CN107090518B - Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit - Google Patents

Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit Download PDF

Info

Publication number
CN107090518B
CN107090518B CN201710216967.7A CN201710216967A CN107090518B CN 107090518 B CN107090518 B CN 107090518B CN 201710216967 A CN201710216967 A CN 201710216967A CN 107090518 B CN107090518 B CN 107090518B
Authority
CN
China
Prior art keywords
reverse primer
probe
primer
air
flow
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710216967.7A
Other languages
Chinese (zh)
Other versions
CN107090518A (en
Inventor
王勇强
刘洋
张鑫磊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Association Gene Technology Co Ltd
Original Assignee
Suzhou Association Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Association Gene Technology Co Ltd filed Critical Suzhou Association Gene Technology Co Ltd
Priority to CN201710216967.7A priority Critical patent/CN107090518B/en
Publication of CN107090518A publication Critical patent/CN107090518A/en
Priority to PCT/CN2018/081752 priority patent/WO2018184531A1/en
Application granted granted Critical
Publication of CN107090518B publication Critical patent/CN107090518B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a diarrhea-associated pathogen multiple RT-PCR combined gene chip detection kit, which uses multiple specificity conservative degenerate primer combinations and probe combinations to detect one or more of 26 diarrhea-associated pathogens and is provided with an endogenous control, a positive control and a negative control. The detection kit improves the coverage rate of a target sequence of a high mutation pathogen, avoids the problem of non-specific cross reaction between multiple primers and probes, can realize the simultaneous detection of more than 20 diarrhea-related pathogens by a single reaction system, and provides a simple and sensitive detection tool with high rapid flux and multi-index parallel detection for the diarrhea-related pathogen detection.

Description

Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit
Technical Field
The invention relates to the technical field of nucleic acid detection, in particular to a diarrhea-related pathogen multiplex RT-PCR combined gene chip detection kit.
Background
Diarrhea caused by pathogen infection is a common clinical multiple disease, and about 20 hundred million cases of diarrhea occur worldwide each year, and 220 million people, including 180 million children, die of the diarrhea are important causes of infant death. Diarrhea can occur all the year round, wherein the diarrhea is concentrated in summer and autumn, and the infection is mostly caused by the spread of food or water source pollution through feces mouths, so that sudden public health events such as mass morbidity, epidemic outbreak and the like can be caused, and the public health and the social and economic development are directly harmed. Common infectious pathogens of the diarrheal diseases comprise viruses, bacteria, parasites and the like, and the etiology of the diseases and the epidemic situation is complex, so that rapid and accurate multi-index pathogen detection provides sufficient basis for diagnosis and treatment of the diseases and provides basis for control of the epidemic situation.
Currently, the common diarrhea-associated pathogen detection technology includes two aspects of pathogen antigen detection and nucleic acid detection. Enzyme-linked immunosorbent assay (ELISA), immune test paper and other methods are the main protein-based detection methods at present, and the methods are convenient and rapid to use, but have the defects of relatively low detection sensitivity and easy occurrence of false negative along with the variation of antigen protein; meanwhile, the antigen detection is susceptible to various factors, so that false positive is caused. Nucleic acid-based detection methods are currently the most common and accurate pathogen detection technology, and mainly include PCR (polymerase chain reaction) technology and gene chip technology based on molecular hybridization. At present, the PCR technology is still most widely applied, and commonly used technical methods comprise methods such as common qualitative PCR, nested PCR, multiplex PCR, fluorescent quantitative PCR and the like. The common qualitative PCR method has low detection efficiency, and is more time-consuming and labor-consuming when detecting a multi-gene object; although the sensitivity of detection is improved by the nested PCR, the detection efficiency is also problematic; the fluorescence quantitative PCR method has high sensitivity, but has high cost, needs special detection instruments and has limited number of detection indexes of a single tube. The multiple PCR method can detect a plurality of genes simultaneously in one reaction, can realize multiple amplification and detection, and has the technical difficulty that the cross-linking reaction among a plurality of primers in the PCR process is avoided, the optimal reaction conditions of each amplicon are consistent, the detection capability of the currently conventionally designed multiple PCR is about 10 indexes, and the more optimal design scheme of the multiple primers can obviously improve the multi-index detection capability of the method. The gene chip is a very practical pathogen detection technology at present, and can be matched with a multiple PCR technology for use, so that multiple amplification and multi-index detection of target pathogens are realized.
The diarrhea-associated pathogen detection needs to solve the following problems: firstly, the pathogens are various, and dozens of common pathogens are found, including various RNA viruses, DNA viruses, pathogenic Escherichia coli, other pathogenic bacteria and parasites, and the like. Complex etiology requires detection technologies that can achieve parallel detection of up to 20 indices or more, and have the ability to detect both nucleic acid RNA and nucleic acid DNA. Secondly, a large part of diarrhea related pathogens have the characteristic of rapid evolution, and the same pathogen corresponds to a large group of different variant genes and has the capacity of mutating new variant genes in a short time. This feature presents a great challenge to clinical assays, requiring detection techniques that have good coverage of a large set of mutated genes and the ability to tolerate genetic variations. Thirdly, the diarrhea disease is a clinical multiple common disease, has the characteristics of quick onset and concentrated outbreak, requires that a detection technology can simultaneously process a plurality of clinical samples in a short time and has the capabilities of quick detection and high-throughput detection.
Disclosure of Invention
The invention aims to solve the problem of low detection coverage rate of conventional primers and probes on high mutation pathogens, solve the problem of parallel detection of a single reaction system of more than 20 diarrhea-related pathogens and solve the problem of non-specific cross reaction between the multiple primers and the probes by using a multiple specificity conservative degenerate primer combination and a probe combination, overcome the defects of less detection indexes, time and labor waste of the single reaction system in the prior art, and provide a diarrhea-related pathogen gene detection kit which is simple in operation, rapid and sensitive and has high detection flux.
The invention relates to a diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit, which is used for detecting one or more of the following pathogens: adenovirus, astrovirus, norovirus type GI, norovirus type GII, rotavirus, sapovirus, salmonella, shigella, campylobacter, clostridium difficile, clostridium perfringens, enterotoxigenic escherichia coli, enterohemorrhagic escherichia coli, enteropathogenic escherichia coli, enteroinvasive escherichia coli, enteroaggregative escherichia coli, vibrio cholerae, vibrio parahaemolyticus, yersinia enterocolitica, aeromonas hydrophila, listeria monocytogenes, enterobacter sakazakii, staphylococcus aureus, cryptosporidium, giardia intestinalis, and amebiasis dysentery;
a primer combination and a probe combination of diarrhea-related pathogens are arranged in the kit, and an internal contrast of a human GAPDH gene, a positive contrast and a negative contrast are arranged at the same time;
the purpose of the invention is realized by the following technical scheme:
the diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit is composed of a primer combination, a probe combination, a gene chip, auxiliary materials and a preparation solution.
The invention is characterized in that the Primer combination is one or more groups of multiple specificity Conserved region Degenerate primers (multiple specificity Conserved Primer, wherein the nucleotide of Degenerate site is represented as R ═ A/G, Y ═ C/T, M ═ A/C, K ═ G/T, S ═ C/G, W ═ A/T, H ═ A/C/T, B ═ C/G/T, V ═ A/C/G, D ═ A/G/T, N ═ A/C/G/T), the base sequence of each pair of primers is 5' -3 ', wherein the reverse Primer 5' end is marked with Cy5 fluorescent group: adenovirus, reverse primer 5' end with Cy5 mark:
a forward primer: CAGACAGGTCRCAGCGACTG the flow of the air in the air conditioner,
reverse primer: cy5-5' -AAGTAGGTGCTGGCCATGTC;
astrovirus, reverse primer 5' end with Cy5 mark:
a forward primer: TRGARCACTGCCTNTCDCGGAC the flow of the air in the air conditioner,
reverse primer: cy5-5' -YRGRCTTRCTAGCCATCRCAC;
norovirus type GI, reverse primer 5' with Cy5 marker:
a forward primer: GCARGCCATGTTCCGYTGGA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCGTCYTTAGACGCCATCATCAT;
norovirus GII type, reverse primer 5' with Cy5 mark:
a forward primer: CTGGCTCCCAGYTTYGTGAA the flow of the air in the air conditioner,
reverse primer: cy5-5' -CAATRGCRGCACCRRCWACG;
rotavirus, the reverse primer 5' end carries a Cy5 mark:
a forward primer: CCATCTWCACATGACCCTCTATGAGC the flow of the air in the air conditioner,
reverse primer: cy5-5' -ACGSCCCTATAGCCATTTAGGT;
the 5' end of a reverse primer of the arenavirus carries a Cy5 mark:
a forward primer: CCCTCCATYTCAAACACTA the flow of the air in the air conditioner,
reverse primer: cy5-5' -VAAYTWYGAYYWGGCYCTCG;
salmonella, reverse primer 5' with Cy5 marker:
a forward primer: GYACGATATTCAGTGCGATCAGGA the flow of the air in the air conditioner,
reverse primer: cy5-5' -TTAACAGTGCTCGTTTACGACCTG;
shigella, the reverse primer 5' end carries Cy5 mark:
a forward primer: GGCCTTCCAGACCATGCTCG the flow of the air in the air conditioner,
reverse primer: cy5-5' -CAGTGCGGAGGTCATTTGCT;
campylobacter, with Cy5 mark at the 5' -end of the reverse primer:
a forward primer: TGAGTGCTATTAAAGGYATTGATKTRGGT the flow of the air in the air conditioner,
reverse primer: cy5-5' -CCATAATGKCCAAATCCWCCRCTT;
clostridium difficile, the reverse primer 5' end carries Cy5 mark:
a forward primer: GCACCATCAAIAACATATAGAGAGCCAC the flow of the air in the air conditioner,
reverse primer: cy5-5' -CCAAGCAAATACTCTATTTGGAGCATTAGG;
the clostridium perfringens, the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: CCAGYCATAAARTCATTTCCTGGGT the flow of the air in the air conditioner,
reverse primer: cy5-5' -TCAACTAGTGGTGARAAAGATGCTGG;
enterotoxigenic escherichia coli, the reverse primer 5' end is marked by Cy 5:
a forward primer: ACAGAAATCTGAATATAGCTCCGGCA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GGTGCATGATGAATCCAGGGT;
enterohemorrhagic escherichia coli, the reverse primer carries a Cy5 mark at the 5' end:
a forward primer: CAAAGACGTATGTAGATTCGCTGAATGTC the flow of the air in the air conditioner,
reverse primer: cy5-5' -ACTATCAATCATCAGTAAAGACGTACCTCC;
enteropathogenic Escherichia coli, and a reverse primer is marked by Cy5 at the 5' end:
a forward primer: GGATTTTTCTGGTGATAATACCCGYTTAGG the flow of the air in the air conditioner,
reverse primer: cy5-5' -AGTCTTTCTTRTTGTATGACTCATGCCA;
enteroinvasive Escherichia coli, and a reverse primer with a Cy5 mark at the 5' end:
a forward primer: GTAGACATAGGTTCTTCTGTT the flow of the air in the air conditioner,
reverse primer: cy5-5' -GTTGCCCCACGCTGGTTGTC;
escherichia coli with intestinal aggregation, the reverse primer with Cy5 mark at 5' end:
a forward primer: CCATTTATCGCAATCAGATTAARCAGCGA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCTACAATTATTCCTTTTGACCAATTCGGA;
vibrio cholerae, reverse primer 5' end with Cy5 mark:
a forward primer: GGCCCAACGTCCAAACGAGG the flow of the air in the air conditioner,
reverse primer: cy5-5' -TCGAAATGGCTTGGGTTAAGCT;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: CGAAGTTGTACGATTAGGAAGCAACG the flow of the air in the air conditioner,
reverse primer: cy5-5' -ACGCCAAACAAACTCGTGAAGCT;
yersinia enterocolitica, reverse primer 5' end with Cy5 mark:
a forward primer: TYAGTGAGAACCAGTATTCCGCT the flow of the air in the air conditioner,
reverse primer: cy5-5' -CTGGTCGCGGCACAATTGGT;
the 5' end of the reverse primer of the aeromonas hydrophila is marked with Cy 5:
a forward primer: MGAGCTCTACAAGGCYGAYATCTC the flow of the air in the air conditioner,
reverse primer: cy5-5' -TRACGAAGGTGTGGYTCCAGTTCG;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: CAGCATCTCCGCCTGCAAGTC the flow of the air in the air conditioner,
reverse primer: cy5-5' -TTCTTGGCGGCACATTTGTC;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: AAGTMTTCGKGCTGCGAGTT the flow of the air in the air conditioner,
reverse primer: cy5-5' -TTGCTCTYTAACAATCCGGAACAAGCT;
staphylococcus aureus, reverse primer 5' with Cy5 mark:
a forward primer: TKTTTYGAAAGRRCAATACRC the flow of the air in the air conditioner,
reverse primer: cy5-5' -GTGATGCATYTGCTGAGCTAC;
cryptosporidium, reverse primer 5' end with Cy5 mark:
a forward primer: GCTGAATTAGAATCGACATGCCCA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GGTGGRCATTCYTTTGCAGGA;
giardia intestinalis, the reverse primer 5' end carries a Cy5 mark:
a forward primer: CAGACGTGGAGTCTGCGGCT the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCYCGTTGTCGCARTGGAGC;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: GGGAGCTTTACAGATGGCTACCA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCCCTCCAATTGATTTCGTAGGAGAA;
internal source control GAPDH gene, and the 5' end of the reverse primer carries Cy5 mark:
a forward primer: ATCTTCCAGGAGCGAGATCC the flow of the air in the air conditioner,
reverse primer: cy5-5' -AGGGGGCAGAGATGATGAC;
and the probe set is one or more nucleic acid probes sequentially fixed on the surface of the gene chip, including diarrhea-associated pathogen-specific conservative degenerate probes, GAPDH internal control probes, positive heterozygote probes and negative heterozygote probes, wherein the nucleotide at the degenerate position is represented by R ═ a/G, Y ═ C/T, M ═ a/C, K ═ G/T, S ═ C/G, W ═ a/T, H ═ a/C/T, B ═ C/G/T, V ═ a/C/G, D ═ a/G/T, N ═ a/C/G/T), the 5' end of each probe is given an amino tag (NH2), and the base sequence of each probe is 5' -3 ' as follows:
adenovirus probe:
NH2-5’-GAMACCGCYTAYTCTTACAAAGTGCGCTTTACGCTGGCCGTGGGCGACAACCGGGTKTT；
astrovirus probes:
NH2-5’-TGYDAAGCAGCTTCGTGANTCTGGHYTNCCDGCYAGRCTCACWGAAGAGCAACTYCATC；
norovirus GI type probes:
NH2-5’-GCGNTTCCAYGAYYTNRGNYTDTGGACAGGRGAYCGCRATCTBYTRCCCGAWTWYGTRA；
norovirus GII-type probe:
NH2-5’-GAAGATGGCGTCGARTGACGCCARCCCATCTGATGGGTCCRCRGCCARCCTYGTCCCAG；
rotavirus probe:
NH2-5’-CCATCTWCACATGACCCTCTATGAGCRCAATAGTTAAAAGCTAACACTGTCAAAAACCT；
sandwave virus probe:
NH2-5’-TTTGKKDGYHYCTTCABTGKRRCBVHCTKGVHCNRKNVCTGYACCRCCTATRAACCADG；
salmonella:
and (3) probe:
NH2-5’-AATCAACCAGAWAGGTAGGTAATGGRATGACGAACATAGAAATGATCATCACCATTAGT；
shigella probe:
NH2-5’-GAAACTTCAGCTCTCYACTGCCGTGAAGGAAATGCGTTTCTATGGCGTGTCGGGAGTGA；
campylobacter probe:
NH2-5’-TTYTATGGTTTAGCWGGTGKRGGATATGARGATTTTTCWAAWGSYGCTTWTGATAATAA；
clostridium difficile probes:
NH2-5’-ATGACGTATTGGAAGTACAAAAAGAAGAACTTGATTTGTCAAAAGATTTAATGGTATTA；
clostridium perfringens probe:
NH2-5’-CCCATTCTTGAGTTTTTCCATCCTTTGTTTTGATTCCAAARTACATGTAGTCATCTGTT；
enterotoxigenic escherichia coli probe:
NH2-5’-GAGGATGGTTACAGATTAGCAGGTTTCCCACCGGATCACCAAGCTTGGAGAGAAGAACC；
enterohemorrhagic escherichia coli probe:
NH2-5’-TAGATTCGCTGAATGTCATTCGCTCTGCAATAGGTACTCCATTACAGACTATTTCATCA；
enteropathogenic E.coli probes:
NH2-5’-TGGSGAATACTGGCGAGACTATTTCAAAAGTAGYGTKAACGGCTATTTCCGCATGAGCG；
intestinal invasive E.coli probes:
NH2-5’-TTATTTCCTTATGTTCAAGGAAATAATTGTTGGCCTCCTTCTCTCTTTTTGCTTGTCTC；
enteroaggregative E.coli Probe:
NH2-5’-CGCCTAAAGGATGCCCTRATGATAATATACGGAATATCAAAAGTAGATGCTTGYAGTTG；
vibrio cholerae probe:
NH2-5’-CTCGCAATGATTTGCATGACTTTGTTTGGCGAGAGCAAGGTTTTGAAGTCGATGATTCC；
vibrio parahaemolyticus probe:
NH2-5’-AAAGCCGTATACTCCTGATGTTGGCGGAGAGACCAAACGAAGTTTTAACCCGTAACGAG；
yersinia enterocolitis probe:
NH2-5’-CACCAAAACCTTTCACTGATATGTAGTTGAGTAAAAACATCAGGGCGAGGAACARCGCA；
aeromonas hydrophila probe:
NH2-5’-VCTGAGYGGYTTCCTGCGYTGGGGYGGCAAYGCCTGGTAYACCCAYCCGGACAAYCGYC；
listeria monocytogenes probes:
NH2-5’-CCAATCGAAAAGAAACACGCGGATGAAATCGATAAGTATATACAAGGRTTGGAYTAYAA；
sakazakii probe:
NH2-5’-CAYACCGCGMATHCCTKWTTACSGARRAATRCRGCAGCRTGTCTGTTTCAATTTTCAGC；
staphylococcus aureus probe:
NH2-5’-AGAGGTTTTTCWWWTTCRCTACTAGTTGYTTAGTGTTAAYTTTAGTTGTAGYTTCAAGT；
cryptosporidium probe:
NH2-5’-ATTCRATATTTGAAAATGGAAAATGTAAAGTGATTAAAASTATTGATATGGTCTGCCCA；
giardia intestinalis probe:
NH2-5’-TGACTCAACGCGYGCACCTCACCAGGCCCRGACGCGCGGAGGACCGACAGCCGGGYGCG；
amebic dysentery probe:
NH2-5’-CGACACATAACTCTAGAGTTGAGTAAAATCAATTCTTGAAGGAATGAGTAGGAGGTAAA；
internal control GAPDH gene probe:
NH2-5’-TCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTT；
positive probe for cross-point:
NH2-5’-CCCTCGGGTTAATGCGCGATTGTCACCACACGTTGCGAGTTATGTTGCTGCGGAGATGG；
negative heterosis probe:
NH2-5’-GATCGTCGTTGGGCTTTAGATTTCTCTTATAGGCTCGGTCGGCGCCTCTCGCCCCGAGC；
the gene chip is a solid-phase supporting medium with a probe array fixed on the surface, and the solid-phase supporting medium is a glass sheet, a silicon wafer, a nylon membrane or a nitrocellulose membrane.
The diarrhea-related pathogen detection kit comprises a primer combination, a probe combination, a gene chip, auxiliary materials and a preparation solution, wherein the auxiliary materials are a One-Step reverse transcription amplification Reagent (One Step RT-PCR Reagent), Ultrapure Water (Ultrapure Water) and positive oligonucleotide single-stranded DNA with a Cy5 mark at the 5 'end, and the base sequence of the positive oligonucleotide single-stranded DNA with a Cy5 mark at the 5' end is Cy 5-5'-CCATCTCCGCAGCAACATAACTCGCAACGTGTGGTGACAATCGCGCATTAACCCGAGGG-3'.
The diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit comprises a primer combination, a probe combination, a gene chip, auxiliary materials and a preparation solution, wherein the preparation solution comprises a chip sample solution, a chip cleaning solution, a hybridization solution, a cleaning solution I and a cleaning solution II.
In the scheme, the chip sample solution is 50% DMSO; the chip washing solution is 5XSSC (20 XSSC: 3M NaCl, 0.3 MNa)3Citrate·2H2O, pH 7.0), 0.2% SDS; the hybridization solution is 5XSSC, 0.1% SDS; cleaning solution I is 0.5XSSC, 0.1% SDS; cleaning solution II was 0.05 XSSC.
The invention designs and adopts a specially designed multiple specificity conserved Degenerate Primer (multiple specific conserved Primer) to amplify a target sequence. The diarrhea-associated pathogens are various in types, twenty common pathogens are found, and a large part of the common pathogens are highly mutable pathogens, such as norovirus, rotavirus, saporovirus and the like, the sequence variation is large, the evolution is rapid, and even a plurality of different variants exist in the same pathogen. Aiming at the characteristics of multiple types and quick variation of diarrhea-related pathogens, the invention solves two technical problems in the design of multiple primers: firstly, a specific conservative degenerate primer is designed to ensure the specificity of the primer among different pathogens, especially the specificity among different subtype pathogens, and simultaneously, the conservative property and the detection coverage of the primer among different variant strains of the same pathogen are ensured. Secondly, the problem of multiple amplification of a single reaction system of more than 20 pathogens is solved, and mutual cross-linking between primers is avoided through mutual matching design between the primers.
The invention adopts a One-step reverse Transcription multiplex RT-PCR (One-stepRev Transcription Polymerase Chain Reaction) amplification technology based on multiple specific conservative degenerate primers to detect diarrhea-related pathogens. The multiple RT-PCR method is to put multiple pairs of primers into the same reaction tube and to perform reverse transcription reaction and PCR amplification reaction in the same system in sequence, so as to achieve the purpose of detecting multiple target RNA/DNA sequences simultaneously in a single-tube reaction system.
The invention adopts a group of specific conservative degenerate probes to detect the target sequence in the multiple RT-PCR product. The degenerate probe is designed with long probe of 59 nucleotides, and has relatively high detection sensitivity and fast combination with target gene. The 5' end of the specificity conservative degenerate probe is modified by amino (NH2), so that the probe is convenient to be combined with a gene chip.
The invention adopts gene chip to detect diarrhea relative pathogen molecule hybridization, and gene chip technology is based on nucleic acid molecule hybridization principle. The working process comprises the steps of firstly, sequentially arranging and fixing single-chain probes aiming at various diarrhea-related pathogens in a specific area on the surface of a solid-phase support medium to form a low-density probe array, hybridizing a multiple RT-PCR product to be detected with the low-density probe array, hybridizing a target gene sequence in the product with probes on the support medium, coupling a marker on a target sequence product DNA, reading corresponding hybridization signals through corresponding washing, fluorescence scanning and other steps, and simultaneously detecting a plurality of diarrhea-related pathogen target sequences on one chip.
The invention has the beneficial effects that:
1) provides a diarrhea-related pathogen multiplex PCR primer and a detection probe combination, and solves the problem of multiplex amplification and detection of a single reaction system of more than 20 pathogens; 2) the detection probe and the primer are designed by adopting specific conservative degenerate oligonucleotide, so that the detection coverage of a target sequence is improved, and the method is particularly suitable for detecting diarrhea-related pathogens with high mutation characteristics; 3) the design avoids non-specific cross reaction among different primers in a multiple system; 4) the design avoids non-specific amplification between the primer and potential non-target sequences in the sample; 5) designing to avoid non-specific hybridization of the probe with non-target sequence product DNA; 6) the method is simple to operate, can synchronously detect various diarrhea-related pathogens in the sample by single-chip hybridization through one-time sample pretreatment and single-tube RT-PCR amplification, and has the characteristics of parallel analysis and multiple judgment; 7) the test objects are complete, 26 common diarrhea-related pathogens are contained, and a new detection sequence can be conveniently added; 8) the kit adopts a gene chip detection mode, so that the multi-index parallel detection capability of the system is improved; 9) the kit is simple and convenient to operate, and is suitable for large-scale detection of diarrhea-related pathogens.
Drawings
FIGS. 1-3 show the hybridization results of the gene chip for detecting diarrhea-associated pathogens samples according to the present invention, wherein:
FIG. 1 is a schematic diagram of a probe distribution pattern of a chip;
FIG. 2 is a graph showing the results of the measurement of 26 diarrhea samples;
FIG. 3 shows 27 positive controls (26 pathogen standard nucleic acid molecules and 1 GAPDH internal control standard nucleic acid molecule) and 1 negative control (H)2O) a detection result graph.
Detailed Description
The diarrhea-associated pathogen multiplex RT-PCR combined gene chip detection kit is used for detecting one or more of the following pathogens: adenovirus, astrovirus, norovirus type GI, norovirus type GII, rotavirus, sapovirus, salmonella, shigella, campylobacter, clostridium difficile, clostridium perfringens, enterotoxigenic escherichia coli, enterohemorrhagic escherichia coli, enteropathogenic escherichia coli, enteroinvasive escherichia coli, enteroaggregative escherichia coli, vibrio cholerae, vibrio parahaemolyticus, yersinia enterocolitica, aeromonas hydrophila, listeria monocytogenes, enterobacter sakazakii, staphylococcus aureus, cryptosporidium, giardia intestinalis, and amebiasis dysentery; meanwhile, an internal contrast of a human GAPDH gene, a positive contrast and a negative contrast are arranged. Besides the combination of the primer and the probe, the kit also comprises a gene chip, auxiliary materials and a preparation solution.
The first embodiment is as follows: a diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit.
1) Design and preparation of multiple specificity conservative degenerate primers and probes:
downloading nucleic acid sequences of each pathogen from a nucleic acid database, performing multiple sequence alignment (NCBI database, ClustalW), and generating a degenerate sequence according to the alignment result (Python program); eliminating high variation regions in the sequence (Python program), generating a plurality of pairs of candidate primers (Primer3, Python program) through a Primer design process, and analyzing the specificity of the candidate primers by sequence alignment so as to avoid cross reaction (BLAST +) with other nucleic acids in the sample; then evaluating the compatibility of primers among different target genes, wherein the evaluation content comprises Tm value similarity, primer dimer tendency and 3' terminal hybridization tendency (Python program), and finally generating a multiple degenerate primer combination; specific conservative degenerate probes (Python program) were then designed using the corresponding program based on the primer amplification region, and the probe specificity was analyzed by sequence alignment to avoid cross-reactivity (BLAST +) with other nucleic acids in the sample. The same design method is adopted for internal source reference GAPDH. The positive control probe and the negative control probe are oligonucleotides of 59 nucleotides generated randomly, and are prevented from generating non-specific cross linking with a pathogen sequence to be detected through sequence alignment. And generating a positive oligonucleotide single-stranded DNA according to the positive control probe, wherein the sequence of the positive oligonucleotide single-stranded DNA is the reverse complementary sequence of the positive control probe. The primer and probe combination and the corresponding control sequence are synthesized by a solid phase phosphoramidite triester method. Finally, the performance of the probe and the primer is verified through an experimental method.
2) Preparing a gene chip:
each nucleotide probe (probe dissolved in chip sample solution with concentration of 10. mu. mol/L) was distributed in a specific position region on an optical amino chip using a micro-quantitative dot-jet gene chip sample applicator. And (3) drying the chip at 80 ℃ for 2 hours to fix the probe, washing the fixed chip in a cleaning solution for 5 minutes, washing the chip by using absolute ethyl alcohol, centrifugally drying the chip, and storing the processed chip at room temperature. The probe array layout coated on the surface of the chip is shown in figure 1.
3) Preparing a positive standard nucleic acid molecule:
positive standard nucleic acid molecules for each pathogen and internal control were prepared using a gene synthesis method, which includes a PCR amplification region and a region of 150 nucleotides each upstream and downstream. The synthetic sequence is inserted into pET-30a plasmid vector, and then is extracted, purified and quantified by plasmid, and diluted to 105copies/. mu.l, used as a positive standard nucleic acid molecule for multiplex PCR amplification and gene chip detection.
4) Preparing a PCR reaction premix: the SuperRT One Step RT-PCR Kit (CWBIO) is used, and the system contains components such as reverse transcriptase, DNA polymerase, RNase inhibitor, dNTP and the like. For each reaction tube, 15. mu.l of a premix of the reaction was prepared, the premix comprising: 2 XRT-PCR reaction buffer (12.5. mu.l), enzyme mixture (0.5. mu.l), primer mixture (2. mu.l), wherein the primer mixture contains amplification primers of each pathogen, wherein each Cy 5-labeled primer concentration is 3.75. mu. mol/L, and each non-labeled primer concentration is 2.5. mu. mol/L.
5) Extracting sample nucleic acid: the clinical samples to be detected are collected, and the types of the samples can be feces, anal swabs and other samples. Then, nucleic acid is extracted from the sample by using a suitable nucleic acid extraction technique (e.g., Viral genomic DNA/RNA extraction Kit Viral DNA/RNA Kit, CWBIO; fecal genomic extraction Kit, TIANGEN).
6) Multiplex PCR amplification reaction: a25. mu.l amplification system was used, consisting of: PCR reaction premix (15. mu.l), nucleic acid (5. mu.l) and ultrapure water (5. mu.l) were extracted from the sample. A positive control (positive standard nucleic acid molecule) and a negative control (sterile water) were set at the same time, and the positive control and the negative control were mixed in the same system. Each reaction tube was then subjected to multiplex PCR amplification according to the following procedure: holding at 45 ℃ for 30 minutes (reverse transcription); hold at 95 ℃ for 2 minutes (hot start); then 35 thermal cycle processes are carried out, wherein the temperature is maintained at 94 ℃ for 30 seconds, the temperature is maintained at 55 ℃ for 30 seconds, and the temperature is maintained at 72 ℃ for 30 seconds; finally, the temperature was maintained at 72 ℃ for 5 minutes.
7) Gene chip hybridization detection: putting the microarray face of the chip into hybridization equipment, adding 20 mu L of multiplex PCR amplification product into the prepared hybridization solution (prepared before use, 500-1000 mu L of hybridization solution (5XSSC, 0.1% SDS) at the dot array position, simultaneously adding 1 mu L of positive oligonucleotide single-stranded DNA with the concentration of 2 mu mol/L), carefully covering the upper cover of a hybridization box, and hybridizing for 1 hour at 50 ℃; taking out the chip, putting the chip into a 42 ℃ cleaning solution I (0.5XSSC, 0.1% SDS) for cleaning for 2 minutes, then putting the chip into a 42 ℃ cleaning solution II (0.05XSSC) for cleaning for 2 minutes, and centrifugally spin-drying; the chip is scanned with a suitable fluorescence scanner (e.g., Boo LuxScan 10k scanner), and the results are interpreted based on the fluorescence signal of the hybrid junction.
Example two: and (4) detecting a positive sample of diarrhea-related pathogens.
Diarrhea positive samples with the following pathogens were used, sample types were stool samples: adenovirus, astrovirus, norovirus type GI, norovirus type GII, rotavirus, sapovirus, salmonella, shigella, campylobacter, clostridium difficile, clostridium perfringens, enterotoxigenic escherichia coli, enterohemorrhagic escherichia coli, enteropathogenic escherichia coli, enteroinvasive escherichia coli, enteroaggregative escherichia coli, vibrio cholerae, vibrio parahaemolyticus, yersinia enterocolitica, aeromonas hydrophila, listeria monocytogenes, enterobacter sakazakii, staphylococcus aureus, cryptosporidium, giardia intestinalis, and amebiasis dysentery amoeba, for a total of 26 positive samples. Positive controls (26 pathogen standard nucleic acid molecules and 1 internal GAPDH target standard nucleic acid molecule) and negative controls (sterile water) were set simultaneously and the detection was performed in the same procedure. The primer and probe combination, the auxiliary materials, the preparation solution and the reference standard plasmid molecules are obtained in the first embodiment.
Nucleic acid is extracted from the sample using a nucleic acid extraction Kit (Viral genomic DNA/RNA extraction Kit Viral DNA/RNA Kit, CWBIO; fecal genomic extraction Kit, TIANGEN), and the nucleic acid is finally dissolved in 50. mu.l of nucleic acid eluent. 5ul of nucleic acid samples were aspirated for multiplex PCR amplification. A25. mu.l amplification system was used, consisting of: PCR reaction premix (15. mu.l), nucleic acid (5. mu.l) and ultrapure water (5. mu.l) were extracted from the sample. A positive control (positive standard nucleic acid molecule) and a negative control (sterile water) were set at the same time, and the positive control and the negative control were mixed in the same system. Each reaction tube was then subjected to multiplex PCR amplification according to the following procedure: holding at 45 ℃ for 30 minutes (reverse transcription); hold at 95 ℃ for 2 minutes (hot start); then 35 thermal cycle processes are carried out, wherein the temperature is maintained at 94 ℃ for 30 seconds, the temperature is maintained at 55 ℃ for 30 seconds, and the temperature is maintained at 72 ℃ for 30 seconds; finally, the temperature was maintained at 72 ℃ for 5 minutes.
The specific process of detecting the multiple PCR products by using the gene chip method is the same as that in the first embodiment, and then the result interpretation is carried out according to the color development condition of the hybrid point. As a result, 26 specimens were detected for the presence of diarrhea-associated pathogens, and 27 positive controls (26 pathogen standard nucleic acid molecules and 1 internal GAPDH control standard nucleic acid molecule) and 1 negative control (sterile water) were correctly colored at the crossover point. The detection results are shown in fig. 2 and 3.
SEQUENCE LISTING
<110> Suzhou Xiyun Gene science and technology Co., Ltd
<120> diarrhea-associated pathogen multiple RT-PCR combined gene chip detection kit
<160>83
<210>1
<211>20
<212>DNA
<213> Artificial sequence
<400>1
cagacaggtc rcagcgactg 20
<210>2
<211>20
<212>DNA
<213> Artificial sequence
<400>2
aagtaggtgc tggccatgtc 20
<210>3
<211>22
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(14)..(14)
<223>n is a, c, g, or t
<400>3
trgarcactg cctntcdcgg ac 22
<210>4
<211>21
<212>DNA
<213> Artificial sequence
<400>4
yrgrcttrct agccatcrca c 21
<210>5
<211>20
<212>DNA
<213> Artificial sequence
<400>5
gcargccatg ttccgytgga 20
<210>6
<211>23
<212>DNA
<213> Artificial sequence
<400>6
gcgtcyttag acgccatcat cat 23
<210>7
<211>20
<212>DNA
<213> Artificial sequence
<400>7
ctggctccca gyttygtgaa 20
<210>8
<211>20
<212>DNA
<213> Artificial sequence
<400>8
caatrgcrgc accrrcwacg 20
<210>9
<211>26
<212>DNA
<213> Artificial sequence
<400>9
ccatctwcac atgaccctct atgagc 26
<210>10
<211>22
<212>DNA
<213> Artificial sequence
<400>10
acgsccctat agccatttag gt 22
<210>11
<211>19
<212>DNA
<213> Artificial sequence
<400>11
ccctccatyt caaacacta 19
<210>12
<211>20
<212>DNA
<213> Artificial sequence
<400>12
vaaytwygay ywggcyctcg 20
<210>13
<211>24
<212>DNA
<213> Artificial sequence
<400>13
gyacgatatt cagtgcgatc agga 24
<210>14
<211>24
<212>DNA
<213> Artificial sequence
<400>14
ttaacagtgc tcgtttacga cctg 24
<210>15
<211>20
<212>DNA
<213> Artificial sequence
<400>15
ggccttccag accatgctcg 20
<210>16
<211>20
<212>DNA
<213> Artificial sequence
<400>16
cagtgcggag gtcatttgct 20
<210>17
<211>29
<212>DNA
<213> Artificial sequence
<400>17
tgagtgctat taaaggyatt gatktrggt 29
<210>18
<211>24
<212>DNA
<213> Artificial sequence
<400>18
ccataatgkc caaatccwcc rctt 24
<210>19
<211>28
<212>DNA
<213> Artificial sequence
<400>19
gcaccatcaa taacatatag agagccac 28
<210>20
<211>30
<212>DNA
<213> Artificial sequence
<400>20
ccaagcaaat actctatttg gagcattagg 30
<210>21
<211>25
<212>DNA
<213> Artificial sequence
<400>21
ccagycataa artcatttcc tgggt 25
<210>22
<211>26
<212>DNA
<213> Artificial sequence
<400>22
tcaactagtg gtgaraaaga tgctgg 26
<210>23
<211>26
<212>DNA
<213> Artificial sequence
<400>23
acagaaatct gaatatagct ccggca 26
<210>24
<211>21
<212>DNA
<213> Artificial sequence
<400>24
ggtgcatgat gaatccaggg t 21
<210>25
<211>29
<212>DNA
<213> Artificial sequence
<400>25
caaagacgta tgtagattcg ctgaatgtc 29
<210>26
<211>30
<212>DNA
<213> Artificial sequence
<400>26
actatcaatc atcagtaaag acgtacctcc 30
<210>27
<211>30
<212>DNA
<213> Artificial sequence
<400>27
ggatttttct ggtgataata cccgyttagg 30
<210>28
<211>28
<212>DNA
<213> Artificial sequence
<400>28
agtctttctt rttgtatgac tcatgcca 28
<210>29
<211>21
<212>DNA
<213> Artificial sequence
<400>29
gtagacatag gttcttctgt t 21
<210>30
<211>20
<212>DNA
<213> Artificial sequence
<400>30
gttgccccac gctggttgtc 20
<210>31
<211>29
<212>DNA
<213> Artificial sequence
<400>31
ccatttatcg caatcagatt aarcagcga 29
<210>32
<211>30
<212>DNA
<213> Artificial sequence
<400>32
gctacaatta ttccttttga ccaattcgga 30
<210>33
<211>20
<212>DNA
<213> Artificial sequence
<400>33
ggcccaacgt ccaaacgagg 20
<210>34
<211>22
<212>DNA
<213> Artificial sequence
<400>34
tcgaaatggc ttgggttaag ct 22
<210>35
<211>26
<212>DNA
<213> Artificial sequence
<400>35
cgaagttgta cgattaggaa gcaacg 26
<210>36
<211>23
<212>DNA
<213> Artificial sequence
<400>36
acgccaaaca aactcgtgaa gct 23
<210>37
<211>23
<212>DNA
<213> Artificial sequence
<400>37
tyagtgagaa ccagtattcc gct 23
<210>38
<211>20
<212>DNA
<213> Artificial sequence
<400>38
ctggtcgcgg cacaattggt 20
<210>39
<211>24
<212>DNA
<213> Artificial sequence
<400>39
mgagctctac aaggcygaya tctc 24
<210>40
<211>24
<212>DNA
<213> Artificial sequence
<400>40
tracgaaggt gtggytccag ttcg 24
<210>41
<211>21
<212>DNA
<213> Artificial sequence
<400>41
cagcatctcc gcctgcaagt c 21
<210>42
<211>20
<212>DNA
<213> Artificial sequence
<400>42
ttcttggcgg cacatttgtc 20
<210>43
<211>20
<212>DNA
<213> Artificial sequence
<400>43
aagtmttcgk gctgcgagtt 20
<210>44
<211>27
<212>DNA
<213> Artificial sequence
<400>44
ttgctctyta acaatccgga acaagct 27
<210>45
<211>21
<212>DNA
<213> Artificial sequence
<400>45
tktttygaaa grrcaatacr c 21
<210>46
<211>21
<212>DNA
<213> Artificial sequence
<400>46
gtgatgcaty tgctgagcta c 21
<210>47
<211>24
<212>DNA
<213> Artificial sequence
<400>47
gctgaattag aatcgacatg ccca 24
<210>48
<211>21
<212>DNA
<213> Artificial sequence
<400>48
ggtggrcatt cytttgcagg a 21
<210>49
<211>20
<212>DNA
<213> Artificial sequence
<400>49
cagacgtgga gtctgcggct 20
<210>50
<211>20
<212>DNA
<213> Artificial sequence
<400>50
gcycgttgtc gcartggagc 20
<210>51
<211>23
<212>DNA
<213> Artificial sequence
<400>51
gggagcttta cagatggcta cca 23
<210>52
<211>26
<212>DNA
<213> Artificial sequence
<400>52
gccctccaat tgatttcgta ggagaa 26
<210>53
<211>20
<212>DNA
<213> Artificial sequence
<400>53
atcttccagg agcgagatcc 20
<210>54
<211>19
<212>DNA
<213> Artificial sequence
<400>54
agggggcaga gatgatgac 19
<210>55
<211>59
<212>DNA
<213> Artificial sequence
<400>55
gamaccgcyt aytcttacaa agtgcgcttt acgctggccg tgggcgacaa ccgggtktt 59
<210>56
<211>59
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(19)..(19)
<223>n is a, c, g, or t
<220>
<221>misc_feature
<222>(28)..(28)
<223>n is a, c, g, or t
<400>56
tgydaagcag cttcgtgant ctgghytncc dgcyagrctc acwgaagagc aactycatc 59
<210>57
<211>59
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(4)..(4)
<223>n is a, c, g, or t
<220>
<221>misc_feature
<222>(16)..(16)
<223>n is a, c, g, or t
<220>
<221>misc_feature
<222>(19)..(19)
<223>n is a, c, g, or t
<400>57
gcgnttccay gayytnrgny tdtggacagg rgaycgcrat ctbytrcccg awtwygtra 59
<210>58
<211>59
<212>DNA
<213> Artificial sequence
<400>58
gaagatggcg tcgartgacg ccarcccatc tgatgggtcc rcrgccarcc tygtcccag 59
<210>59
<211>59
<212>DNA
<213> Artificial sequence
<400>59
ccatctwcac atgaccctct atgagcrcaa tagttaaaag ctaacactgt caaaaacct 59
<210>60
<211>59
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(34)..(34)
<223>n is a, c, g, or t
<220>
<221>misc_feature
<222>(37)..(37)
<223>n is a, c, g, or t
<400>60
tttgkkdgyh ycttcabtgk rrcbvhctkg vhcnrknvct gyaccrccta traaccadg 59
<210>61
<211>59
<212>DNA
<213> Artificial sequence
<400>61
aatcaaccag awaggtaggt aatggratga cgaacataga aatgatcatc accattagt 59
<210>62
<211>59
<212>DNA
<213> Artificial sequence
<400>62
gaaacttcag ctctcyactg ccgtgaagga aatgcgtttc tatggcgtgt cgggagtga 59
<210>63
<211>59
<212>DNA
<213> Artificial sequence
<400>63
ttytatggtt tagcwggtgk rggatatgar gatttttcwa awgsygcttw tgataataa 59
<210>64
<211>59
<212>DNA
<213> Artificial sequence
<400>64
atgacgtatt ggaagtacaa aaagaagaac ttgatttgtc aaaagattta atggtatta 59
<210>65
<211>59
<212>DNA
<213> Artificial sequence
<400>65
cccattcttg agtttttcca tcctttgttt tgattccaaa rtacatgtag tcatctgtt 59
<210>66
<211>59
<212>DNA
<213> Artificial sequence
<400>66
gaggatggtt acagattagc aggtttccca ccggatcacc aagcttggag agaagaacc 59
<210>67
<211>59
<212>DNA
<213> Artificial sequence
<400>67
tagattcgct gaatgtcatt cgctctgcaa taggtactcc attacagact atttcatca 59
<210>68
<211>59
<212>DNA
<213> Artificial sequence
<400>68
tggsgaatac tggcgagact atttcaaaag tagygtkaac ggctatttcc gcatgagcg 59
<210>69
<211>59
<212>DNA
<213> Artificial sequence
<400>69
ttatttcctt atgttcaagg aaataattgt tggcctcctt ctctcttttt gcttgtctc 59
<210>70
<211>59
<212>DNA
<213> Artificial sequence
<400>70
cgcctaaagg atgccctrat gataatatac ggaatatcaa aagtagatgc ttgyagttg 59
<210>71
<211>59
<212>DNA
<213> Artificial sequence
<400>71
ctcgcaatga tttgcatgac tttgtttggc gagagcaagg ttttgaagtc gatgattcc 59
<210>72
<211>59
<212>DNA
<213> Artificial sequence
<400>72
aaagccgtat actcctgatg ttggcggaga gaccaaacga agttttaacc cgtaacgag 59
<210>73
<211>59
<212>DNA
<213> Artificial sequence
<400>73
caccaaaacc tttcactgat atgtagttga gtaaaaacat cagggcgagg aacarcgca 59
<210>74
<211>59
<212>DNA
<213> Artificial sequence
<400>74
vctgagyggy ttcctgcgyt ggggyggcaa ygcctggtay acccayccgg acaaycgyc 59
<210>75
<211>59
<212>DNA
<213> Artificial sequence
<400>75
ccaatcgaaa agaaacacgc ggatgaaatc gataagtata tacaaggrtt ggaytayaa 59
<210>76
<211>59
<212>DNA
<213> Artificial sequence
<400>76
cayaccgcgm athcctkwtt acsgarraat rcrgcagcrt gtctgtttca attttcagc 59
<210>77
<211>59
<212>DNA
<213> Artificial sequence
<400>77
agaggttttt cwwwttcrct actagttgyt tagtgttaay tttagttgta gyttcaagt 59
<210>78
<211>59
<212>DNA
<213> Artificial sequence
<400>78
attcratatt tgaaaatgga aaatgtaaag tgattaaaaa tattgatatg gtctgccca 59
<210>79
<211>59
<212>DNA
<213> Artificial sequence
<400>79
tgactcaacg cgygcacctc accaggcccr gacgcgcgga ggaccgacag ccgggygcg 59
<210>80
<211>59
<212>DNA
<213> Artificial sequence
<400>80
cgacacataa ctctagagtt gagtaaaatc aattcttgaa ggaatgagta ggaggtaaa 59
<210>81
<211>59
<212>DNA
<213> Artificial sequence
<400>81
tccaaaatca agtggggcga tgctggcgct gagtacgtcg tggagtccac tggcgtctt 59
<210>82
<211>59
<212>DNA
<213> Artificial sequence
<400>82
ccctcgggtt aatgcgcgat tgtcaccaca cgttgcgagt tatgttgctg cggagatgg 59
<210>83
<211>59
<212>DNA
<213> Artificial sequence
<400>83
gatcgtcgtt gggctttaga tttctcttat aggctcggtc ggcgcctctc gccccgagc 59

Claims (6)

1. A diarrhea-associated pathogen multiple RT-PCR combined gene chip detection kit is used for simultaneously detecting the following pathogens: adenovirus, astrovirus, norovirus type GI, norovirus type GII, rotavirus, sapovirus, salmonella, shigella, campylobacter, clostridium difficile, clostridium perfringens, enterotoxigenic escherichia coli, enterohemorrhagic escherichia coli, enteropathogenic escherichia coli, enteroinvasive escherichia coli, enteroaggregative escherichia coli, vibrio cholerae, vibrio parahaemolyticus, yersinia enterocolitica, aeromonas hydrophila, listeria monocytogenes, enterobacter sakazakii, staphylococcus aureus, cryptosporidium, giardia intestinalis, and amebiasis dysentery;
a primer combination and a probe combination of diarrhea-related pathogens are arranged in the kit, and an internal contrast of a human GAPDH gene, a positive contrast and a negative contrast are arranged at the same time;
the primer combination is composed of multiple specificity conservative degenerate primers, wherein the nucleotide of a degenerate locus is represented by R-A/G, Y-C/T, M-A/C, K-G/T, S-C/G, W-A/T, H-A/C/T, B-C/G/T, V-A/C/G, D-A/G/T, N-A/C/G/T, and the base sequence of each primer pair is 5 '-3' as follows:
adenovirus, reverse primer 5' end with Cy5 mark:
a forward primer: CAGACAGGTCRCAGCGACTG the flow of the air in the air conditioner,
reverse primer: cy5-5' -AAGTAGGTGCTGGCCATGTC;
astrovirus, reverse primer 5' end with Cy5 mark:
a forward primer: TRGARCACTGCCTNTCDCGGAC the flow of the air in the air conditioner,
reverse primer: cy5-5' -YRGRCTTRCTAGCCATCRCAC;
norovirus type GI, reverse primer 5' with Cy5 marker:
a forward primer: GCARGCCATGTTCCGYTGGA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCGTCYTTAGACGCCATCATCAT;
norovirus GII type, reverse primer 5' with Cy5 mark:
a forward primer: CTGGCTCCCAGYTTYGTGAA the flow of the air in the air conditioner,
reverse primer: cy5-5' -CAATRGCRGCACCRRCWACG;
rotavirus, the reverse primer 5' end carries a Cy5 mark:
a forward primer: CCATCTWCACATGACCCTCTATGAGC the flow of the air in the air conditioner,
reverse primer: cy5-5' -ACGSCCCTATAGCCATTTAGGT;
the 5' end of a reverse primer of the arenavirus carries a Cy5 mark:
a forward primer: CCCTCCATYTCAAACACTA the flow of the air in the air conditioner,
reverse primer: cy5-5' -VAAYTWYGAYYWGGCYCTCG;
salmonella, reverse primer 5' with Cy5 marker:
a forward primer: GYACGATATTCAGTGCGATCAGGA the flow of the air in the air conditioner,
reverse primer: cy5-5' -TTAACAGTGCTCGTTTACGACCTG;
shigella, the reverse primer 5' end carries Cy5 mark:
a forward primer: GGCCTTCCAGACCATGCTCG the flow of the air in the air conditioner,
reverse primer: cy5-5' -CAGTGCGGAGGTCATTTGCT;
campylobacter, with Cy5 mark at the 5' -end of the reverse primer:
a forward primer: TGAGTGCTATTAAAGGYATTGATKTRGGT the flow of the air in the air conditioner,
reverse primer: cy5-5' -CCATAATGKCCAAATCCWCCRCTT;
clostridium difficile, the reverse primer 5' end carries Cy5 mark:
a forward primer: GCACCATCAATAACATATAGAGAGCCAC the flow of the air in the air conditioner,
reverse primer: cy5-5' -CCAAGCAAATACTCTATTTGGAGCATTAGG;
the clostridium perfringens, the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: CCAGYCATAAARTCATTTCCTGGGT the flow of the air in the air conditioner,
reverse primer: cy5-5' -TCAACTAGTGGTGARAAAGATGCTGG;
enterotoxigenic escherichia coli, the reverse primer 5' end is marked by Cy 5:
a forward primer: ACAGAAATCTGAATATAGCTCCGGCA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GGTGCATGATGAATCCAGGGT;
enterohemorrhagic escherichia coli, the reverse primer carries a Cy5 mark at the 5' end:
a forward primer: CAAAGACGTATGTAGATTCGCTGAATGTC the flow of the air in the air conditioner,
reverse primer: cy5-5' -ACTATCAATCATCAGTAAAGACGTACCTCC;
enteropathogenic Escherichia coli, and a reverse primer is marked by Cy5 at the 5' end:
a forward primer: GGATTTTTCTGGTGATAATACCCGYTTAGG the flow of the air in the air conditioner,
reverse primer: cy5-5' -AGTCTTTCTTRTTGTATGACTCATGCCA;
enteroinvasive Escherichia coli, and a reverse primer with a Cy5 mark at the 5' end:
a forward primer: GTAGACATAGGTTCTTCTGTT the flow of the air in the air conditioner,
reverse primer: cy5-5' -GTTGCCCCACGCTGGTTGTC;
escherichia coli with intestinal aggregation, the reverse primer with Cy5 mark at 5' end:
a forward primer: CCATTTATCGCAATCAGATTAARCAGCGA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCTACAATTATTCCTTTTGACCAATTCGGA;
vibrio cholerae, reverse primer 5' end with Cy5 mark:
a forward primer: GGCCCAACGTCCAAACGAGG the flow of the air in the air conditioner,
reverse primer: cy5-5' -TCGAAATGGCTTGGGTTAAGCT;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: CGAAGTTGTACGATTAGGAAGCAACG the flow of the air in the air conditioner,
reverse primer: cy5-5' -ACGCCAAACAAACTCGTGAAGCT;
yersinia enterocolitica, reverse primer 5' end with Cy5 mark:
a forward primer: TYAGTGAGAACCAGTATTCCGCT the flow of the air in the air conditioner,
reverse primer: cy5-5' -CTGGTCGCGGCACAATTGGT;
the 5' end of the reverse primer of the aeromonas hydrophila is marked with Cy 5:
a forward primer: MGAGCTCTACAAGGCYGAYATCTC the flow of the air in the air conditioner,
reverse primer: cy5-5' -TRACGAAGGTGTGGYTCCAGTTCG;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: CAGCATCTCCGCCTGCAAGTC the flow of the air in the air conditioner,
reverse primer: cy5-5' -TTCTTGGCGGCACATTTGTC;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: AAGTMTTCGKGCTGCGAGTT the flow of the air in the air conditioner,
reverse primer: cy5-5' -TTGCTCTYTAACAATCCGGAACAAGCT;
staphylococcus aureus, reverse primer 5' with Cy5 mark:
a forward primer: TKTTTYGAAAGRRCAATACRC the flow of the air in the air conditioner,
reverse primer: cy5-5' -GTGATGCATYTGCTGAGCTAC;
cryptosporidium, reverse primer 5' end with Cy5 mark:
a forward primer: GCTGAATTAGAATCGACATGCCCA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GGTGGRCATTCYTTTGCAGGA;
giardia intestinalis, the reverse primer 5' end carries a Cy5 mark:
a forward primer: CAGACGTGGAGTCTGCGGCT the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCYCGTTGTCGCARTGGAGC;
the 5' end of the reverse primer carries a Cy5 mark:
a forward primer: GGGAGCTTTACAGATGGCTACCA the flow of the air in the air conditioner,
reverse primer: cy5-5' -GCCCTCCAATTGATTTCGTAGGAGAA;
internal source control GAPDH gene, and the 5' end of the reverse primer carries Cy5 mark:
a forward primer: ATCTTCCAGGAGCGAGATCC the flow of the air in the air conditioner,
reverse primer: cy5-5' -AGGGGGCAGAGATGATGAC;
and the probe set is nucleic acid probes which are fixed on the surface of the gene chip in sequence and include a diarrhea-associated pathogen specific conservative degenerate probe, a GAPDH internal control probe, a positive heterosis probe and a negative heterosis probe, wherein the nucleotide of a degenerate site is represented by R ═ A/G, Y ═ C/T, M ═ A/C, K ═ G/T, S ═ C/G, W ═ A/T, H ═ A/C/T, B ═ C/G/T, V ═ A/C/G, D ═ A/G/T, N ═ A/C/G/T, the 5' end of each probe is marked with an amino group, and the base sequence of each probe is 5' -3 ' as follows:
adenovirus probe:
NH2-5’-GAMACCGCYTAYTCTTACAAAGTGCGCTTTACGCTGGCCGTGGGCGACAAC CGGGTKTT；
astrovirus probes:
NH2-5’-TGYDAAGCAGCTTCGTGANTCTGGHYTNCCDGCYAGRCTCACWGAAGAGC AACTYCATC；
norovirus GI type probes:
NH2-5’-GCGNTTCCAYGAYYTNRGNYTDTGGACAGGRGAYCGCRATCTBYTRCCCGA WTWYGTRA；
norovirus GII-type probe:
NH2-5’-GAAGATGGCGTCGARTGACGCCARCCCATCTGATGGGTCCRCRGCCARCCT YGTCCCAG；
rotavirus probe:
NH2-5’-CCATCTWCACATGACCCTCTATGAGCRCAATAGTTAAAAGCTAACACTGTCA AAAACCT；
sandwave virus probe:
NH2-5’-TTTGKKDGYHYCTTCABTGKRRCBVHCTKGVHCNRKNVCTGYACCRCCTAT RAACCADG；
salmonella probe:
NH2-5’-AATCAACCAGAWAGGTAGGTAATGGRATGACGAACATAGAAATGATCATCA CCATTAGT；
shigella probe:
NH2-5’-GAAACTTCAGCTCTCYACTGCCGTGAAGGAAATGCGTTTCTATGGCGTGTC GGGAGTGA；
campylobacter probe:
NH2-5’-TTYTATGGTTTAGCWGGTGKRGGATATGARGATTTTTCWAAWGSYGCTTWT GATAATAA；
clostridium difficile probes:
NH2-5’-ATGACGTATTGGAAGTACAAAAAGAAGAACTTGATTTGTCAAAAGATTTAA TGGTATTA；
clostridium perfringens probe:
NH2-5’-CCCATTCTTGAGTTTTTCCATCCTTTGTTTTGATTCCAAARTACATGTAGTCA TCTGTT；
enterotoxigenic escherichia coli probe:
NH2-5’-GAGGATGGTTACAGATTAGCAGGTTTCCCACCGGATCACCAAGCTTGGAGA GAAGAACC；
enterohemorrhagic escherichia coli probe:
NH2-5’-TAGATTCGCTGAATGTCATTCGCTCTGCAATAGGTACTCCATTACAGACTATT TCATCA；
enteropathogenic E.coli probes:
NH2-5’-TGGSGAATACTGGCGAGACTATTTCAAAAGTAGYGTKAACGGCTATTTCCGC ATGAGCG；
intestinal invasive E.coli probes:
NH2-5’-TTATTTCCTTATGTTCAAGGAAATAATTGTTGGCCTCCTTCTCTCTTTTTGCTT GTCTC；
enteroaggregative E.coli Probe:
NH2-5’-CGCCTAAAGGATGCCCTRATGATAATATACGGAATATCAAAAGTAGATGCTT GYAGTTG；
vibrio cholerae probe:
NH2-5’-CTCGCAATGATTTGCATGACTTTGTTTGGCGAGAGCAAGGTTTTGAAGTCGA TGATTCC；
vibrio parahaemolyticus probe:
NH2-5’-AAAGCCGTATACTCCTGATGTTGGCGGAGAGACCAAACGAAGTTTTAACCC GTAACGAG；
yersinia enterocolitis probe:
NH2-5’-CACCAAAACCTTTCACTGATATGTAGTTGAGTAAAAACATCAGGGCGAGGA ACARCGCA；
aeromonas hydrophila probe:
NH2-5’-VCTGAGYGGYTTCCTGCGYTGGGGYGGCAAYGCCTGGTAYACCCAYCCGG ACAAYCGYC；
listeria monocytogenes probes:
NH2-5’-CCAATCGAAAAGAAACACGCGGATGAAATCGATAAGTATATACAAGGRTTG GAYTAYAA；
sakazakii probe:
NH2-5’-CAYACCGCGMATHCCTKWTTACSGARRAATRCRGCAGCRTGTCTGTTTCAA TTTTCAGC；
staphylococcus aureus probe:
NH2-5’-AGAGGTTTTTCWWWTTCRCTACTAGTTGYTTAGTGTTAAYTTTAGTTGTAG YTTCAAGT；
cryptosporidium probe:
NH2-5’-ATTCRATATTTGAAAATGGAAAATGTAAAGTGATTAAAAATATTGATATGGTC TGCCCA；
giardia intestinalis probe:
NH2-5’-TGACTCAACGCGYGCACCTCACCAGGCCCRGACGCGCGGAGGACCGACAG CCGGGYGCG；
amebic dysentery probe:
NH2-5’-CGACACATAACTCTAGAGTTGAGTAAAATCAATTCTTGAAGGAATGAGTAG GAGGTAAA；
internal control GAPDH gene probe:
NH2-5’-TCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACT GGCGTCTT；
positive probe for cross-point:
NH2-5’-CCCTCGGGTTAATGCGCGATTGTCACCACACGTTGCGAGTTATGTTGCTGCG GAGATGG；
negative heterosis probe:
NH2-5’-GATCGTCGTTGGGCTTTAGATTTCTCTTATAGGCTCGGTCGGCGCCTCTCGC CCCGAGC。
2. the diarrhea-associated pathogen multiple RT-PCR combined gene chip detection kit according to claim 1, wherein the kit comprises a primer combination, a probe combination and a gene chip, the gene chip is a solid phase support medium with a probe array fixed on the surface, and the probe array is the diarrhea-associated pathogen specific conserved degenerate probe, the GAPDH internal control probe, the positive cross-over point probe and the negative cross-over point probe according to claim 1.
3. The diarrhea associated pathogen multiple RT-PCR combined gene chip detection kit according to claim 2, wherein the solid phase support medium is a glass sheet, a silicon wafer, a nylon membrane or a nitrocellulose membrane.
4. The diarrhea-associated pathogen multiple RT-PCR combined gene chip detection kit according to claim 1 or 2, characterized in that the kit comprises a primer combination, a probe combination, a gene chip and auxiliary materials, wherein the auxiliary materials are a one-step reverse transcription amplification reagent, ultrapure water and positive oligonucleotide single-stranded DNA with a Cy5 mark at the 5 'end, and the base sequence of the positive oligonucleotide single-stranded DNA with a Cy5 mark at the 5' end is Cy5-5'-CCATCTCCGCAGCAACATAACTCGCAACGTGTGGTGACAATCGCGCATTAAC CCGAGGG-3'.
5. The diarrhea-associated pathogen multiple RT-PCR combined gene chip detection kit according to claim 4, wherein the kit comprises a primer combination, a gene chip, an auxiliary material and a preparation solution, wherein the preparation solution is a chip spotting solution, a chip cleaning solution, a hybridization solution, a cleaning solution I and a cleaning solution II.
6. The diarrhea associated pathogen multiple RT-PCR combined gene chip detection kit according to claim 5, wherein the chip spotting fluid is 50% DMSO; the chip cleaning solution is 5XSSC, 0.2% SDS; the hybridization solution is 5XSSC, 0.1% SDS; cleaning solution I is 0.5XSSC, 0.1% SDS; cleaning solution II was 0.05 XSSC.
CN201710216967.7A 2017-04-05 2017-04-05 Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit Active CN107090518B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201710216967.7A CN107090518B (en) 2017-04-05 2017-04-05 Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit
PCT/CN2018/081752 WO2018184531A1 (en) 2017-04-05 2018-04-03 Detection kit for diarrhea-related pathogens combining multiple rt-pcr with gene chip

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710216967.7A CN107090518B (en) 2017-04-05 2017-04-05 Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit

Publications (2)

Publication Number Publication Date
CN107090518A CN107090518A (en) 2017-08-25
CN107090518B true CN107090518B (en) 2020-03-20

Family

ID=59649027

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710216967.7A Active CN107090518B (en) 2017-04-05 2017-04-05 Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit

Country Status (2)

Country Link
CN (1) CN107090518B (en)
WO (1) WO2018184531A1 (en)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107090518B (en) * 2017-04-05 2020-03-20 苏州协云基因科技有限公司 Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit
HUE055897T2 (en) 2017-05-12 2021-12-28 Evonik Operations Gmbh Method for detecting c. perfringens induced diseases in animals
CN108265127A (en) * 2018-04-01 2018-07-10 广州奥百阕谱生物科技有限公司 Detect the suspension microballon array system of lead to diarrhea common causative
CN108396076A (en) * 2018-04-26 2018-08-14 四川华汉三创生物科技有限公司 A kind of detection kit of lead to diarrhea pathogenic microorganism
CN108531653A (en) * 2018-04-26 2018-09-14 四川华汉三创生物科技有限公司 A method of detection lead to diarrhea pathogenic microorganism
CN108546781A (en) * 2018-04-26 2018-09-18 四川华汉三创生物科技有限公司 It is a kind of detection lead to diarrhea pathogenic microorganism Nucleic acid combinations and its application
EP3807421B1 (en) * 2018-06-15 2023-09-13 Evonik Operations GmbH Method for early detection of a necrotic enteritis outbreak in an avian population
CN114214443B (en) * 2021-12-28 2023-05-16 上海市质量监督检验技术研究院 Multiplex fluorescence quantitative PCR detection method and multiplex fluorescence quantitative PCR detection kit capable of simultaneously detecting multiple microorganisms
CN114350851A (en) * 2021-12-31 2022-04-15 江苏臻石生物科技有限公司 Reagent for detecting enterovirus
CN114752594B (en) * 2022-05-20 2024-03-15 华中农业大学 Multiplex real-time fluorescent quantitative PCR primer and probe combination for detecting salmonella and cryptosporidium
CN116334264B (en) * 2023-05-17 2023-08-18 广州达安基因股份有限公司 Electrochemical chip detection kit and detection method for infectious diarrhea pathogen

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103074450A (en) * 2013-01-25 2013-05-01 海尔施生物医药股份有限公司 Kit for synchronously detecting thirty diarrhea pathogens and detection method of kit
CN104651538A (en) * 2015-03-11 2015-05-27 珠海国际旅行卫生保健中心 Primer group and kit for simultaneously detecting four diarrhea viruses
CN104946791A (en) * 2015-04-08 2015-09-30 中国人民解放军军事医学科学院放射与辐射医学研究所 Preparation and application of gene chip capable of detecting seven diarrhea viruses

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102140507B (en) * 2010-12-20 2012-12-26 南开大学 Detection genetic chip and detection kit for infectious diarrhea
CN102154528B (en) * 2011-05-20 2013-01-09 何雅青 Primer, probe and kit for detecting rotavirus and Norovirus liquid phase chips
EP2867372B1 (en) * 2012-06-27 2018-12-19 Mobidiag Oy Method for determining the presence of diarrhoea causing pathogens
CN103911443B (en) * 2014-03-18 2015-12-09 烟台毓璜顶医院 The gene chip of a kind of detection 11 kinds of Common infectious dysentery substances and application thereof
CN107090518B (en) * 2017-04-05 2020-03-20 苏州协云基因科技有限公司 Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103074450A (en) * 2013-01-25 2013-05-01 海尔施生物医药股份有限公司 Kit for synchronously detecting thirty diarrhea pathogens and detection method of kit
CN104651538A (en) * 2015-03-11 2015-05-27 珠海国际旅行卫生保健中心 Primer group and kit for simultaneously detecting four diarrhea viruses
CN104946791A (en) * 2015-04-08 2015-09-30 中国人民解放军军事医学科学院放射与辐射医学研究所 Preparation and application of gene chip capable of detecting seven diarrhea viruses

Also Published As

Publication number Publication date
WO2018184531A1 (en) 2018-10-11
CN107090518A (en) 2017-08-25

Similar Documents

Publication Publication Date Title
CN107090518B (en) Diarrhea-related pathogen multiple RT-PCR combined gene chip detection kit
CN107090519B (en) Multiple RT-PCR combined gene chip detection kit for common respiratory pathogens
Orru et al. Rapid detection and quantitation of Bluetongue virus (BTV) using a Molecular Beacon fluorescent probe assay
JP2008502362A (en) Diagnostic primers and methods for detecting avian influenza virus subtypes H5 and H5N1
CN103695566A (en) Multiplex PCR (polymerase chain reaction) primer, probe and gene chip for detecting bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus
CN107488748B (en) Composition for detecting 23 respiratory pathogens, kit and detection method thereof
CN107810275A (en) Probe of regiospecificity genotype for identifying viral hemorrhagic septicemia, VHS virus and application thereof
JP4972104B2 (en) Oligonucleotide microarray for pathogen identification
JP2024003255A5 (en)
JP2005058234A (en) Pcr primer set for detecting hepatitis b, and method for detecting hepatitis b and using the primer set
JPH05503215A (en) Method for instant fluorescence detection of DNA sequences
CN104293976B (en) Gene chip and kit for detecting pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus
CN112226485A (en) Nucleic acid detection method
CN102031311B (en) Gene chip for detecting 6 viruses of zoonosis-borne diseases and application thereof
CN111235321A (en) Dual TaqMan fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit for Muscovy duck reovirus and novel duck reovirus
KR20130010974A (en) Detecting method of several food-poisoning bacteria using pna chip
CN103667538B (en) Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens
JP5613160B2 (en) Method for detecting or analyzing a target sequence in genomic DNA
CN115786529A (en) Gene chip and kit for detecting parasites of aquatic animals and application of gene chip and kit
CN111500774B (en) Epidemic hemorrhagic disease virus and serotype identification RT-PCR kit
KR102276396B1 (en) A composition and RT-qPCR based chip for detecting avian influenza viruses and method for detecting avian influenza viruses using the same
CN110592233B (en) Gene chip for detecting common food-borne parasites and application thereof
CN111961763A (en) Novel gene chip for detecting coronavirus
CN104805210A (en) Gene detection method of Leber&#39;s hereditary optic neuropathy, (LHON) gene chip and kit
US10017830B2 (en) Oligonucleotide probes, kit containing the same and method for pathotyping of H5 avian influenza viruses

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant