CN107041951B - Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof - Google Patents

Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof Download PDF

Info

Publication number
CN107041951B
CN107041951B CN201710256542.9A CN201710256542A CN107041951B CN 107041951 B CN107041951 B CN 107041951B CN 201710256542 A CN201710256542 A CN 201710256542A CN 107041951 B CN107041951 B CN 107041951B
Authority
CN
China
Prior art keywords
foot
mouth disease
strain
disease virus
vaccine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710256542.9A
Other languages
Chinese (zh)
Other versions
CN107041951A (en
Inventor
郑海学
杨帆
张克山
李丹
曹伟军
朱紫祥
�田宏
靳野
郭建宏
何继军
才学鹏
刘湘涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Lanzhou Veterinary Research Institute of CAAS
Original Assignee
Lanzhou Veterinary Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lanzhou Veterinary Research Institute of CAAS filed Critical Lanzhou Veterinary Research Institute of CAAS
Priority to CN201710256542.9A priority Critical patent/CN107041951B/en
Publication of CN107041951A publication Critical patent/CN107041951A/en
Application granted granted Critical
Publication of CN107041951B publication Critical patent/CN107041951B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5252—Virus inactivated (killed)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/70—Multivalent vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/32011—Picornaviridae
    • C12N2770/32111—Aphthovirus, e.g. footandmouth disease virus
    • C12N2770/32134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention relates to a foot-and-mouth disease virus vaccine composition, in particular to a recombinant trivalent vaccine composition of foot-and-mouth disease types O, A and Asia 1. The invention also relates to a method for preparing the foot-and-mouth disease virus vaccine composition and application of the foot-and-mouth disease virus vaccine composition in preparing a medicament for preventing and/or controlling animal foot-and-mouth disease.

