selected from at least one of a DNA sequence, a cDNA sequence and an RNA sequence. The nucleic acid sequence is located on chromosome 17 of version 10.2 of the international porcine genome. For example, the nucleic acid sequence is the claimed nucleic acid sequence as long as it includes the SNP marker, no matter how long the length is, for example, the length can be 10bp, 15bp, 20bp, 30bp, 50bp, 80bp, 100bp, 120bp, 150bp, 180bp, 200bp, 250bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 1000bp, 1200bp, 1500bp, 2000bp, etc., but the nucleotide sequence is not limited to the listed length. In addition, the SNP marker is typically located at or relatively near the center of the selected nucleic acid sequence, e.g., in a 20bp selected fragment, the SNP is typically at one of positions 7-14 in this 20bp DNA fragment; in the 1500bp DNA fragment, the choice of the position of the SNP is greatly increased, which can be a position in the 100-position 1400, preferably a position in the 300-position 1200, and more preferably a position in the 500-position 700, so as to facilitate more accurate detection of the SNP marker; however, in cases where the detection technique is particularly sensitive and/or very specific, the SNP marker may also be located near one of the two ends of the selected nucleic acid sequence, even the first or last position.

In a specific embodiment, the nucleic acid sequence is selected from at least one of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13 and SEQ ID NO 14.

In a specific embodiment, the nucleic acid sequence is selected from at least one of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 8.

The third aspect of the present application provides a method for detecting and/or genetically modifying a growth trait in a pig, the growth trait comprising at least one of pig carcass length, pig carcass bias length, pig carcass weight, pig breast and back fat thickness, and pig cervical spine total length.

In one embodiment, the pig is selected from at least one of a purebred shoal, a purebred white pig, a synthetic line containing long white blood lines, a matched line containing long white blood lines, a hybrid pig containing long white blood lines, a synthetic line containing large white blood lines, a matched line containing large white blood lines, and a hybrid pig containing large white blood lines.

In a preferred embodiment, the pig is selected from at least one of a purebred shoal, a hybrid of duroc and shoal, and a hybrid of three species of duroc, shoal and shoal.

In order to obtain the growth traits of pigs with longer pig carcass length, longer pig carcass slant length, heavier pig carcass weight, thinner pig backfat thickness and longer total pig cervical vertebra length, the fourth application provides a method for genetic improvement of pigs, which comprises the following steps: determining SNP markers according to one of the applications of the boars in the core group of the boars, and making corresponding selections according to the SNP markers:

for the first SNP marker, selecting the boar individuals with AA and GA genotypes at the 16806345 th site in the boar core group, and eliminating the boar individuals with GG genotypes at the site to increase the frequency of the allele A at the site by generations; preferably, selecting a boar individual with the AA genotype at the 16806345 th site in the boar core group, and eliminating a boar individual with the GA and GG genotypes at the site to increase the frequency of the allele A at the site generation by generation;

for the second SNP marker, selecting the boar individuals with TT and CT genotypes at the 16940077 th site in the boar core group, and eliminating the boar individuals with CC genotypes at the site to increase the frequency of the allele T at the site generation by generation; preferably, selecting a boar individual with TT genotype at the 16940077 th site from the boar core group, and eliminating boar individuals with CT and CC genotypes at the site to increase the frequency of allele T at the site generation by generation;

selecting a boar individual with AA and GA genotypes at the 17473931 th site in the boar core group for a third SNP marker, and eliminating a boar individual with GG genotype at the site to increase the frequency of the allele A at the site by generations; preferably, selecting a boar individual with the AA genotype at the 17473931 th site in the boar core group, and eliminating a boar individual with the GA and GG genotypes at the site to increase the frequency of the allele A at the site generation by generation;

for the fourth SNP marker, selecting the boar individuals with TT and CT genotypes at the 17013787 th site in the boar core group, and eliminating the boar individuals with CC genotypes at the site to increase the frequency of the allele T at the site generation by generation; preferably, selecting a boar individual with TT genotype at the 17013787 th site from the boar core group, and eliminating boar individuals with CT and CC genotypes at the site to increase the frequency of allele T at the site generation by generation;

for the fifth SNP marker, selecting the boar individuals with AA and GA genotypes at the 17096014 th site in the boar core group, and eliminating the boar individuals with GG genotypes at the site to increase the frequency of the allele A at the site by generations; preferably, selecting a boar individual with the AA genotype at the 17096014 th site in the boar core group, and eliminating a boar individual with the GA and GG genotypes at the site to increase the frequency of the allele A at the site generation by generation;

for the sixth SNP marker, selecting the boar individuals with GG and GA genotypes at the 17007981 th site in the boar core group, and eliminating the boar individuals with AA genotypes at the site to increase the frequency of the allele G at the site generation by generation; preferably, a boar individual with the gene type GG at the 17007981 th site is selected from the boar core group, and boar individuals with the gene types GA and AA at the site are eliminated, so that the frequency of the allele G at the site is increased generation by generation;

for the seventh SNP marker, selecting the boar individuals with TT and CT genotypes at the 16916995 th site in the boar core group, and eliminating the boar individuals with CC genotypes at the site to increase the frequency of the allele T at the site generation by generation; preferably, selecting a boar individual with TT genotype at the 16916995 th site from the boar core group, and eliminating boar individuals with CT and CC genotypes at the site to increase the frequency of allele T at the site generation by generation;

for the eighth SNP marker, selecting the boar individuals with TT and CT genotypes at the 17102194 th site in the boar core group, and eliminating the boar individuals with CC genotypes at the site to increase the frequency of the allele T at the site generation by generation; preferably, selecting a boar individual with TT genotype at the 17102194 th site from the boar core group, and eliminating boar individuals with CT and CC genotypes at the site to increase the frequency of allele T at the site generation by generation;

for the ninth SNP marker, selecting the boar individuals with AA and GA genotypes at the 17114026 th site in the boar core group, and eliminating the boar individuals with GG genotypes at the site to increase the frequency of the allele A at the site by generations; preferably, selecting a boar individual with the AA genotype at the 17114026 th site in the boar core group, and eliminating a boar individual with the GA and GG genotypes at the site to increase the frequency of the allele A at the site generation by generation;

for a tenth SNP marker, selecting a boar individual with CC and GC genotypes at the 16682972 th site in the boar core group, and eliminating a boar individual with GG genotype at the site to increase the frequency of allele C at the site generation by generation; preferably, the boar individuals with CC genotype at the 16682972 th site are selected from the boar core group, and the boar individuals with GC and GG genotypes at the site are eliminated, so that the frequency of the allele C at the site is increased generation by generation;

for the eleventh SNP marker, selecting the boar individuals with AA and GA genotypes at the 16765047 th site in the boar core group, and eliminating the boar individuals with GG genotypes at the site to increase the frequency of the allele A at the site by generations; preferably, selecting a boar individual with the AA genotype at the 16765047 th site in the boar core group, and eliminating a boar individual with the GA and GG genotypes at the site to increase the frequency of the allele A at the site generation by generation;

for the twelfth SNP marker, selecting the boar individuals with TT and GT genotypes at the 16788727 locus from the boar core group, and eliminating the boar individuals with GG genotypes at the locus to increase the frequency of the allele T at the locus generation by generation; preferably, selecting a boar individual with TT genotype at the 16788727 th site in the boar core group, and eliminating a boar individual with GT and GG genotype at the site to increase the frequency of allele T at the site generation by generation;

for the thirteenth SNP marker, selecting the boar individuals with GG and GA genotypes at the 16767555 th site in the boar core group, and eliminating the boar individuals with AA genotypes at the site to increase the frequency of the allele G at the site generation by generation; preferably, a boar individual with the gene type GG at the 16767555 th site is selected from the boar core group, and boar individuals with the gene types GA and AA at the site are eliminated, so that the frequency of the allele G at the site is increased generation by generation;

for a fourteenth SNP marker, selecting the boar individuals with CC and GC genotypes at the 17472686 th site in the boar core group, and eliminating the boar individuals with GG genotypes at the site to increase the frequency of the allele C at the site generation by generation; preferably, the boar individuals with CC genotype at the 17472686 th site in the boar core group are selected, and the boar individuals with GC and GG genotypes at the site are eliminated, so that the frequency of the allele C at the site is increased generation by generation.

In a specific embodiment, the SNP marker according to one of the present application is determined for the pig by analyzing the nucleic acid sequence of the pig, wherein the nucleic acid sequence is selected from the nucleic acid sequences as described in the second of the present application. Wherein a specific method for analyzing the nucleic acid sequence includes at least one of PCR-RFLP and PCR-sequencing and the method for detecting SNP as described above.

Further, commonly used methods for detecting SNPs include 1) a hybridization-based method, which is classified into at least a) a method using △ Tm, b) a method using hybridization with a fluorescent probe, 2) an enzyme-based method, which is classified into at least a) a DNA polymerase method, such as PCR amplification using DNA polymerase, b) a ligase method, c) a restriction enzyme method, d) an exonuclease FEN method, e) an RNase H method, 3) an electrophoresis method, which is classified into at least SSCP single-strand conformation polymorphism and DGGE/TGGE denaturing gradient gel electrophoresis, and 4) a direct sequencing method.

The fifth application provides a method for determining the quality of the growth traits of pigs, which comprises the following steps: determining the SNP marker of the pig according to one of the applications, and determining the growth traits of the pig according to the SNP marker:

for the first SNP marker, the growth traits of the pig with AA and GA genotypes at the 16806345 th site are better than those of the pig with GG genotype;

for the second SNP marker, the growth traits of the pigs with TT and CT genotypes at the 16940077 site are better than those of the pigs with CC genotypes;

for the third SNP marker, the growth traits of the pig with AA and GA genotypes at the 17473931 th site are better than those of the pig with GG genotype;

for the fourth SNP marker, the growth traits of the pigs with TT and CT genotypes at the 17013787 site are better than those of the pigs with CC genotypes;

for the fifth SNP marker, the growth traits of the pig with AA and GA genotypes at the 17096014 th site are better than those of the pig with GG genotype;

for the sixth SNP marker, the growth traits of the pigs with GG and GA genotypes at the 17007981 th site are better than those of the pigs with AA genotypes;

for the seventh SNP marker, the growth traits of the pigs with TT and CT genotypes at the 16916995 site are superior to those of the pigs with CC genotypes;

for the eighth SNP marker, the growth traits of the pigs with TT and CT genotypes at the 17102194 site are superior to those of the pigs with CC genotypes;

for the ninth SNP marker, the growth traits of the pigs with GG and GA genotypes at the 17114026 th site are better than those of the pigs with AA genotypes;

for the tenth SNP marker, the growth traits of the pigs with GG and GC genotypes at the 16682972 th site are better than those of the pigs with CC genotypes;

for the eleventh SNP marker, the growth traits of the pigs with GG and GA genotypes at the 16765047 th site are better than those of the pigs with AA genotypes;

for the twelfth SNP marker, the growth traits of the pigs with GG and GT genotypes at the 16788727 site are better than those of the pigs with TT genotype;

for the thirteenth SNP marker, the growth traits of the pigs with the GG and GA genotypes at the 16767555 th site are better than those of the pigs with the AA genotypes;

for the fourteenth SNP marker, the growth traits of the pigs with GG and GC genotypes at the 17472686 th site are better than those of the pigs with CC genotypes;

the growth traits comprise at least one of pig carcass length, pig carcass oblique length, pig carcass weight, pig back and forth fat thickness and pig cervical vertebra total length, the long pig carcass length is superior to the short pig carcass length, the long pig carcass oblique length is superior to the short pig carcass oblique length, the heavy pig carcass weight is superior to the light pig body weight, the thin pig back and forth fat thickness is superior to the thick pig back and forth fat thickness, and the long pig cervical vertebra total length is superior to the short pig cervical vertebra total length.

In a preferred embodiment, the SNP marker according to one of the present application is determined in said pig by analyzing the nucleic acid sequence of said pig, wherein said nucleic acid sequence is selected from the group consisting of the nucleic acid sequences as described in the second of the present application.

The beneficial effect of this application:

the 14 SNP markers of the present application are closely linked, and particularly, the first SNP marker, the second SNP marker, the third SNP marker, the fourth SNP marker, the fifth SNP marker, the sixth SNP marker, the seventh SNP marker, and the eighth SNP marker are more closely linked, and the linkage degree (r2) is 0.6. And the closely linked SNP markers are closely related to growth traits including pig carcass length, pig carcass oblique length, pig carcass weight, pig back fat thickness and pig cervical vertebra total length, so that the related indexes of the pig can be detected by at least one of the 14 SNP markers, or genetic improvement is performed by at least one of the 14 SNP markers.

Drawings

FIG. 1 shows the 60KGWAS analysis result of Du-grown commercial pig.

FIG. 2 shows the results of association analysis of 196 SNP sites within the QTL region.

FIG. 3 shows the results of analysis of the degree of Linkage Disequilibrium (LD) between significant SNPs and peripheral SNPs.

Detailed Description

The foregoing aspects of the present invention are explained in further detail below with reference to preferred embodiments, but are not intended to limit the present invention.

The Du grown-up commercial pig in the application refers to the offspring of the hybridization of the sow which is hybridized by taking a long white pig as a male parent and a large white pig as a female parent and a Duroc boar.

1. Pig whole genome 60K SNP chip scanning, quality control and type judgment

A small sample of ear tissue was collected from each individual in the first growing population, genomic DNA was extracted by standard phenol chloroform method, and the DNA was dissolved in TE buffer. Detecting the mass with a Nanodrop-ND1000 spectrophotometer to make the A260/280 ratio of 1.8-2.0 and the A260/230 ratio of about 1.7-1.9. Diluting the concentration of a DNA sample meeting the standard to 50 ng/mu l, ordering a Porcine SNP60DNA Analysis kit chip by using an Illumina Infinium SNP typing platform, carrying out chip hybridization and result scanning according to the instruction of Illumina Infinium SNP and a standard flow, and reading genotype data by using genome studio software. Quality control is carried out on the obtained genotype data by using PLINK v1.07, the detection rate is eliminated to be less than 97%, the frequency of Minor Allele Frequency (MAF) is less than 0.01, individuals with the detection rate of less than 90% and the family Mendel error rate of more than 0.1 are excluded, and finally 46351 SNPs and 610 individuals are used for data analysis.

2. Genome-wide association (GWAS) analysis

GWAS analysis was performed using the mixed linear model in the R software package GenABEL using the 60K SNP marker genotype data and carcass phenotype data of the first 610-headed and large triple-heterozygous population, with the expression y ═ μ + Xb + Kw + Sc + Za + e, where y represents the phenotypic value vector, μ represents the global mean, X is the fixed effect indicator matrix, b represents the fixed effect of batch and sex, vector K is the covariate indicator matrix, w is the individual slaughter weight covariate, S is the SNP genotype indicator matrix, c is the additive effect of detected SNPs, Z is the random effect correlation matrix, a represents the random additive genetic effect vector obeying from a to N (0, G σ α 2) (where G is the genetic relationship matrix, σ α 2 is the additive genetic variance), e is the residual.

3. 60K GWAS analysis results

GWAS results show that SNP locus rs16767555 (shown in figure 1) which is obviously related to the carcass length of the Du-growing commercial pig exists on the pig chromosome 17. This locus corresponded to 16767555bp on chromosome 17 of the international porcine genomic reference sequence (version 10.2) and it was found that individuals with the GG genotype at this locus had 2cm more carcass length than those with the AA genotype (Table 1).

Table 1 Effect of SNP rs16767555 on the straight growth of first grown Du pig carcasses

4. High-density SNP marker association analysis (QTL fine positioning)

As the marker density of the 60K chip of the pig is sparse, in order to further reduce QTL confidence interval and search causal mutation sites influencing carcass length of the Du-growing commercial pig or SNP sites strongly linked with the causal mutation sites, the applicant selects all SNPs in the QTL region around 1Mb of rs16767555 highest point of GWAS according to 60 pigs subjected to re-sequencing in a laboratory and re-sequencing data disclosed on the network, selects SNPs which are separated from the white pig and are not separated from the Duroc again, finally adds nearly 200 SNP sites for fine positioning, and the marker average density reaches 1 SNP/2 kb. And selecting the grown-up Dudu individuals with more extreme 500 phenotypic types for genotyping. 196 sites left after passing quality inspection were analyzed for correlation.

The results were: (1) as can be seen from fig. 2, a total of 81 SNP sites were associated with carcass length to a significant extent exceeding P < 2.77E-05. (2) The strongest association site is rs16806345, its P value is 5.22E-23, its favorable allele a increases carcass length by nearly 4.2cm, the a allele frequency is only 22.19% (table 2), and its P value is more significant than the strongest association site rs16767555(3.2E-17) found by the above-mentioned 60K GWAS, and 6 orders of magnitude higher than rs16767555 site. (3) Compared with GG individuals, the AG genotype individuals on the rs16806345 locus have the carcass length of 4.28cm, the carcass weight increase of nearly 7.0kg, the backfat thickness reduction of 0.28cm and the cervical vertebra total length increase of 1.3cm (Table 2), so the marker locus has great breeding value.

TABLE 2 Effect of SNP rs16806345 on the growth traits of extremely large and long pigs of phenotypic type

5. Linkage Disequilibrium (LD) analysis

Haploview version4.1 analysis software is adopted to construct a haplotype frame, and the linkage disequilibrium degree (LD) of the significant SNP and the peripheral SNPs is analyzed. The results are shown in FIG. 3.

Example 2

In this example, in order to verify the effect of SNP markers with top 14 degrees of significance of association obtained in example 1, they were expanded to a population of 1847 large commercial pigs for gene detection, although the 1847 individuals were from populations of different pig farms at different periods, the association analysis results showed that the association between rs16806345 and body length (P value) reached 3.082E-23, and even though the association between rs17472686 site and body length (P value) reached 2.45E-12 (Table 3). in a biometrical sense, when the association between SNP site and phenotype reached 1 × 10^-5It can be seen that the correlation of 14 SNP markers such as the rs16806345 site and pig carcass length is extremely significant, and the favorable allele A at the rs16806345 site can increase the carcass length by about 2.41cm, the frequency of the favorable allele A in the Duchang big pig is only 18.28% (Table 4), so that the method has a large breeding space.

Example 3

Taking the detection of the rs16806345 site as an example, the correlation between one of the 14 closely linked SNP markers in example 2 and the growth trait of swine was evaluated.

The applicant further detects the separation condition of the rs16806345 locus in the Changbai and Dabai commercial pure breeding pigs and evaluates the influence of the locus on the body length of the Changbai and Dabai commercial pure breeding pigs so as to provide theoretical and technical support for the molecular breeding of the growth traits of the two varieties.

After the gene typing detection is carried out on 297 pure white and 163 pure white samples by using an rs16806345 site specific detection probe (sequence: FAM-TAGTACACAGTGGCCCCACTTC-MGB, VIC-TAGTACACAGTAGCCCCACTTC-MGB), the frequency of the favorable allele of the site in the white is only 9.9 percent, but the phenotype and the gene correlation still reach the utmost significance (P is 0.00164, Table 5); whereas, the favorable allele frequency reached 63.8% in the growth white, and the genotype and phenotype were also strongly correlated (P. 0.00341), and the favorable allele had the effect of increasing the length of the 1.27cm living body (table 6). The result verifies that the rs16806345 marker locus has obvious effect on body length of both large white and long white, and is suitable for body length breeding of the two varieties and pig species containing blood sources of the two varieties.

TABLE 3 most significant 14 SNP site information by association analysis

TABLE 4 Effect of SNP rs16806345 on carcass straightening in all grown-up pigs

TABLE 5 Effect of SNP rs16806345 on the growth of Large white breed pigs

TABLE 6 Effect of SNP rs16806345 on body length of growing white inbred pigs

While the present application has been described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes may be made without departing from the true spirit and scope of the application. For example, many modifications may be made to adapt a particular situation, material, composition of matter, or method step to the objective, spirit and scope of the present application. All such modifications are intended to be included within the scope of the claims set forth herein. Moreover, the technical content disclosed above is subject to some variations or modifications, which are equivalent to the equivalent embodiments, and all fall within the scope of the technical solution.

LHA1760162 nucleotide sequence List

<110> university of agriculture in Jiangxi

<120> an SNP marker for determining and/or genetically modifying pig growth traits

<130>LHA1760162

<160>14

<170>PatentIn version 3.5

<210>1

<211>846

<212>DNA

<213> pig (Sus Scrofa)

<400>1

TACACTGTGACTTTCAGGGCAAGGGTGGCAAACTGTCTTCTTGCATTGGGGTTTGATTGATAGACGGCATGAGCCAGGCTAATTAAGGAGGAGCCTGGGATAAGGGGCCTCCAACACCCAGAGCAGCAGATGTTTCTCACCCCAGGACTCCTGTAATGCCTGCTGTGGAACCCCCAAGATTCCAGGAGATTGGCTTCTTCTGGGAAGGCTTGTCATGGCAGCAGCATGTTGGGCCAGAATCCATGACCCCTGAGGCTCAGTGCATCTCAGCCCAGCCTTTCCCTGACCTCCATCAGGACTCACACTTACTCTCCACATGCAGCCACAACCACAGTAGTACACAGTY1GCCCCACTTCACCTACACATACATCAGGCCTGGCCCTGGTCCTGAGTGTCCTGTGTGATGTTCAAAGAGGAGAACATTCCCTGATGGAGGGGTTTGGGCGAAGAGGCCAGCTACCTATGGCCGGGTACTGGCAGTGGGACTGGGTTAAAGGAGGGAGCAATGTGCCGAGGCTGTTCGTTGGGGTAAAGGCCCCAGGAGTAGGTAGTGGTGGTCTCAGGGACAAATCTGACTCAGGTTCAAGCTGCCAGGGGAAATACCTGACCGGGAAGATGTTAGTGAGCTCTTGGGTCTTTTTGTGAGTGTGGATGTGTATGTATGTTTGCATGTGTTTATTTCCTTTCTAAATCTTACTTTGTGGAGTGCACTAAATTGGCTAGCCCTAGCTTTCTGGATGGCAGTGTTCAGGATGGGTAGCCCAGGACCATCTTGCCTTAAGACCAGCTGTAGCCTGTATACTCCTTGGTATACAGCGGAATCCCTTATCTGTGGCTTTGCTTTCT；

<210>2

<211>1201

<212>DNA

<213> pig (Sus Scrofa)

<400>2

AACATGGTGCCTTGTTTTCAGATGAGGAAACCGAGGCACAGAGTCATGAAGTCTTTGCCTTTGTTTCCTCATCTGTAAACAAGGCTGATCAATGAAGAAATAGATGTTCACACCCACAGTTGCCTGACTCCAAACCCCCTTTCTCCCTCCACCAGTACTGTTGATATATTTCAGAAAGTAGATTTCAGAATTTCTAAGCCAAGCATATATAGATTCAAAAAGACCCACAGTGATTCTGAACCAACTCCTAATCCAGAACATGCCCAATTGTTTGGTTGCTTTTTTTTTTTTTTTTCCTCCCCTTGACCAACAAAAAAACCACCCAATAAATGACAAAGGTGCTTTAGTCCAGTGAAAAAACACTGGAGTGTGAATTTGGAAAGTTGGGTCTGCTCTGCTACTGATAACAGTCATTTTTAGGCAAATGACTAAACATATGTCCTTCACTCAATAAATATTCACTTATTAAGCCAAAACTCAGTAATAATTGCAATGTTGTAGGCTTCTTACAGATGGAAGTATTTATAAACCATGCTCTCCACTCATATGTTACCCACGGTCTAGTGATGAACCCAGAY2ATATAAACATGCTTGACATTCATAATGATGACAAAATTCCTATAAGGGGTTTAGTTCCAAAAGCTCTTGCGTCTACCTGGATGGTCATAGAAGTCAGGAAAGCTTCACCAAGCAACGAGAGGATTAAAGTTTGCCAGGTTGATATGTAGAAGCAGAAGGGAAATTCCAGGATGAGAGAACAATATATGCAAAGACATGAAGTCTTGTTCATAGACTTGAATGTCTTGACAGAGTTGAATCATAAAGGACACAGAATTGGGCATTAGTAGCTGCAAACTATTCCATTTAGAATGGATAAGCAATGAGGTCCTGCTGTGTAGCACAGGGAACCATATCTAATCTCCTGGGATAGACCATGATGAAAGAGAATATTAAAAAGAATGTATTTATGTATGACTGAGTCACTTTGCTGTATATCAGAGACTGGTACAACATTGTAAATCGACTATACTTTAATAAGAAAAAAATGATCTTAAAAAAAAAAAAAAGGACATGTCATGCCATGCTTAAGAGTTTGAACATTCTGGAGTTCCTGTTCTGTCTCTGCAGATTACTAACGAGTCTAGTATCCATGAGGATGTGGGTTTGATCCCTGGCCCTGCTCAGTGGGTTAAGGATTCAGC；

<210>3

<211>1001

<212>DNA

<213> pig (Sus Scrofa)

<400>3

ATATTTTGTGAAGAGTAAAGTCTCAGTTTGTTTAGAACTGCATTTCAGTTCACTCAAGTCAGTCCTGATGTATGCCTGCTGTCCCTGTGTAATTATAGCAGCAATTCCTCTTACTCTCAAAAGTTTCTGGTTTAAAGGATAACTTATAGAGCTACCTTACTAATGAGGAAAAGAAACATTCAGTTTTGAAAGTGCTGCACAGATTTTTTGTTTGTTTGTTTGTTTTTGCTTTCTCAGGGCCACACCTGCAGCATATGGAAATTCCCAGGCCAGGAGCTGAATTGGAGCTGCAGCTGCAGAGTTATTCGTGATTTTAGATGAGTCAAATCCTTAGCTTTTTGGGCCTACACCACAGCCACAGTAACACAGGATCCACCCACATCTGCAACCTATACCACAGATCATGGCAATGCCATATCCTTAACCCACTGGGCAAGGCCAGGGATTAAATCCACATCTTCAAGGAAACTAGTTAGATTTGCGACCCTCTGAGACACAACY3GGAACTCCCTGCACAAGTTTTTAACCAGATCAAACTAAGTTAATGGCAGAGTTTATAGATAAACCCTTCTAACTTCCAAACTAGGAATAAATGTATTATATTGAAGTTATTCATGATTTTAGATGAGTCAAATAAGTACAAAAATCCTTAGCTTTTTTGGTGAAGCAGTGCATGCTCTATGATGCTTAGCCATGCTCTCACTTTGAGAACCTCTGTGTTCACCGAGTGTTAAAGTGAAGATAGAGGCTTGACAGTGCACCTTCCTCAGCTGCAAGCATTCACTTTTTCTTCTCAATATATAATTGACTTTATATATGTTGGAGTTTTGTCACAGTGAAAACTAGAAGTGGAGTGGAGAATTAATTTGAAATACAACATTCACAGACGAAGGTAGGGTGATGTAGGGTTAGGGTTGGTCACTTTTCCCACTCTTAGATAACAAAACTGGAAGATTACCCAGTTGGAAGGGAGAAATTGCCTCTCAACTTCTGCCTGCAAAC；

<210>4

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>4

ATCTATAGGTAACACCTTTTGATGGCAGAACTAGAGTAGGACCAGGAACAGAAATGAGATTTTTTTTTTAATGTGGGCAGAATTGAGAAGTGAACCTGGAAAGAGGCTTGAGTAGCCTTGAAGAGTACTCAATGGTCTTGATATGTGTTCATCTTTTCCAGAATGTAAGGCAACTCAAAAGCAGTTTGTTTGTTTGTTCTGTCCATCAGACTAGAAAATGGAACAGAGTGAGCACTGGACCAATGAAGTGAGGCCAAGTCATACAGAGATTCACAGAGAAGCTGGTGCCCACCATCAGGGY4CAATGTCAACGTGAGTCCCCAGGCTGGTTTACTGTAGTAGATGAAATTTGGGTTTTGAGGTACTAATTCAGCATGCCTTTTTTCCTCTCCTGGTTTAAATCAATGGAGAACAAATCCAAATGACAAGATAAGAATTTGATCTGGTATCAGAGTTTTGATCTCCAGATAGAGGATCTATGGTATGTTTCGTCTAAGGAAGAGGTGGCTGGGGCCTGAAGGCAAAGTGGAGCTGCTAGCTTGTTCCTTCACATCCTCATCTAGAACATGCCTACAGGAAGGCCTAGGTTTGTGGAGCAGGCA；

<210>5

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>5

TTAGATGTTCCAGCACTTAATTCCCACTGTGACAGTGACTCATGGGATGATTCGGGTACATCAGTTTGGTGTTCCCAACTCAGTTTCCTAAACTCTGAGATAGGACTGCCCTGTTGACTCAACCCATTGCTTGGGGTGAAGGAGGTTACAAAAAGGAAGAGCACCATGTCCCACAGGGGCATTGGAACTTCTTGTCCAATGGCTTCCTGGGCCTGGTCACGCTTCTTCTCCAGGATGATAAAGCCCATTGTTATACCATCCCCTGTTGGAGACTTTCTCATAAAGAGAGAACACATGTTGY5GTCCTAGGAGATACAGTGAGTCAGAGGAGATTAAAAAGTCCTCAGGACCGCTCATGACTTTTCTGAAGGTGTCCACTGACTCACCAAAGCCCTTACATCTGGAAGGAGTTTACAAGTTGAAAATACTATTAGGCATAAAACTTGGCCTCCTCAAAGATGTTGATAGGTGATGTCATCTGCAAATCAGCCATTTCACCTGTAGGAATCCTTTTCCCCACAATCAGAATTCGTATAAAGAGACTGGTCCAAGATGGCCTTTAGGAGATCAAGTGAATCCTGGGGGATCCTGAGATAGACCTA；

<210>6

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>6

GATCACCATACGAAATACGTTGGCTATCATACATCGACCATTTGCTTTTTTGGCTTCTCTAGTCCTTGTAAATAGGTTCAGCTTTATTTTCCCTATTAAACAGGTGTTTTCAGGTATCTGAATGCTATGGTTTGAATTGTGTACTAAAAAAAGCTATGTTGAAATCCTAATCCCCAAACCTCAGAAGGTGACTTTATTTGGAAATAGGGTCTTTGCAGATGTTGTTAAGAAGAAGTCATACTGGAGTAATCTTGGCCCTTAACCCAATATGATTTGTGTCCTTAAAAGAAGAGAAGAGGTY6CAACTACTATGGAAAATAATATGGAGGTTCCTCAGAAAATGGAATATAGACTACCATATGATCACACTCCTGGGCATCTATCCAGATAAAACTACAATTCAAAAAGATTCACACACCCCTATGTTCATAGCAACACTATTCACAATATCCAATACATGGAAACAACCTAAATGCCCATTGATGGATGAATGGATTAAGAAGATGCAATATGCATACATATACATACATATATATATATATATGTGTGTGTGTATATATGTATATATGTATATATTCACCCCTATGGGTTTCAGAGGGACT；

<210>7

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>7

CAACCTCAGTCAGCTTCAGTTGGCTTCAATGAGTTGATAAGCTCTGGTAAATACATCTCACCTAAACAGTTCTTGCTATGGAAGATAAAGCAGAGAAGGGAGGAAAAGGTGCCAAGGTGCTTAGATTTGGAGCAGAGTATACCCCACACATGCCAGTCAATCAGTTTGGCTCATCTCTCCTAGCATTCCATTCTACTGACTGTCTCCCACGGATCCAGTGGGGTTTTCACACATTAACCCAATTTGTAAGCTTGGGAGTTTCCCATGAAAACTCCCTGAGCACAGGTCAGAGGTAGAAGCY7GAGAATATTTGTATGATCTTTCTTGGTATGGCTCTTTCTTGGTACTGGTAACTAAAGTTACCAGGCACAGCCTCTGATGAAACAACCGTGCTATGGTCACAGAACCTTGGCTGATGTATGTGGATGGAGCAATTCAGACATTTCACGTTAGAGTTTGTGGCCCCAGGAGCATGTTCTTAATTGAAAACATTATTGTCAACGTCTCTAATTCATATCACAACTTTCTTAGGAATAACTGAAAGGATCACTCATAAAAATATTATTACTGAAAGAAATGGAGATAATCTTGTCTAATCCCTT；

<210>8

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>8

CTTTAAAAAAAAGAAGAACCAGGCTGGTGACCTAAGCCTTTCCTGTGGAATATCATGGGTGTTTTATATATGACATGGAAAGCTAATAAAGTTGACATGTTTGAAAACATTCTCTGATTCTACTTATGCAGTTCTGGGTTCAATAAATAGGTATCATGTTTGTTTTCTGTACTACATGTAAAGGTAATAAGTAAATTGATATTTTTGAAAACACTCTGATTACACATTCATGTTTTCAATAAACAGGCATTCAAGCTCTCAAGGAGATAAGCCTTATGCTGAACACTCTGTTACATGAAGY8GAAATAGGACTGCTTCTGCCTCTAGGAGATACCATAACCCAGTACAACTCTAACTTGTGGAAGTGGAAGCTCTCCATCCTTTCTGAGCTGGCCAAGAAGGATGATGGAGACAGTAAGTAAATGGAGTTTGGAAAAGCAAGCTGTACAAAGGGTCCAGACGTGTGGGCACAGGAGGGGCTGGGGGACAACCCAACGTGCGAAGAGAACAGAATTTATTAGAAGTCAAGGTAACAAGAGGCTATTTGAGGCCGCCCATTCCATCTACCATGTGCTAATATTATGACAGTAATGATTCATCTG；

<210>9

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>9

AGAAAAATCTTAGAGCTACAACAATAATGTAATTTTTTGTCCAAATCAGGACACTTCTGAGAGCAAAATGGAGTTTTATTAGTAATAACATCCAGGAAAACATGTCATTCTTTGCTTTCTAAAGCCCAGATATTGTTGAGGAAACAAAGCGATATATATACCTGTAAATTTTCAGCATTGATAAAATGAGACATCTATATTTTGATGGTTAACATGCATGTTAGAAACAAAAAGATTTTGATAATATCATCACTTTATCTGTTTCCTTTATCTTCAAAGTGCCTTTTTGCTGCAAGTAACY9ATAGTCAGAGACTGCGTAGGAAACAGAATTTCTCTAGAAAGCATTTAACTGAAAAGAAATAATATGGGGTTATGCACAGATATGTGAGTAGAAGTTTTTAAAAATTTACATGTATATATATGCATGCATCTTTATAGATATCACCTTATATGTTCGTTTTATTATATATACATATATGTATGTATATAAACATATATTGATAACATGCTTTTAATGAAGAGACTTCACTTTTTGGAGCCGTCTTAGGCTTACAGAAATAATGCAAAAGTATAGAGACTTCCCATATACCTCCTCTACCT；

<210>10

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>10

CAGCCAGCCTTCAAGGGAAGCAATTGATCACAACCTGTCATCTTTAAAGGCCAGAAGAATGCAAAATAAACACTTGGGATTAGTGTACTAAATATGGTTCATCAGTCTTCAGCTCTGCCCTCTGATAATTCATCTATCTCATTTATTTTAATGCTTTATCATGTATCTCCCCAGCTCTGTAATTAGCCTTTCAGGTATTCTCTTTTTCTTCCTGCCTTTGAAATGGTGTGTGGTGAGATTCTACAAGGAGAGGATATTATTACCATCCCTTACAAAAGAAGCAACTCCTGCAATAATTCTY10TTTTATAGCTTACGTGCTGGAATTCTTGCTGAAACTTAGAGGGTGTGTTAAAGTGGTTTAACGAAAAAGTCTTAGCAAATTTACCTGTTCTTTTAAATGGAGAGTTTAGTTTGGCTATAGATTAACTGTTTGATTTTATAGGAGGAGTCTGGATTTAGGCTCATTAAGCCCCAAATGCTGGTTTTGATTTTTTTAAAAACCTAATGTACCAAAGTTGGCTTCCGAATTAAAGTCATTAAAGACTCACATTTTATTGATTTGTTTCTGAGTGAAGAGTTAATTTTTACTTGCCTAAAAAGA；

<210>11

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>11

CAGCAGTGACAATGCTAGATCCTTAACCTGCTGAGCCACTCCTTAAATGCTCCCTAATAAGGATTCTTGAAAGTTACCTTAAGCAGGAAAGTGACATGATAAAGTTATATTTAATTGGCAACTGATTATAGAATGGAATAACGGAGGACTGTCTAAAGCAAGATCAACTGCAGGTCATACAAACAAGACCTTACAAGAGTCTGACCTATATATACTACAGCATGTATGGAAGAAAAGAGACACACAGAGAGAGTTAAGGAGAGAATAGTTCACAGTTCTGCCTTACTAAAAGTATATGATY11GGAGAAAAAAAGTAGTAGAAAGAATTACAGGTAACTATGTTGAGTTGAACTGATTTTAGCAAGAAAAGATAACTTCGTTTCAATAAAAAAACCAAAATGTCCTTTTGCAAACAGTAGTGAAAAATACTTTTTTTTTTTTTTTTGTCTTTTTAGTGCCATATCTGTGGCATATGGAGGTTCCCGTGCTATGGATTGAATTGGAGCTGATGCCAGATCCAAGCCATGTTTGTGACCTACACCCAGCTCATGGCAATGCTGGATCCTTAACACACTGAGCGAGGTCAGGGTTGGAACCTGCAT；

<210>12

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>12

TAGACTAGAATCTTTTGCTTCCACTTTCAATGATCTATATTTTGATCATAGCGTGTCTCCCAAATTTTCATGTAGATAACTCTTTACAGCCTTAAATTAAAACTAGTCTTTATTATTATGATTCAGAAGTATATAAATTAAAAATACCTACTCTCAAGTGCCTGTTGGCCATCTGTATATCTTCTTTGAAGAAATGTTTACTCAGGTTTCTTGCCCATTTTTCAATTAGGTTCTTGGGTTTTTTTGCTCTTGAGTTGTATAAGTTGTGTGTATATTTTAGAGATTAAGCTCTTGTCAGTTY12CATCTTTTGAAACTATTTTTTCCCATTCTGTAGGTTGTCTTTTTTTTTTTTTTTTTTTAAAGGGTTTCCTTTGCTATGCAAAAGCTTGTCAGTTAGAAAAGAAACTCATGGACTTGGAGTACAGACCCATAGTTGCCAAGGAGGTAGGGGGAGGGCATGGGATGGACTGGGAGTTTGGCGTTAATTGATGTAGACTATAGCATTTGGAGTGGATAAGCAATGAGATCCTGCTGTATAGCACAGGGAATTGTATCTTGTCACTTATGATGGAACATGATGGAGGATAATGTGAGAAAAAGA；

<210>13

<211>601

<212>DNA

<213> pig (Sus Scrofa)

<400>13

AATAAGTGTTTATTTATCACCAATTCTCTTCTAGGATTAGTGTTAGCCACAGTGGTAGAAATAGTTACGGTCCCGCCCTCACATGACTAGCAATGAGAGATGCAACTAGAAGAAAGCCACACAATTACAAATTGAGTTGGGCACAATAAAGCAGGCTAAAATAAAACTTCTGCAAAAGATATTAGTGATATTCTGACTTAGGTTGGGGATGGTGGGGGAGGTAGTAGAAAAAAGCTTCCTGAAAAGGCAACATTTCAGCTGACACCTTCATGATGAGTAGGGAACAGCTAAGGAAAGAGTY13AAAGTAGGAGTGTTCTAGCAAAGGGCAGACTCGGTATGTCCAAAAGCTTGCTGTGCTAAGGAATTGGAGGAGCTTTAGGACATACACAACTTGTGCTTGTATCTAGGGAATGGAAGTAGACAATAGCATAGGCTAAAATATCTATGTTAATTATTTCTCTAAAATGTGAAGATTTGCACTATTTGGGGGTAACTACCCTTAGACATACAACATCCTCTTGTTCTATTCTTTCCTTTCTTGTTATTAAAACACAGAAGTTATACATAATATCTTGAATAATTTTTCCCACTTCTTCACTAC；

<210>14

<211>600

<212>DNA

<213> pig (Sus Scrofa)

<400>14

GCATATGGAGGTTCCCAGGCTAGGGGTCCAATCGGAGCTGTAGCCACTGGCCTACGCCAGAGCCACAGCAATGCAGGATCCGAGTTGCATCTGCGACCCACACCATAGCTCATGGCAAGGCCGGATCCTCAACCCACTGAGCAAAGCCAGGGATGGAACCTGCAACCTCATGGTTGCTAGTCGGATTCGTTAACCACTGCACCACGATGGGAACTCCGTGGCTTAATTTTCTTTGTGGGAGTCAGGTGGGGGAATTTTTAGTAGAAATTTTCTAGTCCATTGAAATTTTTGAATAAGGGTY14AAAACCCTTGAGCACACCAATACAAATACTTTTCAAGATATCACATAACATTTGCTTTAGGGAAAACAAAAATATAAAACTCTCTAATGAATGAATCACCAACACAACACTCTTACACCAAAAGTTTCTCTTTGCTATTTCTTTTTTCTTCTTCTTTTTTTTGGGGGGTGCGGGGGGGCCACATCCTCGGCATATGGAAGTTCCCAGGCTAGGGGTCAAATCAGAGCTGCAGCTGCTGGCCACAACCACAGCCATAGCAACTCCGGACCCAAGACACATCTGCACCCTACACCACAGCT。

Claims

1. The SNP marker of the pig has the nucleic acid sequence of SEQ ID NO. 1, and the SNP marker is nucleotide Y of 16806345 th site from 5' end on 17 th chromosome of 10.2 version international pig genome¹Nucleotide Y corresponding to position 346 from the 5' end of SEQ ID NO. 1¹Said Y is¹Is selected from G or A.

2. Use of the SNP marker of claim 1 to determine and/or genetically modify growth traits in swine including at least one of swine carcass length, swine carcass skew length, swine carcass weight, swine backfat thickness, and swine cervical spine total length.

3. The use according to claim 2, wherein the pig is selected from at least one of a purebred shoal pig, a synthetic line containing long white blood, a matched line containing long white blood, a hybrid pig containing long white blood, a synthetic line containing large white blood, a matched line containing large white blood, and a hybrid pig containing large white blood.

4. The use according to claim 3, wherein the pig is selected from at least one of a purebred shoal, a hybrid of Duroc and shoal, and a hybrid of Duroc, shoal and shoal.

5. A method of genetic improvement in a pig, the method comprising: determining the SNP markers of claim 1 for a swine in a swine core group, and making a corresponding selection based on the SNP markers:

and selecting the boar individuals with AA and GA genotypes at the 16806345 th site in the boar core group, and eliminating the boar individuals with GG genotypes at the site to improve the frequency of the allele A at the site by generations.

6. The method of claim 5, wherein the swine individuals with AA genotype at the 16806345 site are selected from the swine core group, and swine individuals with GA and GG genotypes at the site are eliminated to increase the frequency of allele A at the site generation by generation.

7. The method of claim 5, wherein the analyzing the nucleic acid sequence of the swine is used to determine the SNP marker of claim 1 of the swine, wherein the nucleic acid sequence is SEQ ID NO 1.

8. A method of determining the goodness of a growth trait in a pig, the method comprising: determining the SNP marker according to claim 1 of the pig, and determining the growth traits of the pig according to the SNP marker:

the growth traits of the pig with AA and GA genotypes at the 16806345 site are superior to those of the pig with GG genotype;

9. The method of claim 8, wherein the pig is analyzed for the nucleic acid sequence of SEQ ID NO. 1 to determine the SNP marker of claim 1.