Description

Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof
Technical Field
The invention relates to a recombinant high-efficiency trivalent inactivated vaccine for foot-and-mouth disease types O, A and Asia1, a preparation method and application thereof, belonging to the field of biotechnology and biological products.
Background
Foot-and-mouth disease (FMD) is an acute, febrile, highly contagious disease of cloven-hoofed animals such as pigs, cattle and sheep, caused by FMD virus (FMDV). FMDV has 7 different serotypes a, O, Asial, C, SAT1, SAT2, and SAT3 with no cross-protection between serotypes.
In recent years, affected by the surrounding national regions of China, the foot-and-mouth disease situation of multi-provincial provinces is continuous, and the healthy development of the breeding industry in China is seriously harmed by the different epidemic strains of three serotypes, namely O type, A type and Asia1 type. In view of the complex situation of foot-and-mouth disease epidemic in China and the phenomenon that cross immunity does not exist before each serotype of the foot-and-mouth disease, a targeted vaccine aiming at O-type, A-type and Asia 1-type epidemic strains needs to be developed, and the vaccine is required to have high efficiency and broad spectrum, so that the characteristics of preventing a plurality of strains simultaneously by immunizing one strain, effectively protecting the domestic epidemic strains and the like are required, and the health and the safety of domestic livestock are ensured.
The reverse genetic operation technology can realize modification and reformation of virus genes, overcomes the natural attribute constraints of time and labor consumption, poor antigenicity, late antibody response and the like of domesticating vaccine strains from epidemic strains, and realizes more active construction and improvement of the vaccine strains. Therefore, the research uses the established reverse genetic operation system with a strain with stronger cellular immune response as a frame to prepare a vaccine strain containing the antigen skeleton of the screened O-type Mya98 strain, combines an A-type foot-and-mouth disease recombinant vaccine strain and an Asia 1-type foot-and-mouth disease recombinant vaccine strain which are successfully developed by using the reverse genetic technology to prepare the O-type, A-type and Asia 1-type trivalent inactivated vaccine, and obtains the trivalent vaccine which has the characteristics of good production performance, good antigen matching property, wide antigen spectrum, capability of preventing O-type, A-type and Asia 1-type foot-and-mouth diseases simultaneously, improved early immune response, strong immune efficacy, long immune duration and the like.
Disclosure of Invention
The invention relates to a foot-and-mouth disease virus vaccine composition, a method for preparing the same and application of the foot-and-mouth disease virus vaccine composition in preparation of drugs for preventing and/or controlling animal foot-and-mouth disease.
In one aspect, the invention relates to a foot and mouth disease virus vaccine composition.
In certain embodiments, the foot-and-mouth disease virus vaccine composition comprises a first foot-and-mouth disease virus vaccine, a second foot-and-mouth disease virus vaccine, and a third foot-and-mouth disease virus vaccine, the first foot-and-mouth disease virus vaccine comprising or encoded by a first recombinant foot-and-mouth disease nucleic acid, the sequence of the first recombinant foot-and-mouth disease nucleic acid comprising a nucleic acid sequence of a foot-and-mouth disease virus strain of a non-O/JSCZ/2013 strain, but wherein L gene, P1 gene, and P2 gene that are adjacent to each other in the nucleic acid sequence of the foot-and-mouth disease strain of the non-O/JSCZ/2013 strain are replaced by corresponding gene fragments in the nucleic acid sequence of the foot-and-mouth disease strain O/JSCZ/2013 strain, the second foot-and-mouth disease virus vaccine and the third foot-and-mouth disease virus vaccine are non-O-type foot-and foot-and-mouth disease virus vaccines.
In the present application, the "non-O type foot-and-mouth disease virus strain" means that part or all of the nucleic acid of the foot-and-mouth disease virus is not derived from a type O serous strain, and may be, for example, a type a, Asial, C, SAT1, SAT2 or SAT3 foot-and-mouth disease virus strain.
In certain embodiments, the corresponding gene segment in the nucleic acid sequence of said O/JSCZ/2013 strain is equal or unequal to the contiguous L, P1 and P2 genes of the aftosa strain of said non-O/JSCZ/2013 strain, in certain embodiments, the corresponding gene segment in the nucleic acid sequence of said O/JSCZ/2013 strain is as shown in SEQ ID NO:1 in certain embodiments, the L gene sequence substituted in the aftosa strain of said non-O/JSCZ/2013 strain is at least 100 contiguous nucleotide sequences linked to the P1 gene in L gene of the aftosa strain of said non-O/JSCZ/2013 strain, such as 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 171, 172, 173, 175, 176, 175, 201170, 20124, 20126, 180, 12026, or 180, 120, seven contiguous nucleotide sequences of said aftosa gene sequence linked to the non-O/P gene sequence of said aftosa strain is as shown in SEQ ID, equivalent to the sequence of said non-O/JSCZ strain, in said sequence of said non-O/JSCZ strain, as shown in certain embodiments, iii.
In certain embodiments, the foot and mouth disease strain other than the O/JSCZ/2013 strain is the O/CHA/99 strain.
As known to those skilled in the art, in the genome of foot-and-mouth disease virus, L gene, P1 gene and P2 gene are arranged in order from 5 'end to 3' end, in the present application, "L gene, P1 gene and P2 gene adjacent to each other" means that 3 'end of L gene is operably linked to 5' end of P1 gene, and 3 'end of P1 gene is operably linked to 5' end of P2 gene.
In the present application, "L gene" refers to a part or all of L gene in the genome of foot-and-mouth disease virus, for example, at least 100 consecutive nucleotide sequences, such as 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179 or 180 consecutive nucleotide sequences, linked to the P1 gene in L gene.
In the present application, the "P2 gene" refers to a part or all of the P2 gene in the genome of foot and mouth disease virus, for example, at least 1000 consecutive nucleotide sequences of the P2 gene linked to the P1 gene, such as 1050, 1100, 1150, 1200, 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208, 1209, or 1210 consecutive nucleotide sequences.
In the application, the expression "corresponding gene segments in the nucleic acid sequence of the foot-and-mouth disease strain O/JSCZ/2013 strain" refers to L gene, P1 gene and P2 gene which are adjacent to each other in the genome of the foot-and-mouth disease strain O/JSCZ/2013 strain, wherein the L gene can be all or part of the L gene of the O/JSCZ/2013 strain, and the P2 gene can be all or part of the P2 gene of the O/JSCZ/2013 strain.
In the present application, the phrase "a foot-and-mouth disease strain other than O/JSCZ/2013 strain" means that part or all of the nucleic acid of the foot-and-mouth disease virus is not derived from the O/JSCZ/2013 strain, and may be, for example, a foot-and-mouth disease strain derived from O/CHA/99 strain, O/GDBY/2010 strain, A/GD/2013 strain, or a highly effective vaccine strain recommended by OIE. In certain embodiments, the foot and mouth disease strain other than the O/JSCZ/2013 strain is the O/CHA/99 strain.
In certain embodiments, the first foot and mouth disease virus vaccine is a type O foot and mouth disease virus vaccine strain. In certain embodiments, the first foot and mouth disease virus vaccine is capable of eliciting immune activity against a foot and mouth disease virus strain type O. In certain embodiments, the type O foot-and-mouth disease virus strain is Mya-98, PanAsia, or Cathay lineage strain. In certain embodiments, the type O foot-and-mouth disease virus strain is O/BY/CHA/2010, O/0834 or O/0718 and the first foot-and-mouth disease virus vaccine is to PD of O/BY/CHA/2010, O/0834 or O/071850All values are greater than 6.
In certain embodiments, the second foot and mouth disease virus vaccine comprises a foot and mouth disease virus vaccine strain of any of serotypes a, Asial, C, SAT1, SAT2, and SAT 3. In certain embodiments, the second foot and mouth disease virus vaccine is a type a foot and mouth disease virus vaccine strain. In certain embodiments, the second foot and mouth disease virus vaccine is capable of eliciting immunological activity against a type a foot and mouth disease virus strain. In certain embodiments, the type A foot and mouth disease virus strain is SEA-97G1 or SEA-97G2 strain. In some embodiments of the present invention, the substrate is,the A type foot-and-mouth disease virus strain is A/WH/09 or A/GDMM/2013, and the second foot-and-mouth disease virus vaccine is used for PD of A/WH/09 and A/GDMM/201350All values are greater than 6. In certain embodiments, the second foot and mouth disease virus vaccine is a type a foot and mouth disease virus recombinant vaccine strain. In some embodiments, the recombinant vaccine strain of foot-and-mouth disease virus type A comprises a nucleic acid sequence as set forth in SEQ ID NO. 4.
In certain embodiments, the genome of said type A recombinant vaccine strain of foot-and-mouth disease virus comprises the nucleic acid sequence of strain O/CHA/99, but wherein contiguous portions of the L gene and the P1 gene fragment are replaced by corresponding gene fragments in the nucleic acid sequence of strain A/WH/CHA/09, in certain embodiments, the corresponding gene fragments in the nucleic acid sequence of said strain A/WH/CHA/09 are of equal or unequal length to portions of the L gene and the P1 gene fragment of said strain O/CHA/99, in certain embodiments, the corresponding gene fragments in the nucleic acid sequence of said strain A/WH/CHA/09 are as set forth in SEQ ID NO: 4.
In this application, "contiguous portion L gene and P1 gene fragment" means that the 3 'end of the portion L gene is operably linked to the 5' end of the P1 gene.
As used herein, "a gene fragment corresponding to the nucleic acid sequence of strain A/WH/CHA/09 for foot-and-mouth disease" refers to L gene and P1 gene fragments adjacent to each other in the genome of strain A/WH/CHA/09 for foot-and-mouth disease, wherein L gene may be all or a part of L gene of strain A/WH/CHA/09, and P1 gene may be all or a part of P1 gene of strain A/WH/CHA/09.
In certain embodiments, the third foot and mouth disease virus vaccine comprises a foot and mouth disease virus vaccine strain of any of serotypes a, Asial, C, SAT1, SAT2, and SAT 3. In certain embodiments, the third foot and mouth disease virus vaccine is a foot and mouth disease virus vaccine strain type Asia 1. In certain embodiments, the third foot and mouth disease virus vaccine is capable of eliciting immune activity against a type Asia1 foot and mouth disease virus strain. In certain embodiments, the type Asia1 foot-and-mouth disease virus strain is a GV or GII strain. In certain embodiments, the Asia1 type foot-and-mouth disease virus strain is Asia1/HN/06And the third foot and mouth disease virus vaccine against Asia1/HN/06 PD50The value is greater than 6. In certain embodiments, the third foot and mouth disease virus vaccine is an Asia1 type foot and mouth disease virus recombinant vaccine strain. In certain embodiments, the recombinant vaccine strain of Asia1 type foot-and-mouth disease virus comprises the nucleic acid sequence set forth in SEQ ID NO. 7.
In certain embodiments, the genome of the recombinant vaccine strain of Asia1 type foot-and-mouth disease virus comprises the nucleic acid sequence of the foot-and-mouth disease strain O/CHA/99 strain, but wherein a portion of the L gene and the P1 gene, and a portion of the P2 gene fragment that are contiguous to each other, are replaced by a corresponding gene fragment in the nucleic acid sequence of the foot-and-mouth disease strain Asia1/HN/06 strain.
In the present application, the phrase "corresponding gene fragment in the nucleic acid sequence of Asia1/HN/06 strain" refers to L gene, P1 gene and P2 gene fragment adjacent to each other in the genome of Asia1/HN/06 strain, wherein L gene may be all or a part of Asia1/HN/06 strain L gene, and P2 gene may be all or a part of Asia1/HN/06 strain P2 gene.
In certain embodiments, there is no immune suppression between said first, said second and said third foot-and-mouth disease virus vaccines. In the present application, "without immunosuppression" means that the first, second and third foot-and-mouth disease virus vaccines do not significantly impair the immune effect of the counterpart after immunization of the animal.
In certain embodiments, the foot and mouth disease virus vaccine composition is capable of eliciting immune activity against a foot and mouth disease virus type O strain. In certain embodiments, the type O foot-and-mouth disease virus strain is an epidemic strain of Mya-98, PanAsia, or Cathay lineages. In certain embodiments, the type O foot-and-mouth disease virus strain is O/BY/CHA/2010,O/0834 or O/0718 and the vaccine composition is directed against PD of O/BY/CHA/2010, O/0834 or O/071850All values are greater than 6.
In certain embodiments, the foot and mouth disease virus vaccine composition is capable of eliciting immune activity against a type a foot and mouth disease virus strain. In certain embodiments, the type A foot and mouth disease virus strain is SEA-97G1 or SEA-97G2 strain. In certain embodiments, the type a foot-and-mouth disease virus strain is a/WH/09 or a/GDMM/2013, and the vaccine composition has PD to a/WH/09 and a/GDMM/201350All values are greater than 6.
In certain embodiments, the foot and mouth disease virus vaccine composition is capable of eliciting immune activity against a foot and mouth disease virus strain type Asia 1. In certain embodiments, the type Asia1 foot-and-mouth disease virus strain is a GV or GII strain. In certain embodiments, the Asia1 type foot-and-mouth disease virus strain is Asia1/HN/06, and the vaccine composition is directed against PD of Asia1/HN/0650The value is greater than 6.
In another aspect, the present invention relates to a method for preparing a foot-and-mouth disease virus vaccine composition, comprising the steps of: (a) culturing and collecting a first foot-and-mouth disease virus vaccine strain; (b) culturing and collecting a second foot-and-mouth disease virus vaccine strain; (c) culturing and collecting a third foot-and-mouth disease virus vaccine strain; (d) respectively inactivating the first foot-and-mouth disease virus vaccine strain collected in the step (a), the second foot-and-mouth disease virus vaccine strain collected in the step (b) and the third foot-and-mouth disease virus vaccine strain collected in the step (c), and then mixing. In certain embodiments, the foot and mouth disease virus vaccine strain is emulsified after mixing. In certain embodiments, the emulsification is performed with ISA206 adjuvant in a volume ratio of 1: 1.
In certain embodiments, step (a) comprises the steps of:
1) mixing specific primers OP12A-F and OP12A-R with cDNA nucleic acid of an O/JSCZ/2013 strain to amplify to obtain L gene, P1 gene and P2 gene fragment of the O/JSCZ/2013 strain, replacing and inserting the obtained gene fragment into eukaryotic transcription plasmid prO/CHA/99 to obtain prO-FMDV recombinant plasmid, wherein the specific primers are respectively as follows:
OP12A-F:5'-TTTTCCTTAAGGGACAGGAACACGCCGTGTTTGCCTGCGT-3'(SEQ ID NO:2)
OP12A-R:5'-ACTCACATCGATGTCAAAGTGAAACCTTC-3'(SEQ ID NO:3)；
2) transfecting the foot-and-mouth disease virus sensitive cells with the eukaryotic transcription plasmid prO-FMDV obtained in the step 1) to obtain a first foot-and-mouth disease virus vaccine strain.
In certain embodiments, the L gene, the P1 gene, and the P2 gene of the O/JSCZ/2013 strain comprise nucleic acid sequences as shown in SEQ ID NO: 1. in certain embodiments, the foot and mouth disease virus-sensitive cells are BHK-21 cells or IBRS-2 cells. in certain embodiments, the 146S antigen content of the first foot and mouth disease virus vaccine strain obtained is greater than 4.0 μ g/m L (the method for determining the 146S antigen content is described in Chinese invention patent Z L201310017378.8, which is incorporated herein by reference in its entirety).
In certain embodiments, the step (b) comprises the steps of:
1) mixing specific primers AP1-F and AP1-R with cDNA nucleic acid of A/WH/CHA/09 strain to amplify partial L gene and P1 gene fragment of A/WH/CHA/09 strain, and replacing and inserting the obtained gene fragment into eukaryotic transcription plasmid prO/CHA/99 to obtain recombinant plasmid of prA-FMDV, wherein the specific primers are respectively as follows:
AP1-F：5'-ttttccttaagggacaggaacatgctgtgtttgcctgcgt-3'(SEQ ID NO:5)；
AP1-R：5'-tattttcaccggtgcaataattttctgcttgtgtctgtc-3'(SEQ ID NO:6)；
2) transfecting foot-and-mouth disease virus sensitive cells by using the eukaryotic transcription plasmid rA-FMDV obtained in the step 1) to obtain a second foot-and-mouth disease virus vaccine strain.
In certain embodiments, the foot and mouth disease virus sensitive cells are BHK-21 cells or IBRS-2 cells, in certain embodiments, the second foot and mouth disease virus vaccine strain obtained has a 146S antigen content of 4.0 μ g/m L or greater (146S antigen content is determined as described in Chinese invention patent Z L201310017209.4, which is incorporated herein by reference in its entirety). in certain embodiments, the inactivation is performed with a divinyl imine.
In certain embodiments, the step (c) comprises the steps of:
1) mixing the cDNA nucleic acid of Asia1/HN/06 strain with specific primers Asia1P12A-F and Asia1P12A-R to amplify partial L gene and P1 gene of Asia1/HN/06 strain and partial P2 gene fragment, connecting the amplified product with pMD20-T vector overnight, transforming JM109 competent cells with the connected product, sequencing and identifying positive clone, obtaining recombinant plasmid named pMD20-Asia1P12A, wherein the specific primers are as follows:
Asia1P12A-F:5'-ttttccttaagggacaagaacatgctgtgtttgcctgtgt-3'(SEQ ID NO:8)
Asia1P12A-R:5'-actcacatcgatgtcaaagtgaaacctcc-3'(SEQ ID NO:9)；
2) carrying out PCR amplification by using phosphorylated mutation primers S-P and RSD-P with the correctly identified recombinant plasmid pMD20-Asia1P12A as a template, carrying out blunt end amplification by using the phosphorylated mutation primers to the RGD point of a receptor binding site in an amplification sequence of an Asia1/HN/06 strain, purifying and recovering a PCR product, transforming Escherichia coli JM109 by using a ligation product, sequencing and identifying a positive clone after the point mutation, and naming the obtained site-directed mutation recombinant plasmid as pMD20-Asia1P12A-RSD, wherein the 5' phosphorylated point mutation primers are respectively as follows:
S-P：5'-cacgcagagtgagcaaccggctgcc-3'(SEQ ID NO:10)
RSD-P：5'-cgagggcggcaagatcgctacgccgcgagg-3'(SEQ ID NO:11)；
3) replacing the fragment in the site-directed mutagenesis recombinant plasmid pMD20-Asia1P12A-RSD obtained in the step 2) and inserting the fragment into a eukaryotic transcription plasmid prO/CHA/99 to obtain a recombinant plasmid transfection foot-and-mouth disease virus sensitive cell of prAsia1-RSD-FMDV and obtain a third foot-and-mouth disease virus vaccine strain.
In certain embodiments, a portion of the L gene and the P1 gene of the Asia1/HN/06 strain and a portion of the P2 gene fragment comprise the nucleic acid sequence shown in SEQ ID No. 7. in certain embodiments, the foot and mouth disease virus-sensitive cells are BHK-21 cells or IBRS-2 cells. in certain embodiments, the third foot and mouth disease virus vaccine strain obtained has a 146S antigen content of 3.5 μ g/m L or more (the method of determining the 146S antigen content is described in chinese patent Z L201310055748.7, which is incorporated herein by reference in its entirety).
In certain embodiments, the first, second, and third foot and mouth disease virus vaccine strains are suitable for suspension cell culture. In some embodiments, the first, second and third foot and mouth disease virus vaccine strains may be mixed in an appropriate ratio after inactivation. The first, second and third foot-and-mouth disease virus vaccine strains can be prepared into antigen solutions with certain virus titers respectively, and then the mixing ratio is calculated according to the measured antigen content. In some embodiments, the first, second and third foot-and-mouth disease virus vaccine strains are mixed in a ratio of 1:1:1 antigen content. In certain embodiments, the inactivation is performed with a divinyl imine. In certain embodiments, the vaccine composition is emulsified after said inactivation. In certain embodiments, the emulsification is performed with ISA206 adjuvant in a volume ratio of 1: 1.
In another aspect, the invention relates to the use of said foot and mouth disease virus vaccine composition for the preparation of a medicament for the prevention and/or control of foot and mouth disease in animals. In certain embodiments, the foot and mouth disease is a type a, O, C, Asial, SAT1, SAT2, or SAT3 foot and mouth disease. In certain embodiments, the foot and mouth disease is a type O foot and mouth disease. In certain embodiments, the foot and mouth disease is a type a foot and mouth disease. In certain embodiments, the foot and mouth disease is Asia1 type foot and mouth disease. In certain embodiments, the animal is an artiodactyl. In certain embodiments, the animal is a pig, a cow, or a sheep.
The invention has the following positive effects:
the invention utilizes mature reverse genetic technology, realizes the improvement and the improvement of various phenotypes of the foot-and-mouth disease vaccine strain by modifying related genes, constructs an O-type recombinant vaccine strain with short lesion time, high virus titer, high antigen matching property and high virus yield, combines the successfully developed A-type foot-and-mouth disease recombinant vaccine strain and Asia1 type foot-and-mouth disease recombinant vaccine strain to prepare the trivalent inactivated vaccine of O-type, A-type and Asia1 type foot-and-mouth disease, and obtains the trivalent vaccine with good production performance, good antigen matching property and wide antigen spectrum, which can simultaneously prevent the O-type, A-type and Asia1 type foot-and-mouth disease, enhance the immune efficacy, improve the early immune response, prolong the immune duration and the like. The method solves the problems of production and domestication of the screened vaccine seed virus, and realizes the first development of the high-efficiency trivalent inactivated vaccine by using the vaccine seed virus constructed by the reverse genetic technology.
1) The production performance of the foot-and-mouth disease vaccine strain is improved on the virus level, the pathological change time of the O-type recombinant vaccine strain, the A-type recombinant vaccine strain and the Asia 1-type recombinant vaccine strain is reduced, the virus titer is improved, and the antigen production cost is reduced.
2) The structural proteins of the O-type recombinant vaccine strain, the A-type recombinant vaccine strain and the Asia 1-type recombinant vaccine strain are consistent with the epidemic strains, the antigen matching is completely matched, and the pertinence of the vaccine strain and the epidemic strains is improved.
3) The O-type foot-and-mouth disease recombinant vaccine strain, the A-type foot-and-mouth disease recombinant vaccine strain and the Asia 1-type foot-and-mouth disease recombinant vaccine strain can be rapidly and massively proliferated on suspended BHK-21 cells, the lesion harvesting time of the O-type recombinant vaccine strain is concentrated in 8-14 hours, the antigen content can reach more than 4.0 mu g/m L, the antigen content can reach more than 4.0 mu g/m L6-10 hours after the A-type recombinant vaccine strain is inoculated, the antigen content can reach 3.5 mu g/m L6-10 hours after the Asia 1-type recombinant vaccine strain is inoculated, and the production cost is effectively saved due to the increase of the antigen content.
4) The O-type foot-and-mouth disease recombinant vaccine strain, the A-type foot-and-mouth disease recombinant vaccine strain and the Asia 1-type foot-and-mouth disease recombinant vaccine strain have the characteristic of wide antigen spectrum, structural proteins of the O-type recombinant vaccine strain are obtained by amplifying Mya98 strains which are screened in large quantity, and the selected strain orthosite has good matching performance with the epidemic strains of the pedigree and is overlapped with the epidemic strains of other pedigrees, Panasia and Catay in a cross mode. The cross immunity challenge test shows that the recombinant vaccine strain can effectively protect Mya98, Panasia and Catheay epidemic strains; the A-type foot-and-mouth disease recombinant vaccine strain also has cross immune protection characteristic, can effectively protect SEA-97G1 strain and G2 strain, and the antigen gene of Asia 1-type foot-and-mouth disease recombinant vaccine strain is from G V strain proved by cross challenge test, and can effectively protect G V and G II epidemic strains. The broad-spectrum antigen of the vaccine is realized.
5) The prepared trivalent inactivated vaccine for the foot-and-mouth disease of type O, type A and type Asia1 can effectively stimulate an organism to generate immune response when used for immunizing animals, has the function of synergistically enhancing the immune response among antigens, improves the early immune response, prolongs the immune duration to about 6 months, and greatly enhances the immune efficacy of the foot-and-mouth disease vaccine.
6) The technology of the invention changes the defects of large restriction of natural attributes of viruses, time and labor waste and low success rate of the vaccine virus screening and domesticating technology, realizes more active and effective construction of vaccine strains, realizes innovation of the preparation process of the foot-and-mouth disease inactivated vaccine virus seeds, and has great application value.
Drawings
FIG. 1 is the electrophoresis chart of the L gene, P1 gene and P2 gene fragments of FMDV O/JSCZ/2013 strain in example 1, wherein 1 is the amplified fragment and M is DNA marker.
FIG. 2 is a schematic diagram of the construction strategy of the recombinant plasmid prO-FMDV of foot-and-mouth disease virus type O in example 1.
FIG. 3 is the cytopathic effect (CPE) caused by the recombinant virus rO-FMDV of example 2 after infecting BHK-21 cells, wherein A represents normal BHK-21 cells; b represents BHK-21 cells with CPE.
FIG. 4 is the nucleic acid sequence of SEQ ID NO. 1.
FIG. 5 is the nucleic acid sequences of SEQ ID NO 2 and SEQ ID NO 3.
FIG. 6 is the nucleic acid sequence of SEQ ID NO. 4.
FIG. 7 is the nucleic acid sequences of SEQ ID NO 5 and SEQ ID NO 6.
FIG. 8 is the nucleic acid sequence of SEQ ID NO. 7.
FIG. 9 is the nucleic acid sequences of SEQ ID NO 8 and SEQ ID NO 9.
FIG. 10 is the nucleic acid sequences of SEQ ID NO 10 and SEQ ID NO 11.
Detailed Description
The invention combines strain accumulation in national foot-and-mouth disease reference laboratory in recent years and analysis research on whole genome sequence thereof, amplifies L gene of O-type foot-and-mouth disease virus O/JSCZ/2013 strain and P1 and P2 gene, replaces corresponding nucleotide sequence in a rescue system of the established O-type foot-and-mouth disease virus O/CHA/99 strain by selecting proper restriction endonuclease sites, obtains O-type foot-and-mouth disease virus recombinant plasmid prO-FMDV, obtains O-type foot-and-mouth disease recombinant virus rO-DV after being rescued on BHK-21 cells or IBRS-2 cells, completely matches with antigen of epidemic virus, and is overlapped with epidemic strain antigen of Panasia and Catay lineages, has good production performance, is produced by suspending BHK-21 cells, has antigen content of up to 4.0 mu G/m L, can effectively stimulate organisms to generate strong antibody, has high immune response, high immune response.
The present invention will be further described with reference to the following specific embodiments, but the present invention is not limited to these embodiments.
The experimental procedures used in the following examples were carried out under conventional conditions, unless otherwise specified, as described in molecular biology laboratory Manual (ed. F.M. Osber, R.E. Kingston, J.G. Sedman, ed., Mashimi, Shujiong, Beijing: scientific Press, 2004).
Example 1 construction of infectious clones of recombinant foot-and-mouth disease virus type O
The O/JSCZ/2013 strain used by the inventor is deposited in a foot-and-mouth disease reference laboratory of China designated by department of veterinary medicine of Ministry of agriculture, and can be obtained by the public through a commission letter approved by the department of veterinary medicine of Ministry of agriculture. Designing and synthesizing a pair of amplification primers, OP12A-F (5' -TTTTC), according to the O/JSCZ/2013 strain genome sequenceCTTAAGGGACAGGAACACGCCGTGTTTGCCTGCGT-3') and OP12A-R (5' -ACTCAC)ATCGATGTCAAAGTGAAACCTTC-3'), extracting total RNA of O/JSCZ/2013 strain with RNAeasy Mini Kit (Qiagen), and extracting with primer oligNot I (5' -ttttctaga)gcggccgct38-3') Reverse transcription to synthesize first strand cDNA, preparing 20 mu L reaction system according to product instruction by using PrimeScript Reverse Transcriptase Transcriptase (TaKaRa) Reverse Transcriptase with extremely strong extension ability, reacting for 1h at 42 ℃ for standby, mixing the Reverse transcribed first strand cDNA as a template with primers OP12A-F and OP12A-R and cDNA nucleic acid of O/JSCZ/2013 strain, amplifying to obtain gene fragment of O/JSCZ/2013 strain, amplifying by using L A which is suitable for long-fragment amplification and has excellent performance
Figure BDA0001273523290000141
(TaKaRa Co., Ltd.) DNA polymerase was prepared in accordance with the product instructions 50Mu L reaction system, the amplification conditions are 94 ℃ for 5min, 94 ℃ for 30s, 57 ℃ for 30s, 72 ℃ for 3min for 30 min and 30s, after 35 cycles and 72 ℃ for 10min, PCR amplification products are purified and recovered and are sequenced, the electrophoresis result of the amplification products is shown in figure 1, the size is 3591bp, the size is consistent with the expected size, and the sequencing result shows the nucleotide sequence shown in SEQ ID NO. 1.
The obtained plasmid prO/CHA/99 (disclosed in granted patent "Asia 1 type foot-and-mouth disease recombinant virus and preparation method thereof and application" Z L201310175323. X "and" A type foot-and-mouth disease recombinant vaccine strain and preparation method thereof and application "Z L201310175324.4, the whole contents of which are incorporated into the application) containing O/JSCZ/2013 strain L gene, P1 and P2 gene fragment and O type foot-and-mouth disease virus O/CHA/99 strain rescue system is subjected to double enzyme digestion by AflII and ClaI respectively, then the corresponding target fragment is purified and recovered, connected and transformed into JM109 competent cells, and the positive clone is identified by sequencing to obtain the recombinant plasmid prO-FMDV containing O/JSCZ/2013 strain L gene, P1 and P2 gene, and the construction method is shown in figure 2.
Example 2 rescue of recombinant foot-and-mouth disease virus type O
By using
Figure BDA0001273523290000151
Plasmid Plus Maxi Kit (QIAGEN Co.) the recombinant Plasmid prO-FMDV obtained in example 1 was prepared, used for transfection when BHK-21 cells were grown to 80%, in liposomes L ipofectamineTM2000(Invitrogen) 4. mu.g of recombinant plasmid was transfected into BHK-21 cells, together with liposome controls and normal cell controls, and placed in a 5% CO-containing chamber2And (3) in a 37 ℃ incubator, transfecting for 6h, removing the supernatant, adding an MEM (minimum essential medium) culture medium, continuously culturing, observing the cell state and the cytopathic condition, harvesting the virus when about 90% of cells have lesions, repeatedly freezing and thawing for 3 times, and then inoculating the BHK-21 cells again until the virus can stably produce cytopathic effect and become round, the cells are aggregated into grape-shaped distribution, and finally the cells are disintegrated into fragments. The resulting recombinant virus of type O foot-and-mouth disease was named rO-FMDV, and in fig. 3, a: a normal control BHK-21 cell picture is obtained; b: pictures of CPE appeared when the rescued recombinant virus rO-FMDV was infected with BHK-21 cells.
Example 3 identification of type O foot-and-mouth disease recombinant viruses by RT-PCR
The supernatant of BHK-21 cells infected by stably passaged recombinant virus rO-FMDV is extracted by RNAeasy Mini Kit (Qiagen) to obtain total RNA, after reverse transcription, amplification, purification and recovery, sequencing is carried out, and the result shows that the L gene, the P1 gene and the P2 gene of the obtained recombinant O-type foot-and-mouth disease virus are consistent with the gene sequence of the O/JSCZ/2013 strain.
Example 4 construction of infectious clones of recombinant foot-and-mouth disease virus type A
The A/WH/CHA/09 strain used by the present inventors was deposited in a foot-and-mouth disease reference laboratory of the state designated by the veterinary office of Ministry of agriculture, and publicly available through a letter of commission approved by the veterinary office of Ministry of agriculture. Total RNA from the A/WH/CHA/09 strain was extracted using the RNAeasy Mini Kit (Qiagen) and the primer oligNot I (5' -ttttctaga)gcggccgct38-3') synthesizing a first-strand cDNA of a virus by reverse transcription, and amplifying a gene fragment of the A/WH/CHA/09 strain using primers AP1-F (5'-ttttccttaagggacaggaacatgctgtgtttgcctgcgt-3') and AP1-R (5'-tattttcaccggtgcaataattttctgcttgtgtctgtc-3') using the synthesized first-strand cDNA as a template, wherein L A which is suitable for long-length fragment amplification and has excellent performance is used for amplification
Figure BDA0001273523290000161
(TaKaRa company) DNA polymerase, according to the product instruction, a 50 mu L reaction system is constructed, the amplification conditions are 94 ℃ for 5min, 94 ℃ for 30s, 57 ℃ for 30s, 72 ℃ for 2min for 30s, 35 cycles, 72 ℃ for 8min, the PCR amplification product is purified and recovered after being checked by 0.8% agarose gel electrophoresis and then is delivered for sequencing, and the sequencing result shows that the nucleotide sequence is shown as SEQ ID NO: 4.
The plasmid prO/CHA/99 containing the A/WH/CHA/09 strain part L gene and the P1 fragment and the O-type foot-and-mouth disease virus O/CHA/99 strain rescue system is respectively digested by AflII and SgrAI, then the corresponding target fragment is purified and recovered, connected and transformed into JM109 competent cells, and positive clones are identified by sequencing to obtain the recombinant plasmid prA-FMDV containing the A/WH/CHA/09 strain part leader protein L and the structural protein P1 (the plasmid and the method are disclosed in the granted patent "A-type foot-and-mouth disease recombinant vaccine strain and the preparation method and application thereof" Z L201310175324.4 ", which is incorporated into the application by reference in its entirety).
Example 5 rescue of recombinant foot-and-mouth disease type A viruses
By using
Figure BDA0001273523290000171
Plasmid Plus Maxi Kit (QIAGEN Co.) the recombinant Plasmid prA-FMDV obtained in example 4 was prepared, used for transfection when BHK-21 cells were grown to 80%, in liposomes L ipofectamineTM2000(Invitrogen) 4. mu.g of recombinant plasmid was transfected into BHK-21 cells, together with liposome controls and normal cell controls, and placed in a 5% CO-containing chamber2And (3) in a 37 ℃ incubator, transfecting for 6h, removing the supernatant, adding an MEM (minimum essential medium) culture medium, continuously culturing, observing the cell state and the cytopathic condition, harvesting the virus when about 90% of cells have lesions, repeatedly freezing and thawing for 3 times, and then inoculating the BHK-21 cells again until the virus can stably produce cytopathic effect and become round, the cells are aggregated into grape-shaped distribution, and finally the cells are disintegrated into fragments. The obtained recombinant virus of foot-and-mouth disease type A is named rA-FMDV.
Example 6 identification of type A foot-and-mouth disease recombinant viruses by RT-PCR
The supernatant of BHK-21 cells infected with stably passaged recombinant virus rA-FMDV was subjected to total RNA extraction using RNAeasy Mini Kit (Qiagen), reverse transcription, amplification, purification and recovery, and then sequencing, and the result showed that the obtained part L of the recombinant type A foot-and-mouth disease virus was consistent with the gene sequence of the A/WH/CHA/09 strain as compared with the P1 gene.
Example 7 construction of infectious clone of recombinant foot-and-mouth disease virus type Asia1
The Asia1/HN/06 strain used by the present inventors was deposited in the foot and mouth disease reference laboratory of the state designated by the veterinary office of the Ministry of agriculture, and was publicly available through a letter of commission approved by the veterinary office of the Ministry of agriculture. Total RNA of Asia1/HN/06 strain was extracted using RNAeasy Mini Kit (Qiagen), and primer oligNot I (5' -ttttctaga) was usedgcggccgct38-3') synthesizing a viral first strand cDNA by reverse transcription, and amplifying the synthesized first strand cDNA as a template with primers Asia1P12A-F (5'-ttttccttaagggacaagaacatgctgtgtttgcctgtgt-3') and Asia1P12A-R (5'-actcacatcgatgtcaaagtgaaacctcc-3')Obtain the gene sequence of Asia1/HN/06 strain, L A suitable for long-segment amplification and with excellent performance
Figure BDA0001273523290000172
The DNA polymerase (TaKaRa company) is used for constructing a 50 mu L reaction system according to the product instruction, the amplification conditions are that the PCR amplification product is purified and recovered after being checked by 0.8% agarose gel electrophoresis at 94 ℃ for 5min, 94 ℃ for 30s, 57 ℃ for 30s, 72 ℃ for 3min for 30s, 35 cycles and 72 ℃ for 10min, the PCR amplification product is connected with a pMD20-T vector at 4 ℃ overnight, the connection product is transformed into JM109 competent cells, and positive clones are identified by sequencing, so that the obtained recombinant plasmid is named as pMD20-Asia1P 12A.
Carrying out PCR amplification by using phosphorylation mutation primers S-P and RSD-P by taking correctly identified recombinant plasmid pMD20-Asia1P12A as a template, wherein the 5' phosphorylation point mutation primers are respectively: S-P: 5'-cacgcagagtgagcaaccggctgcc-3', respectively; RSD-P: 5'-cgagggcggcaagatcgctacgccgcgagg-3', in the phosphorylated point mutation primers, the RGD point of the receptor binding site in the amplification sequence of Asia1/HN/06 strain is mutated into RSD, the primers are used for blunt end amplification, PCR products are purified and recovered, after being connected for 5min at room temperature, Escherichia coli JM109 is transformed, positive clones after point mutation are sequenced and identified, the obtained point mutation recombinant plasmid is named as pMD20-Asia1P12A-RSD, and the sequencing result shows that the inserted gene fragment is the nucleotide sequence shown in SEQ ID NO. 7.
Plasmid prO/CHA/99 of plasmid pMD20-Asia1P12A-RSD and O-type foot-and-mouth disease virus O/CHA/99 strain rescue system is respectively double digested by AflII and ClaI, corresponding target fragments are purified and recovered, connected and transformed into JM109 competent cells, positive clones are identified by sequencing, recombinant plasmids containing Asia1/HN/06 strain receptor binding sites mutated into RSD are obtained, and the recombinant plasmids are named as prAsia1-RSD-FMDV (the plasmids and the methods are disclosed in the granted patent "Asia 1 type foot-and-mouth disease recombinant virus as well as the preparation method and application" Z L201310323. X ", which is incorporated into the application by reference in its entirety).
Example 8 rescue of recombinant Asia1 type foot-and-mouth disease Virus
By using
Figure BDA0001273523290000181
Plasmid Plus Maxi Kit (QIAGEN Co.) the recombinant Plasmid prAsia1-RSD-FMDV obtained in example 7 was prepared, used for transfection when BHK-21 cells were grown to 80%, in liposomes L ipofectamineTM2000(Invitrogen) 4. mu.g of recombinant plasmid was transfected into BHK-21 cells, together with liposome controls and normal cell controls, and placed in a 5% CO-containing chamber2And (3) in a 37 ℃ incubator, transfecting for 6h, removing the supernatant, adding an MEM (minimum essential medium) culture medium, continuously culturing, observing the cell state and the cytopathic condition, harvesting the virus when about 90% of cells have lesions, repeatedly freezing and thawing for 3 times, and then inoculating the BHK-21 cells again until the virus can stably produce cytopathic effect and become round, the cells are aggregated into grape-shaped distribution, and finally the cells are disintegrated into fragments. The obtained recombinant Asia1 type foot-and-mouth disease virus was named rAsia 1-RSD-FMDV.
Example 9 identification of recombinant foot-and-mouth disease Virus type Asia1 by RT-PCR
The supernatant of BHK-21 cells infected by the stably passaged recombinant virus rAsia1-RSD-FMDV is subjected to total RNA extraction by using RNAeasy MiniKit (Qiagen), and after reverse transcription, amplification, purification and recovery, sequencing is carried out, and the result shows that the gene sequence is consistent with the sequence of the constructed recombinant Asia1 type foot-and-mouth disease virus.
Example 10 pathogenicity test of recombinant vaccine strains of foot-and-mouth disease type O, A, Asia1 on BHK-21 cells
10.1 pathogenicity test of foot-and-mouth disease O-type recombinant vaccine Strain on BHK-21 cells
BHK-21 cells were digested according to the conventional method, added with MEM cell culture medium containing 10% fetal bovine serum, dispersed in 12-well plates, and contained 5% CO at 37 deg.C2The culture box is used for culturing until the cell monolayer grows to 90 percent for standby. Viral fluid was diluted 10-fold with MEM, and each dilution was diluted (10 times)-4.0～10-9.0) The virus solution was added to a cell plate, 4 wells for each dilution, and the plate was placed at 37 ℃ with 5% CO2The cells were cultured in the incubator of (1), observed for 3 days, and half of the infection amount (TCID) of BHK-21 cells was measured by the Reed-Muench method50). According to the method, the titer of rO-FMDV is determined, and the O-type foot-and-mouth disease recombinant vaccine strain is calculatedTCID of rO-FMDV50Is 10-8.33/mL。
The Reed-Muench calculation Method is prior art in The art and is described in detail in The prior document "Reed, L, J.and Muench, H. (1938)," A Simple Method of Estimating fine percentage points ". The American journal of Hygene 27: 493-497", which is hereby incorporated by reference into this application.
10.2 pathogenicity test of foot-and-mouth disease A-type recombinant vaccine Strain on BHK-21 cells
The half infection amount (TCID) of the type A foot-and-mouth disease recombinant vaccine strain rA-FMDV prepared in example 5 on BHK-21 cells was determined as described in 10.150). Calculating TCID of A-type foot-and-mouth disease recombinant vaccine strain rA-FMDV50Is 10-8.33/mL。
10.3 pathogenicity test of recombinant vaccine strain of Asia1 type foot-and-mouth disease on BHK-21 cells
The half infection amount (TCID) of BHK-21 cells with the recombinant foot-and-mouth disease vaccine strain Asia1 prepared in example 8 was determined according to the method described in 10.150). Calculation of TCID of Asia1 type recombinant vaccine Strain50Is 10-8.77/mL。
Example 11 culturing of recombinant vaccine strains of foot-and-mouth disease type O, A, Asia1 in BHK-21 suspension cells
11.1 sensitivity test of BHK-21 suspension cells to O-type vaccine strains
Inoculating an O-type foot and mouth disease recombinant vaccine strain rO-FMDV cultured and harvested by using adherent BHK-21 cells into 5L bioreactor suspension cells, setting adaptive dissolved oxygen, temperature, PH value, rotating speed and the like, sampling at regular time, observing cell morphology and detecting virus content of a sample (table 1). the result shows that the vaccine strain can be well adapted to BHK-21 suspension cells, the lesion time is short, the antigen content can reach more than 4.0 mu g/m L, the vaccine preparation requirement is met, the suspension cells of continuous 5 generations are subjected to passage, and the nucleotide mutation phenomenon is compared through RT-PCR amplification sequencing, so that the strain has good stability, and the suspension cells can be used for producing and preparing O-type antigens in the recombinant foot and mouth disease O-type, A-type and Asia 1-type trivalent inactivated vaccines.
TABLE 1rO-FMDV vaccine Strain suspension Adaptation results
Figure BDA0001273523290000201
Figure BDA0001273523290000211
-indicating not detected
The suspension cell BHK-21 has good infection and proliferation sensitivity on the O-type foot and mouth disease recombinant vaccine strain, can better realize the replication and proliferation of the foot and mouth disease virus in the cell, has characteristic pathological changes such as cell death, cell lysis and the like, regularly concentrates the peak of the virus content in 8-14 hours, improves the antigen 146S, is proved by continuous passage to be capable of proliferating stably by the vaccine strain, and can completely use the suspension BHK-21 cell to produce the O-type foot and mouth disease antigen to prepare the recombinant trivalent inactivated vaccine.
11.2 sensitivity test of BHK-21 suspension cells to type A vaccine strains
Inoculating an A-type foot-and-mouth disease recombinant vaccine strain rA-FMDV cultured and harvested by using adherent BHK-21 cells into 5L bioreactor suspension cells, setting adaptive dissolved oxygen, temperature, PH value, rotating speed and the like, sampling at regular time, observing cell morphology and detecting virus content of a sample (table 2). The result shows that the vaccine strain can be well adapted to the BHK-21 suspension cells, the lesion time is short, the antigen content can reach more than 4.0 mu g/m L, the vaccine preparation requirement is met, the suspension cells of continuous 5 generations are subjected to passage, and the nucleotide mutation phenomenon is compared through RT-PCR amplification sequencing, and the result shows that the strain has good stability, and the suspension cells can be used for producing and preparing the A-type antigen in the recombinant foot-and-mouth disease O, A and Asia1 type trivalent inactivated vaccine.
TABLE 2rA-FMDV vaccine strain suspension adaptation results
Figure BDA0001273523290000221
-indicating not detected
After suspension BHK-21 cells are inoculated with the recombinant vaccine strain rA-FMDV of the foot-and-mouth disease A, the dissolved oxygen is close to zero in about 7 hours on average, then the cells are gradually diseased and cracked, and a large number of virus particles with infectivity are generated, which indicates that the virus propagation speed is high, the cytopathic time is shorter than that of other strains, the cells are basically dead and disintegrated after 6-10 hours after virus inoculation, the activity rate is zero, the content of the virus particles 146S can reach more than 4.0 mu g/m L, and finally the virus receiving time is even as high as 6.33 mu g/m L, which indicates that the recombinant vaccine strain rA-FMDV of the foot-and-mouth disease A can be massively propagated in BHK-21 cells cultured in suspension, and the BHK-21 cell strain has good sensitivity to the recombinant vaccine strain, the virus valence and 146S are high through continuous 5-generation suspension culture, continuous passage sequencing proves that the strain can be stably propagated, and the suspension BHK-21 cells can be completely used for producing the recombinant vaccine inactivated vaccine antigen of the foot-mouth disease A to.
11.3 sensitivity test of BHK-21 suspension cells to Asia1 type vaccine strain
Inoculating an Asia1 type foot and mouth disease recombinant vaccine strain cultured and harvested by using adherent BHK-21 cells into suspension cells of a 5L bioreactor, setting adaptive dissolved oxygen, temperature, pH value, rotating speed and the like, sampling at regular time, observing cell morphology and detecting virus content of a sample (Table 3), wherein the result shows that the vaccine strain can be well adapted to BHK-21 suspension cells, the lesion time is short, the antigen content can reach more than 3.5 mu g/m L, the vaccine preparation requirement is met, the suspension cells of 4 continuous generations are subjected to passage, and the nucleotide mutation phenomenon is compared through RT-PCR amplification sequencing, so that the strain has good stability, and the production preparation of the Asia1 type antigen in the recombinant foot and mouth disease O type, A type and Asia1 type trivalent inactivated vaccine can be carried out by using the suspension cells.
TABLE 3rAsia1-RSD-FMDV vaccine strain suspension adaptation results
Figure BDA0001273523290000231
-indicating not detected
After suspension BHK-21 cells are inoculated with Asia1 type foot and mouth disease recombinant vaccine strain rAsia1-RSD-FMDV, the dissolved oxygen is close to zero in about 7 hours, a large number of infectious virus particles are generated, the virus propagation speed is high, the cytopathic time is short, the cells die and disintegrate basically after 6-10 hours after inoculation, the survival rate is zero, the content of the virus particles 146S can reach more than 3.5 mu g/m L, the suspension BHK-21 cell strain has good sensitivity to the recombinant vaccine strain, continuous passage sequencing proves that the vaccine strain can propagate stably, and the suspension BHK-21 cells can be used for producing Asia1 type foot and mouth disease antigen to prepare trivalent inactivated vaccine.
Example 12 preparation of recombinant vaccine for type O foot-and-mouth disease and evaluation of immune Effect
12.1 vaccine preparation
The recombinant virus rO-FMDV prepared by suspending BHK-21 cells is inactivated, 3mmol/l of Binary Ethylene Imine (BEI) (Sigma company) is used for 30 hours of inactivation, a blocking agent sodium thiosulfate solution is added, the mixture is kept overnight at 4 ℃ for later use, the inactivated antigen is mixed with an ISA206 adjuvant (French SEPPIC) in a ratio of 1:1 after security inspection to prepare a vaccine, the vaccine is prepared according to the foot-and-mouth disease inactivated vaccine procedure of veterinary biological products in the pharmacopoeia of the people's republic of China, the inactivated virus is injected into the tongue of a security inspection cow at2 ml/head subcutaneously, the cow is observed for 6 days continuously day by day, the cow is good in the observation period, the hoof and the nose are not abnormal, the experimental cow is purchased from a non-epidemic area, and the O type antibody is detected to be less than 1: 4 by the FMD non-structural protein 3-ABC L antibody through the FMD liquid phase blocking E L (L PB-E L ISA) produced by the national foot-and mouth disease reference laboratory to detect that the O type antibody is negative.
12.2 vaccine immunization challenge protection test
The obtained O-type foot-and-mouth disease recombinant virus vaccines qualified in security inspection are used for immunizing 10 cattle and 10 pigs respectively, and 2 non-immune controls are arranged at the same time respectively to determine the immune efficacy. The method of attacking and the method of determining the result were as described in Manual of diagnostic tests and vaccines for terrestrial animals (2009 edition, world animal health Organization (OIE)).
28 days after immunizing pigs, 1000 times of pig half infection dose (SID) is used50Dose) were subjected to challenge experiments with continuous observation for 10 days, and the results showed that the immunized animals had no clinical symptoms and 100% protection, as shown in table 4.
TABLE 4 clinical symptoms and protective conditions of O-type foot-and-mouth disease recombinant vaccine immunized pigs after challenge
Figure BDA0001273523290000241
Figure BDA0001273523290000251
28 days after immunizing cattle, 10000 times of cattle half infection dose (BID) is used50Dose) were subjected to challenge experiments with continuous observation for 10 days, and the results showed: the immunized animals had no clinical symptoms and 100% protection as shown in table 5.
TABLE 5 clinical symptoms and protective conditions of O-type foot-and-mouth disease recombinant vaccine after challenge
Figure BDA0001273523290000252
The O-type foot-and-mouth disease recombinant virus is used as a vaccine strain to immunize pigs and cattle, so that the attack of the current O-type foot-and-mouth disease epidemic virus can be effectively protected.
12.3 vaccine immunopotency and Cross-challenge test
According to the method of 'Chinese animal pharmacopoeia' 2015 edition, the O antibodies detected by FMD liquid phase blocking E L ISA (L PB-E L ISA) produced by foot and mouth disease reference laboratory are all less than 1: 4, the FMD non-structural protein 3ABC-E L ISA antibodies are detected to be negative, the animals used in the experiment are strictly housed in ABS L-3 laboratory, and half protection amount (PD) recorded in 'Chinese animal pharmacopoeia' 2015 edition is adopted50) The half protection amount of the vaccine is determined by the determination method, and the specific method is as follows. Immunizing 15 immune groups in each group with 1 part of immune dose, 1/3 parts of immune dose and 1/9 parts of immune dose, respectively, and after 28 days, respectively using Mya-98, Panasia and Cathay epidemic representative viruses to attack the viruses, wherein the attack dose is 1000 times of SID50Each group was provided with 3 controls, and the toxic challenge method was intramuscular injection. Continuously observing for 15 days, and judging the disease condition of animals caused by virus liquid according to foot-and-mouth disease symptoms such as blisters on tongue surfaces, gingiva and hooves, wherein the animals are judged to be unprotected. The proportion of protection of each group of immunized animals was calculated. Finally, each group is calculated according to the Reed-Muench methodPD50。
The results of the immunity efficacy and cross-challenge test show that the PD of the O-type foot-and-mouth disease recombinant strain pair Mya-98, Panasia and Catheay5013.59, 7.05 and 9.0 respectively, and has immune protective effect on O type foot-and-mouth disease virus with different topotypes higher than that of PD recommended by OIE50(namely, 6) is an ideal recombinant vaccine against the type-O foot-and-mouth disease, and can be used for preventing and controlling the type-O foot-and-mouth disease virus in China and the surrounding countries, see Table 6.
TABLE 6 immune efficacy and cross-challenge protection results of recombinant vaccine strain of O-type foot-and-mouth disease
Figure BDA0001273523290000261
Example 13 preparation of recombinant vaccine for type A foot-and-mouth disease and evaluation of immune Effect
13.1 vaccine preparation
Inactivating recombinant virus rA-FMDV prepared by suspending BHK-21 cells, inactivating the inactivated virus rA-FMDV with 3mmol/l of Binary Ethylene Imine (BEI) (Sigma company) at 30 ℃ for 30h, adding a blocking agent sodium thiosulfate solution, keeping the inactivated antigen overnight at 4 ℃ for later use, mixing the inactivated antigen with an ISA206 adjuvant (French SEPPIC) in a ratio of 1:1 after security inspection to prepare a vaccine, specifically preparing according to the foot-and-mouth disease inactivated vaccine procedure of veterinary biological products in the pharmacopoeia of the people's republic of China, subcutaneously injecting inactivated virus into the tongue of a security inspection cattle at2 ml/head, continuously observing the inactivated virus day by day for 6 days, wherein the cattle are good in the observation period, and the hoof and the nose are not abnormal, and the experimental cattle are purchased from a non-epidemic area, and are detected to be negative by FMD liquid phase blocking E L (L PB-E L ISA) produced by the national foot-and mouth disease reference laboratory, and the A type antibody is less than 1: 4, and the FMD non-structural protein 3-E L ISA antibody is.
13.2 vaccine immunopotency assay
Cattle for test are purchased from non-epidemic areas, and are detected to be less than 1: 4 by FMD liquid phase blocking E L ISA (L PB-E L ISA) produced by national foot and mouth disease reference laboratory, FMD non-structural protein 3ABC-E L ISA antibody is detected to be negative, animals used in the test are strictly housed in ABS L-3 laboratory, a control group is vaccine prepared by immunizing epidemic virus A/WH/CHA/09, and an experimental group is immunizedVaccine prepared by recombination rA-FMDV, and toxin for attacking is 10000 times of BID50The epidemic toxin A/WH/CHA/09. The mode of counteracting toxic pathogen is to inject the toxic liquid into the tongue and the epidermis at multiple points. Continuously observing for 15 days, and judging the cattle disease condition caused by virus liquid according to the foot-and-mouth disease symptoms of blisters, ulcers and the like on the tongue surface, the gingiva and the hoof of the cattle. The result of the immune potency determination shows that the PD of the A type foot-and-mouth disease recombinant strain50Vaccine PD prepared from 10.81-13.59 epidemic strains50It was 5.57 (Table 7).
TABLE 7 recombinant vaccine strain of foot-and-mouth disease type A and epidemic strain PD50Experimental comparison table
Figure BDA0001273523290000271
Example 14 preparation of recombinant Asia1 type foot-and-mouth disease vaccine and evaluation of immune Effect
14.1 vaccine preparation
Inactivating recombinant virus rAsia1-RSD-FMDV prepared by suspending BHK-21 cells, inactivating the inactivated virus rAsia1-RSD-FMDV by using 3mmol/l of Binary Ethylene Imine (BEI) (Sigma company) at 30 ℃ for 30h, adding a blocking agent sodium thiosulfate solution, keeping overnight at 4 ℃ for later use, mixing the inactivated antigen with an ISA206 adjuvant (French SEPPIC) in a ratio of 1:1 after security inspection to prepare a vaccine, specifically preparing according to the foot-and-mouth disease inactivation vaccine procedure of veterinary biological products in the pharmacopoeia of the people's republic of China, subcutaneously injecting the inactivated virus into tongue of a security inspection cattle at2 ml/head, continuously observing for 6 days day by day, wherein the cattle in the observation period is healthy, and the hoof and the nose are not abnormal, and the experiment is carried out by using the cattle purchased from a non-epidemic area, and detecting the Asia1 type antibody by the FMD liquid phase blocking E L ISA (L PB-E L ISA) produced by the national foot-and mouth disease reference laboratory to detect the FMD negative antibody as ABC 3-E L.
14.2 vaccine immunopotency assay
Cattle for test are purchased from non-epidemic areas, and Asia1 type antibodies are less than 1: 4 after being detected by FMD liquid phase blocking E L ISA (L PB-E L ISA) produced by national foot and mouth disease reference laboratory, FMD non-structural protein 3ABC-E L ISA antibodies are detected to be negative, animals used in the test are strictly housed in ABS L-3 laboratory, a control group is vaccine prepared by immunizing epidemic toxin Asia1/HN/06, and the test is carried outThe test group is vaccine immunized by recombinant rAsia1-RSD-FMDV, and the challenge dose is 10000 times of BID50. The mode of counteracting toxic pathogen is to inject the toxic liquid into the tongue and the epidermis at multiple points. Continuously observing for 15 days, and judging the cattle disease condition caused by virus liquid according to the foot-and-mouth disease symptoms of blisters, ulcers and the like on the tongue surface, the gingiva and the hoof of the cattle. The result of the immune potency measurement shows that the PD of the Asia1 type foot-and-mouth disease recombinant strain50Vaccine PD prepared from 9.0-13.59 epidemic strains50It was 6.34 (Table 8).
TABLE 8 recombinant strain of Asia1 type foot-and-mouth disease and epidemic strain PD50Experimental comparison table
Figure BDA0001273523290000281
Figure BDA0001273523290000291
Example 15 preparation of trivalent inactivated vaccine for foot and mouth disease type O, type A, and type Asia1 and evaluation of immune Effect
15.1 vaccine preparation
Respectively inactivating recombinant vaccine strains rO-FMDV, rA-FMDV and rAsia1-RSD-FMDV cultured by suspension BHK-21 cells, inactivating the recombinant vaccine strains for 30 hours at 30 ℃ by using 3mmol/l of Binary Ethylene Imine (BEI) (Sigma company), adding a blocking agent sodium thiosulfate solution, keeping the mixture at 4 ℃ overnight, storing for later use, carrying out inactivated antigen concentration detection 146S, mixing the antigen solution with an ISA206 adjuvant (SEPPIC France) in a ratio of 1:1 to emulsify to prepare the vaccine, specifically, preparing the vaccine according to foot-and-mouth disease inactivated vaccine of a biological product in the people' S republic of China protocol for veterinary use, carrying out safety inspection on 2 ml/head of inactivated virus injected subcutaneously into the tongue of cattle, continuously observing for 6 days day by day, detecting the health of the cattle in an observation period, wherein the hoof part and the nose are abnormal, the cattle are purchased from a non-epidemic area, and are detected by a liquid phase blocking FMD experiment reference cell, namely, the ABC 1, ISA antibody, 3-ISA, 364, and the antibody detection method for detecting the foot-ISA antibody.
15.2 vaccine immunization challenge protection test
Screening negative animals, detecting the type-O, type-A and Asia1 antibodies BY FMD liquid blocking E L ISA (L PB-E L ISA) produced BY a foot and mouth disease reference laboratory, wherein the type-O, type-A and Asia1 antibodies are all less than 1: 4, detecting the FMD non-structural protein 3ABC-E L ISA antibodies as negative, immunizing pigs BY the obtained recombined type-O, type-A and Asia1 trivalent inactivated vaccines qualified in security inspection, simultaneously setting 3 nonimmune controls respectively, and measuring the immune efficacy of the vaccines, immunizing each group BY 15 heads, wherein the immune dose is divided into 1 head part, 1/3 head part and 1/9 head part, the type-O attacking strain is a Mya98 strain (O/Mya 98/BY/2010) which is prevalent in 2010, the type-A attacking strain is selected BY a dominant strain A/GDD, the type-Asia 1 attacking strain is selected BY Asia1/HN/06, and a result judgment method are carried out according to the animal health of human diagnosis and scientific research in the world (OIE 2009)).
After immunizing pig for 28 days, 1000-fold SID is used50And respectively carrying out challenge experiments on the toxic doses, continuously observing for 15 days, judging that at least one hoof of the control pigs has blisters or ulcers, and judging that the immune pigs have any foot-and-mouth disease symptoms, namely, the immune pigs are unprotected. Calculating the PD of the vaccine to be detected according to the protection number of the immune pigs and the Reed-Muench method50(Table 9).
TABLE 9 protective results of immune challenge of trivalent inactivated vaccine for recombinant foot and mouth disease type O, A and Asia1
Figure BDA0001273523290000301
Through vaccine immunopotency experiments, the protective efficacy results are far greater than the OIE recommended 6PD50The trivalent inactivated vaccine for the foot-and-mouth disease type O, A and Asia1 is used for immunizing animals, and the attack of the O-type Mya98 strain, the A-type SEA-97G2 strain and Asia1 epidemic strains can be effectively protected.
15.3 Cross-challenge protection test
Negative animals were selected according to the same test method as described above. Immunizing pigs with trivalent inactivated vaccine for foot-and-mouth disease types O, A and Asia1, immunizing each group with 15 vaccine doses of 1 part, 1/3 parts and 1/9 parts, immunizing separately for 28 days, selecting Panasia (O/0834) and Catheay (0718) as cross-attacking strains of O type, collecting A type strainsThe strain which is epidemic in 2009 (A/WH/09) is used for virus attack. SID with 1000-fold toxic dose 503 controls are arranged in each group, the continuous observation is carried out for 15 days, the disease condition of animals caused by virus liquid is judged according to the foot-and-mouth disease symptoms such as blisters appearing on the tongue surface, the gingiva and the hoofs, and the measurement results of the immunity efficacy and the cross-challenge test show that the protection number of half animals of the vaccine measured by the cross-challenge test is 6PD50The above shows that the cross-attacking animal has good protection effect. After the vaccine is used for immunizing animals, the vaccine can resist the attack of the strains and can be used as a domestic trivalent vaccine for preventing O-type, A-type and Asia 1-type foot-and-mouth diseases. The results are shown in Table 10.
TABLE 10 Cross-challenge protection results of recombinant trivalent inactivated vaccine for foot and mouth disease type O, A, and Asia1
Figure BDA0001273523290000311
15.4 duration of immunization test
Screening negative animals, detecting the antibodies of O type, A type and Asia1 by FMD liquid phase blocking E L ISA (L PB-E L ISA) produced by a foot and mouth disease reference laboratory, wherein the antibodies of the O type, A type and Asia1 are all less than 1: 4, detecting the antibodies of FMD non-structural protein 3ABC-E L ISA to be negative, carrying out virus attack tests on the immune pigs of the obtained recombined foot and mouth disease type O type, A type and Asia1 trivalent inactivated vaccines qualified in security inspection, wherein the virus attack protection condition is shown in 11, and the result shows that the vaccine has very good antigen protection and immunogenicity, the immune duration is prolonged to about 6 months (about 4 months in the conventional vaccine), and finally determining that the immunity of the foot and mouth disease type O type, A type and Asia1 trivalent inactivated vaccine is 6 months.
TABLE 11 trivalent inactivated vaccine immunization 28 days, 180 days, 210 days post-challenge protection rate
Figure BDA0001273523290000312
Challenge tests are carried out 28 days, 180 days and 210 days after immunization, the challenge protection percentage of each type after 28 days and 180 days after immunization of the vaccine is not lower than 80 percent, and the challenge protection percentage of each type after 210 days of immunization reaches 70 percent.
According to the 7-month challenge protection rate and the analysis of the determined antibody titer result, the immune protection of the foot-and-mouth disease type O, A and Asia1 trivalent inactivated vaccines is good, the immune duration is prolonged to 6 months, and the immune efficacy of the foot-and-mouth disease type O, A and Asia1 vaccines is greatly improved.
The above-mentioned embodiments only represent the embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that other modifications can be made by those skilled in the art without departing from the spirit of the invention, and these are within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
SEQ ID NO:1
CTTAAGGGACAGGAACACGCCGTGTTTGCCTGCGTCACCTCCAACGGGTGGTACGCGATCGACGACGAAGAATTCTACCCCTGGACGCCAGATCCGTCCGACGTGCTGGTCTTTGTCCCGTACGATCAAGAACCACTTAATGGAGAATGGAAAGCAAGGGTTCAGAGACGGCTCAAGGGAGCCGGACAATCCAGTCCGGCTACTGGGTCACAGAACCAATCAGGCAACACCGGGAGTATCATCAACAATTACTACATGCAGCAATACCAGAACTCCATGGACACCCAACTTGGTGACAATGCTATCAGCGGAGGCTCCAACGAGGGATCCACAGACACAACCTCCACCCACACAACCAACACTCAGAACAATGACTGGTTTTCAAAGTTGGCCAGCTCTGCCTTCAGCGGTCTTTTCGGCGCCCTCCTCGCCGATAAGAAAACCGAGGAGACCACTCTTCTCGAGGACCGCATCCTCACCACCCGAAACGGACACACCACCTCGACAACCCAGTCGAGTGTTGGCATAACGCACGGGTACGCAACAGCTGAGGATTTTGTGAACGGGCCAAACACCTCTGGTCTTGAGACCAGAGTTGTCCAGGCGGAACGGTTCTTTAAAACCCACCTGTTCGACTGGGTCACCAGTGATCCGTTCGGACGGTACTACTTGTTGGAGCTCCCGACTGACCACAAAGGTGTCTACGGCAGCCTGACCGACTCATACGCCTACATGAGAAACGGTTGGGATGTTGAGGTCACCGCTGTGGGGAATCAGTTCAACGGAGGCTGCCTACTGGTGGCCATGGTACCTGAACTTTGTTCCATCGAGCGGAGAGAGCTGTTCCAGCTTACGCTCTTCCCCCACCAGTTCATCAACCCCCGGACGAACATGACAGCCCACATCAAGGTGCCCTTTGTTGGCGTCAACCGTTACGATCAGTACAAGGTACACAAGCCGTGGACCCTTGTGGTTATGGTCGTAGCCCCACTGACTGTCAACACCGAAGGCGCTCCGCAGATCAAGGTGTATGCCAACATCGCACCCACCAACGTGCACGTCGCGGGTGAGTTCCCTTCCAAAGAGGGGATTTTCCCTGTGGCCTGTAGCGACGGTTATGGCGGCTTGGTGACAACTGACCCAAAGACGGCTGACCCCGTTTACGGCAAAGTGTTCAACCCCCCCCGCAACATGTTGCCGGGGCGGTTCACCAACCTCCTGGGCGTGGCTGAGGCTTGCCCCACGTTTCTGCACTTCGATGGTGACGTACCGTATGTGACCACTAAGACGGATTCGGACAGGGTGCTCGCACAATTTGACTTGTCTTTGGCAGCAAAACACATGTCAAACACCTTCCTTGCAGGTCTTGCCCAGTACTACACGCAGTACAGCGGCACCGTTAACCTGCACTTCATGTTCACAGGTCCCACTGACGCGAAAGCGCGTTACATGATTGCGTATGCCCCTCCGGGCATGGAGCCGCCCAAAACACCTGAGGCTGCTGCTCACTGCATTCACGCAGAGTGGGACACGGGTCTGAACTCAAAGTTTACCTTTTCCATCCCCTACCTCTCGGCGGCTGATTACGCGTACACCGCGTCTGACGCTGCTGAGACCACAAATGTTCAGGGATGGGTCTGCTTATTTCAAATAACACACGGGAAAGCTGAGGGTGACGCTCTTGTCGTGCTGGCCAGTGCTGGCAAAGACTTTGAGCTGCGCCTGCCTGTGGACGCTCGGCAACAGACCACTTCGACGGGCGAGTCGGCTGACCCCGTGACTGCCACCGTTGAGAATTACGGTGGCGAGACACAGGTCCAGAGGCGCCACCACACAGACGTCTCATTCATATTGGACAGATTTGTGAAAGTCACACCAAAAGACTCAATAAATGTATTGGACCTGATGCAGACCCCCTCCCACACCCTAGTAGGGGCGCTCCTCCGCACTGCCACTTACTATTTCGCTGATCTAGAGGTGGCAGTGAAACACAAGGGGGACCTTACCTGGGTGCCAAATGGAGCACCTGAAGCAGCCTTGGACAACACCACCAACCCAACGGCGTACTATAAGGCGCCGCTTACCCGGCTTGCATTGCCCTACACGGCACCACACCGTGTTTTGGCCACCGTTTACAACGGGAAATGCAAATACGCCGGGGGCTCACTGCCCAACGTGAGAGGCGATCTCCAAGAGCTGGCTCAGAAGGCAGCGAGGCCGCTGCCTACTTCTTTCAACTACGGTGCCATCAAAGCCACTCGGGTGACAGAACTGCTGTACCGCATGAAGAGGGCCGAGACGTACTGTCCTCGGCCCCTTTTGGCTGTTCACCCGAGTGCGGCCAGACACAAACAGAAAATAGTGGCGCCTGTAAAGCAGTCCTTGAACTTTGATCTGCTCAAGTTGGCAGGGGACGTGGAGTCCAACCCTGGGCCCTTCTTCTTCTCTGACGTCAGGTCAAACTTCACCAAACTGGTGGAAACCATCAACCAGATGCAAGAGGACATGTCAACAAAACACGGACCCGACTTTAACCGGTTGGTATCAGCGTTTGAGGAATTGGCCGCTGGGGTGAAAGCCATCAGGACCGGCCTCGACGAGGCCAAACCCTGGTACAAGCTCATCAAGCTCCTGAGCCGCTTGTCATGCATGGCCGCTGTAGCAGCACGGTCCAAGGACCCAGTCCTTGTGGCTATCATGCTGGCTGACACCGGTCTTGAGATTCTGGACAGCACATTTGTCGTGCAGAAAATCTCCGACTCCCTCTCCAGTCTCTTTCACGTGCCGGCCCCCGTCTTCAGTTTCGGAGCTCCGATTCTGCTAGCCGGGTTGGTCAAGGTCGCCTCGAGCTTCTTCCGGTCCACACCCGAGGATCTCGAGAGAGCAGAGAAACAGCTCAAAGCACGTGACATCAATGACATCTTCGCCATTCTCAAGAACGGCGAGTGGCTGGTCAAGTTGATCCTAGCCATCCGCGACTGGATTAAAGCATGGATCGCCTCAGAAGAGAAGTTTGTCACCATGACAGACTTGGTGCCTGGCATCCTTGAAAAGCAGCGGGACCTCAACGACCCGGCCAAGTACAAGGAAGCCAAGGAATGGCTCGACAACGCGCGCCAAACGTGTTTGAAGAGCGGGAACGTCCACATTGCCAACCTGTGCAAAGTGGTCGCCCCAGCACCGAGCAAGTCGAGACCTGAACCCGTGGTCGTGTGCCTCCGCGGCAAATCCGGTCAGGGTAAGAGTTTCCTTGCGAACGTGCTGGCACAAGCCATCTCTACCCACTTTACCGGCAGGACTGACTCAGTTTGGTACTGTCCGCCAGACCCTGACCACTTCGACGGTTACAACCAGCAGACCGTTGTTGTGATGGATGATTTGGGCCAGAATCCCGACGGCAAGGACTTCAAGTACTTCGCCCAGATGGTCTCGACCACGGGGTTCATCCCGCCCATGGCTTCACTTGAGGACAAAGGCAAGCCTTTCAACAGCAAAGTCATCATTGCCACCACCAACCTGTACTCGGGCTTCACCCCGAGAACCATGGTGTGCCCCGATGCGCTGAACCGAAGGTTTCACTTTGACATCGAT
SEQ ID NO:2
TTTTCCTTAAGGGACAGGAACACGCCGTGTTTGCCTGCGT
SEQ ID NO:3
ACTCACATCGATGTCAAAGTGAAACCTTC
SEQ ID NO:4
CTTAAGGGACAGGAACACGCAGTGTTTGCCTGTGTTACCTCCAACGGGTGGTACGCGATTGACGACGAGGACTTTTACCCCTGGACACCAGACCCGTCTGATGTCCTGGTGTTTGTCCCGTATGATCAAGAACCACTCAACGGAGAATGGAAAACAAAGGTTCAGAGGCGACTTAAAGGGGCAGGGCAATCTAGCCCCGCCACCGGGTCGCAGAACCAGTCAGGCAATACCGGCAGCATCATTAACAACTACTACATGCAGCAGTACCAGAACTCCATGGACACACAACTTGGTGACAACGCCATCAGCGGAGGATCCAACGAGGGGTCCACGGACACAACCTCTACCCACACAACCAACACCCAAAACAATGACTGGTTCTCAAAACTGGCAAGTTCTGCATTCACCGGTCTTTTCGGCGCACTGCTCGCCGACAAGAAGACCGAAGAGACAACTCTTCTGGAGGACCGTATCCTCACCACTCGTAATGGACACACCACCTCTACAACTCAGTCGAGTGTGGGGGTCACCTACGGGTATTCAACTGGTGAGGACCACGTTTCTGGACCTAACACATCAGGTTTGGAGACGCGGGTGGTACAAGCTGAAAGGTTCTTCAAGAAGCACTTGTTTGATTGGACAACGGACAAACCCTTTGGTCACATTGAAAAGCTGGAACTTCCCACTGATCACAAAGGTGTCTACGGACAGCTGGTGGACTCCTTTGCATACATGAGAAATGGCTGGGACGTGGAGGTGTCTGCTGTTGGCAACCAGTTCAACGGCGGGTGCCTTCTCGTGGCCATGGTACCTGAGTTTAAGGAGTTCACCACACGTGAAAAGTACCAGCTCACCCTGTTCCCCCACCAGTTCATTAGCCCCAGAACCAACATGACCGCGCACATCACGGTCCCGTACCTTGGTGTGAACAGGTATGACCAGTACAACAAACACAAACCCTGGACGTTGGTGGTGATGGTGGTTTCGCCACTTACCACTAGCTCCATTGGTGCATCACAGATTAAGGTCTACACCAACATCGCCCCGACCCACGTTCACGTGGCTGGCGAGCTCCCGTCGAAAGAGGGGATCGTGCCAGTCGCCTGCTCGGACGGGTACGGTGGCCTGGTGACAACAGACCCTAAAACAGCTGACCCTGCTTACGGTATGGTGTACAACCCACCTAGGACCAACTACCCCGGGCGGTTTACAAACTTGTTGGACGTGGCAGAGGCGTGCCCCACCTTCCTCTGTTTCGACGACGGGAAACCGTACGTTGTGACAAGAACGGACGAGCAGCGCCTCTTGGCCAAGTTTGACCTTTCCCTTGCTGCAAAGCACATGTCAAACACCTACCTTTCAGGGATAGCACAGTACTACGCACAGTACTCTGGCACCATCAATTTGCACTTCATGTTTACTGGTTCCACTGACTCAAAGGCCCGTTACATGGTGGCTTACGTCCCGCCCGGCGTGACAACGCCACCGGACACGCCTGAGAGAGCTGCGCACTGCATCCACGCAGAATGGGACACGGGGCTAAACTCCAAATTCACTTTTTCAATCCCATACGTATCTGCTGCAGATTACGCGTACACAGCGTCCGATGTGGCAGACACAACAAACGTACAGGGATGGGTTTGCATCTACCAAATCACCCATGGGAAGGCCGAACAAGACACTCTGGTTGTGTCGGTCAGCGCCGGCAAAGACTTTGAGCTGCGCCTCCCCATTGACCCCCGTGCGCAAACCACCGCCACCGGGGAATCAGCAGACCCCGTCACAACCACCGTCGAGAACTACGGTGGTGAGACACAAGTGCAGCGACGCCACCACACCGACGTCAGCTTCATAATGGACAGGTTTGTGCAAATCAAGCCTGTGAGCCCCACACATGTCATTGACCTCATGCAAACACACCAACACGGGCTGGTGGGCGCTATGTTGCGCGCGGCCACCTACTACTTTTCTGATCTTGAGATTGTGGTGAACCACACGGGTCGCCTAACGTGGGTACCCAATGGAGCACCTGAGGCAGCACTGGACAACACGAGCAACCCCACTGCTTACCACAAAGCACCGTTCACACGGCTTGCACTCCCTTACACCGCGCCACACCGCGTGTTGGCAACTGTGTACAACGGGAATAGCAAGTACTCTGCGCCTGCAACACGGCGAGGTGACTTGGGGTCTCTCGCGGCGAGGCTCGCCGCACAGCTTCCTGCCTCCTTCAACTACGGCGCGATTCGAGCCACGGAGATCCAAGAACTCCTCGTGCGCATGAAGCGTGCCGAGCTCTACTGCCCCAGGCCACTGCTGGCGGTGGAGGTGACGTCACAAGACAGACACAAGCAGAAAATTATTGCACCGGTG
SEQ ID NO:5
ttttccttaagggacaggaacatgctgtgtttgcctgcgt
SEQ ID NO:6
Tattttcaccggtgcaataattttctgcttgtgtctgtc
SEQ ID NO:7
CTTAAGGGACAAGAACATGCTGTGTTTGCCTGTGTCACCTCCAACGGGTGGTACGCGATTGATGACGAGGACTTTTACCCCTGGACACCGGACCCGTCCGACGTCTTGGTGTTTGTTCCGTACGACCAAGAACCGCTCAACGGCGAGTGGAAAGCAAAGGTTCAGAAGCGGCTCAAGGGAGCCGGGCAATCCAGCCCGGCGACCGGGTCGCAGAACCAGTCAGGCAACACTGGAAGCATCATTAACAACTACTACATGCAGCAGTACCAGAACTCCATGGACACGCAACTTGGAGATAACGCTATCAGCGGAGGCTCCAACGAGGGTTCCACGGACACCACATCCGCACACACAAACAACACCCAAAACAATGATTGGTTCTCACGCTTGGCCAACTCGGCCTTTAGCGGACTGTTTGGTGCTCTTTTGGCTGACAAGAAAACGGAGGAGACAACTCTGCTTGAAGACCGCATTCTCACCACCAGAAATGGCCACACGACGTCGACGACACAGTCGAGTGTTGGCGTAACATATGGTTACGCTGTGGCTGAAGACGCGGTATCTGGGCCTAACACCTCAGGCCTGGAGACCCGCGTAACACAGGCTGAACGGTTCTTCAAGAAACACCTGTTTGACTGGACGCCGGATTTGTCATTTGGACACTGTCACTACTTGGAACTCCCCTCTGAACACAAGGGCGTGTTTGGCAGCCTCATGAGCTCTTATGCTTACATGAGGAACGGGTGGGACGTTGAGGTGACCGCTGTTGGAAATCAGTTCAATGGTGGTTGTCTCCTCGTCGCACTCGTGCCGGAGCTGAAAGAGCTCGACACGCGGCAGAAGTATCAGTTAACCCTCTTCCCACACCAGTTCATTAACCCGCGCACTAACATGACGGCTCACATTAACGTGCCGTACGTGGGTGTCAACAGGTACGACCAGTACGAGCTCCACAAACCGTGGACGCTTGTGGTGATGGTGGTGGCCCCGCTTACCGTCAAAACTGGTGGTTCTGAACAGATCAAGGTCTACATGAATGCAGCGCCGACCTACGTGCACGTGGCAGGAGAACTGCCCTCGAAAGAGGGGATAGTTCCTGTGGCGTGTGTGGACGGTTACGGCAACATGGTAACCACGGACCCGAAGACGGCTGACCCCGTCTACGGGAAAGTGTCTAACCCCCCCAGAACAAGCTTCCCTGGGCGTTTCACAAACTTCCTTGATGTAGCGGAGGCGTGTCCGACCTTCCTCCGCTTCGGAGAAGTACCATTTGTGAAGACGGTGAACTCTGGTGACCGCTTGCTTGCCAAGTTTGACGTGTCCCTCGCTGCGGGGCACATGTCCAACACCTACTTGGCAGGTTTGGCACAGTACTACACACAGTACAGCGGCACTATGAATATCCACTTCATGTTCACCGGACCCACGGATGCCAAAGCCCGCTACATGGTGGCTTACATACCTCCTGGTATGACACCGCCAGCGGACCCGGAGCGGGCTGCACACTGCATTCATTCTGAGTGGGACACTGGACTCAATTCTAAATTTACCTTTTCTATCCCTTACCTTTCTGCTGCAGACTATGCTTACACTGCTTCTGACGTGGCTGAGACCACGAGTGTGCAGGGATGGGTGTGTATTTACCAGATCACCCACGGTAAAGCTGAAGGTGACGCGCTGGTCGTGTCCGTCAGCGCTGGCAAGGACTTTGAGTTTCGACTACCGGTGGATGCCCGCCAACAGACTACCACCACTGGCGAGTCCGCGGACCCAGTCACCACCACGGTTGAGAACTACGGAGGAGAAACCCAGACGGCCCGACGGCTTCACACTGATGTCGCCTTCGTTCTCGACAGGTTCGTAAAACTCACCCAGCCCAAGAGCACCCAAACCCTTGATCTCATGCAGATCCCCTCACACACACTGGTCGGGGCGCTTCTCCGGTCTGCGACGTACTACTTCTCAGATCTGGAGGTTGCGCTCGTCCACACAGGACCGGTCACGTGGGTGCCCAATGGTGCGCCTAAGACCGCCTTGAACAACCACACCAACCCGACTGCCTACCAGAAGCAGCCTATCACCCGCTTGGCACTCCCCTACACCGCTCCCCACCGTGTGCTGTCAACAGTGTACAACGGGAAGACAACGTACGGAGAAGAATCCTCGCGGCGTAGCGATCTTGCCGCCCTCGCACGCAGAGTGAGCAACCGGCTGCCCACTTCCTTCAACTACGGCGCTGTGAAGGCCGACACCATCACGGAGCTGTTGATCCGCATGAAGCGTGCGGAAACATACTGCCCCAGGCCCTTGCTGGCTCTTGACACCACACAAGACCGCCGTAAACAGGAGATCATTGCACCTGAGAAACAGACTTTGAACTTTGACCTACTCAAGTTGGCAGGAGACGTGGAGCCCAACCCTGGGCCCTTCTTCTTCTCTGATGTCAGGTCGAACTTCACCAAGCTGGTGGACACCATTAACCAGATGCAAGAGGACATGTCAACAAAACACGGACCCGACTTTAACCGGTTGGTGTCCGCATTTGAGGAACTGGCCACTGGAGTGAAGGCTATCAGGACTGGTCTTGACGAGGCCAAACCCTGGTACAAACTCATCAAACTCCTGAGCCGCTTGTCATGCATGGCCGCTGTAGCAGCACGGTCAAAGGACCCAGTCCTTGTGGCCATCATGCTGGCTGACACCGGCCTTGAGATTCTGGACAGCACATTCGTCGTGAAGAAGATCTCCGACTCACTCTCCAGTCTCTTTCACGTGCCGGCCCCCGTCTTCAGTTTCGGAGCCCCGGTTCTGTTGGCCGGGTTGGTCAAAGTCGCCTCGAGTTTCTTCCGGTCCACGCCCGAAGACCTTGAGAGAGCAGAGAAACAGCTCAAAGCACGTGACATCAACGACATCTTCGCCATTCTCAAGAACGGCGAGTGGTTGGTCAAATTGATTCTTGCCATCCGCGACTGGATTAAGGCATGGATCGCCTCAGAAGAAAAGTTTGTCACCATGACAGACTTGGTGCCTGGCATCCTCGAAAAGCAACGGGACCTCAACGACCCGAGCAAGTACGAGGAAGCCAAGGAGTGGCTCGACAACGCGCGTCAAGCGTGTCTGAAGAGCGGGAACGTCCACATTGCCAACCTGTGCAAGGTGATCGCCCCGGCACCCAGCAAGTCGAGACCCGAACCCGTGGTCGTTTGCCTCCGAGGCAAATCCGGCCAGGGAAAGAGTTTCCTTGCGAACGTGCTCGCACAAGCAATCTCCACACACTACACTGGCAGAACTGATTCAGTTTGGTACTGCCCGCCTGACCCTGACCACTTCGACGGTTACAACCAACAGACCGTTGTTGTGATGGATGATTTGGGCCAGAACCCCGACGGCAAGGACTTTAAGTACTTCGCCCAGATGGTTTCAACCACGGGGTTCATCCCGCCCATGGCCTCGCTCGAAGACAAAGGCAAACCTTTCAACAGCAAGGTCATCATCGCCACCACCAACCTGTACTCGGGCTTCACCCCGAGGACCATGGTGTGCCCTGATGCACTGAACCGGAGGTTTCACTTTGACATCGAT
SEQ ID NO:8
ttttccttaagggacaagaacatgctgtgtttgcctgtgt
SEQ ID NO:9
actcacatcgatgtcaaagtgaaacctcc
SEQ ID NO:10
cacgcagagtgagcaaccggctgcc
SEQ ID NO:11
cgagggcggcaagatcgctacgccgcgagg

Claims (30)

1. A foot-and-mouth disease virus vaccine composition is characterized by comprising a first foot-and-mouth disease virus vaccine, a second foot-and-mouth disease virus vaccine and a third foot-and-mouth disease virus vaccine, wherein the first foot-and-mouth disease virus vaccine comprises a first foot-and-mouth disease recombinant nucleic acid or a first foot-and-mouth disease virus coded by the first foot-and-mouth disease recombinant nucleic acid, the sequence of the first foot-and-mouth disease recombinant nucleic acid comprises a nucleic acid sequence of a foot-and-mouth disease strain of an O/CHA/99 strain, but 177 continuous nucleotide sequences connected with a P1 gene in L genes of the foot-and-mouth disease strain of the O/CHA/99 strain, all P1 genes and 1206 continuous nucleotide sequences connected with a P1 gene in a P2 gene are replaced by a sequence shown as SEQ ID NO:1, the second foot-and-mouth disease virus vaccine is an A type foot-and mouth disease virus recombinant strain comprising a nucleic acid sequence shown as SEQ ID NO:7, and the third foot-and mouth disease virus vaccine is an Asia type 1 recombinant virus strain comprising a nucleic acid sequence shown as SEQ ID NO: 7.
2. The vaccine composition of claim 1, wherein said first foot and mouth disease virus vaccine is capable of eliciting immune activity against a foot and mouth disease virus strain type O.
3. The vaccine composition of claim 2, wherein said type O strain of foot and mouth disease virus is a strain of the Mya-98, PanAsia or Cathay lineage.
4. The vaccine composition of claim 3, wherein said type O foot-and-mouth disease virus strain is O/BY/CHA/2010, O/0834 or O/0718 and said first foot-and-mouth disease virus vaccine is against PD of O/BY/CHA/2010, O/0834 or O/071850All values are greater than 6.
5. The vaccine composition of claim 1, wherein said second foot and mouth disease virus vaccine is capable of eliciting immunological activity against a type a foot and mouth disease virus strain.
6. The vaccine composition of claim 5, wherein said type A foot and mouth disease virus strain is SEA-97G1 or SEA-97G2 strain.
7. The vaccine composition of claim 6, wherein said type A foot-and-mouth disease virus strain is A/WH/CHA/09 or A/GDMM/2013, and said second foot-and-mouth disease virus vaccine is directed against PD of A/WH/CHA/09 and A/GDMM/201350All values are greater than 6.
8. The vaccine composition of claim 1, wherein said third foot and mouth disease virus vaccine is capable of eliciting immunological activity against a foot and mouth disease virus strain type Asia 1.
9. The vaccine composition of claim 8, wherein said Asia1 type foot and mouth disease virus strain is the GV or GII strain.
10. The vaccine composition of claim 9, wherein said Asia1 type foot-and-mouth disease virus strain is Asia1/HN/06, and said third foot-and-mouth disease virus vaccine is against the PD of Asia1/HN/0650The value is greater than 6.
11. The vaccine composition of claim 1, wherein there is no immune suppression between said first, said second and said third foot and mouth disease virus vaccines.
12. The vaccine composition of claim 1, wherein said vaccine composition is capable of eliciting immunological activity against a foot-and-mouth disease virus type O strain.
13. The vaccine composition of claim 12, wherein said type O foot-and-mouth disease virus strain is an epidemic strain of Mya-98, PanAsia or Cathay lineages.
14. The vaccine composition of claim 13, wherein the type O foot-and-mouth disease virus strain is O/BY/CHA/2010, O/0834, or O/0718, and the vaccine composition is directed against PD of O/BY/CHA/2010, O/0834, or O/071850All values are greater than 6.
15. The vaccine composition of claim 1, wherein said vaccine composition is capable of eliciting immunological activity against a type a foot-and-mouth disease virus strain.
16. The vaccine composition of claim 15, wherein said type a foot and mouth disease virus strain is SEA-97G1 or SEA-97G2 strain.
17. The vaccine composition of claim 16, wherein said type a foot and mouth disease virus strain isA/WH/CHA/09 or A/GDMM/2013, and the vaccine composition is used for treating PD of A/WH/CHA/09 and A/GDMM/201350All values are greater than 6.
18. The vaccine composition of claim 1, wherein said vaccine composition is capable of eliciting immunological activity against a strain of Asia1 type foot-and-mouth disease virus.
19. The vaccine composition of claim 18, wherein said Asia1 type foot-and-mouth disease virus strain is the GV or GII strain.
20. The vaccine composition of claim 19, wherein said Asia1 type foot and mouth disease virus strain is Asia1/HN/06, and said vaccine composition has PD for Asia1/HN/0650The value is greater than 6.
21. A method of preparing the vaccine composition of any one of claims 1-20, comprising the steps of:
(a) culturing and collecting the first foot-and-mouth disease virus vaccine strain;
(b) culturing and collecting a second foot-and-mouth disease virus vaccine strain;
(c) culturing and collecting a third foot-and-mouth disease virus vaccine strain;
(d) and (c) inactivating the first foot-and-mouth disease virus vaccine strain collected in the step (a), the second foot-and-mouth disease virus vaccine strain collected in the step (b) and the third foot-and-mouth disease virus vaccine strain collected in the step (c) respectively and then mixing.
22. The method of claim 21, wherein said step (d) is followed by emulsifying a foot and mouth disease virus vaccine strain.
23. The method of claim 22, wherein the emulsification is performed with ISA206 adjuvant in a volume ratio of 1: 1.
24. The method of claim 21, wherein said first, second and third foot and mouth disease virus vaccine strains are suitable for suspension cell culture.
25. The method of claim 21, wherein said mixing is carried out by mixing said first, second and third foot-and-mouth disease virus vaccine strains in a ratio of 1:1:1 antigen content.
26. Use of a vaccine composition according to any one of claims 1 to 20 in the manufacture of a medicament for the prevention and/or control of foot and mouth disease in an animal.
27. The use of claim 26, wherein said foot and mouth disease is type O foot and mouth disease.
28. The use of claim 26, wherein said foot and mouth disease is type a foot and mouth disease.
29. The use according to claim 26, wherein said foot and mouth disease is Asia1 type foot and mouth disease.
30. The use of claim 26, wherein the animal is a pig, a cow or a sheep.
CN201710256542.9A 2017-04-19 2017-04-19 Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof Active CN107041951B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710256542.9A CN107041951B (en) 2017-04-19 2017-04-19 Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710256542.9A CN107041951B (en) 2017-04-19 2017-04-19 Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN107041951A CN107041951A (en) 2017-08-15
CN107041951B true CN107041951B (en) 2020-08-04

Family

ID=59544423

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710256542.9A Active CN107041951B (en) 2017-04-19 2017-04-19 Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN107041951B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109825625B (en) * 2019-03-11 2022-04-15 北京林业大学 Primer group for identifying haploid or homozygous diploid of populus tomentosa and application thereof
CN113061587B (en) * 2021-04-30 2023-03-31 中国农业科学院兰州兽医研究所 Antigen spectrum expanded O-type foot-and-mouth disease virus strain and construction method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102757942A (en) * 2012-07-30 2012-10-31 中国农业科学院兰州兽医研究所 Recombinant vaccine strain for foot-and-mouth disease type A as well as preparation method thereof and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102757942A (en) * 2012-07-30 2012-10-31 中国农业科学院兰州兽医研究所 Recombinant vaccine strain for foot-and-mouth disease type A as well as preparation method thereof and application thereof
CN103266091A (en) * 2012-07-30 2013-08-28 中国农业科学院兰州兽医研究所 A type foot-and-mouth disease recombinant vaccine strains and preparation method and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
In-vitro and in-vivo phenotype of type Asia 1 foot-and-mouth disease viruses utilizing two non-RGD receptor recognition sites;Li等;《BMC MICROBIOLOGY》;20111231;第11卷;第154页 *

Also Published As

Publication number Publication date
CN107041951A (en) 2017-08-15

Similar Documents

Publication Publication Date Title
CN107815441B (en) Type II pseudorabies virus attenuated strain and preparation method and application thereof
CN101514334B (en) Chicken infectivity bronchitis virus attenuated vaccine strain and application thereof
CN107184969A (en) A kind of A types Sai Nika paddy viral inactivation vaccines and its preparation method and application
CN111394367B (en) Selcarinovirus recombinant nucleic acid, recombinant vaccine strain, and preparation methods and applications thereof
CN111744000B (en) Foot-and-mouth disease recombinant virus with reduced immunosuppressive function and preparation method and application thereof
CN104988124A (en) Genotype VII Newcastle disease virus marker vaccine strain and application thereof
WO2020258757A1 (en) Mutant strain of type 3 duck hepatovirus ch-p60-117c strain and construction method therefor
CN109321535A (en) A kind of heat-staple newcastle disease virus attenuated vaccine Candidate Strain
CN112094824B (en) Recombinant Newcastle disease virus heat-resistant vaccine strain for expressing avian adenovirus 4 type truncated Fiber2 protein and preparation method and application thereof
CN109321534A (en) A kind of recombination VIII type newcastle disease virus low virulent strain
CN107041951B (en) Recombinant trivalent inactivated vaccine for foot-and-mouth disease and preparation method and application thereof
CN111729091B (en) Method for checking efficacy of porcine Seika virus inactivated vaccine by using rabbit
CN107213460B (en) Gene VII type newcastle disease vaccine
CN106916832B (en) O-type foot-and-mouth disease virus recombinant nucleic acid, recombinant vaccine strain, preparation method and application thereof
US10894081B2 (en) Recombinant bivalent inactivated vaccine against foot-and-mouth disease virus, preparation method and use thereof
CN111996201A (en) Samlika recombinant virus and recombinant vaccine strain of recombinant A-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof
CN109943576A (en) A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application
CN113462660B (en) Recombinant Newcastle disease vector vaccine for expressing avian infectious bronchitis virus S protein, preparation method and application
CN107058244B (en) Gene VII type newcastle disease virus low virulent strain constructed by P protein mutation
CN111996203B (en) Sai-lnica recombinant virus and recombinant vaccine of recombinant O-type foot-and-mouth disease virus epitope gene, and preparation method and application thereof
CN110904056A (en) Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof
CN112094821B (en) O-type foot-and-mouth disease virus strain and application thereof
CN113897376B (en) HN protein mutated gene VII type Newcastle disease virus recombinant vaccine strain
CN111996202B (en) Indocard recombinant virus and recombinant vaccine strain of recombinant O-type foot-and-mouth disease virus VP1 gene, and preparation method and application thereof
CN107418973B (en) Construction method of gene VII type Newcastle disease virus low virulent strain

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant