CN107012174A - Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained - Google Patents
Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained Download PDFInfo
- Publication number
- CN107012174A CN107012174A CN201710310315.XA CN201710310315A CN107012174A CN 107012174 A CN107012174 A CN 107012174A CN 201710310315 A CN201710310315 A CN 201710310315A CN 107012174 A CN107012174 A CN 107012174A
- Authority
- CN
- China
- Prior art keywords
- silkworm
- zinc finger
- finger protein
- cas9
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091033409 CRISPR Proteins 0.000 title claims abstract description 42
- 241000255789 Bombyx mori Species 0.000 title claims abstract description 38
- 101710185494 Zinc finger protein Proteins 0.000 title claims abstract description 22
- 238000005516 engineering process Methods 0.000 title claims abstract description 16
- 238000010354 CRISPR gene editing Methods 0.000 title claims abstract description 12
- 108090000623 proteins and genes Proteins 0.000 abstract description 16
- 108091023040 Transcription factor Proteins 0.000 abstract description 8
- 238000000034 method Methods 0.000 abstract description 8
- 238000010362 genome editing Methods 0.000 abstract description 7
- 102000040945 Transcription factor Human genes 0.000 abstract description 6
- 102100023597 Zinc finger protein 816 Human genes 0.000 abstract description 3
- 238000009395 breeding Methods 0.000 abstract description 3
- 230000001488 breeding effect Effects 0.000 abstract description 3
- 238000011160 research Methods 0.000 abstract description 3
- 108091027544 Subgenomic mRNA Proteins 0.000 description 32
- 108020004999 messenger RNA Proteins 0.000 description 12
- 238000006243 chemical reaction Methods 0.000 description 10
- 238000002347 injection Methods 0.000 description 10
- 239000007924 injection Substances 0.000 description 10
- 238000000520 microinjection Methods 0.000 description 9
- 238000013518 transcription Methods 0.000 description 9
- 230000035897 transcription Effects 0.000 description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 9
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 8
- 238000000338 in vitro Methods 0.000 description 8
- 102000002322 Egg Proteins Human genes 0.000 description 6
- 108010000912 Egg Proteins Proteins 0.000 description 6
- 101150038500 cas9 gene Proteins 0.000 description 6
- 238000005119 centrifugation Methods 0.000 description 6
- 238000001514 detection method Methods 0.000 description 6
- 210000004681 ovum Anatomy 0.000 description 6
- 108091028113 Trans-activating crRNA Proteins 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- 238000010367 cloning Methods 0.000 description 5
- 239000000203 mixture Substances 0.000 description 5
- 108020004414 DNA Proteins 0.000 description 4
- 239000000969 carrier Substances 0.000 description 4
- 238000013461 design Methods 0.000 description 4
- 235000013601 eggs Nutrition 0.000 description 4
- 238000002474 experimental method Methods 0.000 description 4
- 239000003292 glue Substances 0.000 description 4
- 238000011534 incubation Methods 0.000 description 4
- 239000013612 plasmid Substances 0.000 description 4
- 238000012163 sequencing technique Methods 0.000 description 4
- 239000000243 solution Substances 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- 238000001556 precipitation Methods 0.000 description 3
- 238000012216 screening Methods 0.000 description 3
- USFZMSVCRYTOJT-UHFFFAOYSA-N Ammonium acetate Chemical compound N.CC(O)=O USFZMSVCRYTOJT-UHFFFAOYSA-N 0.000 description 2
- 239000005695 Ammonium acetate Substances 0.000 description 2
- 108091033380 Coding strand Proteins 0.000 description 2
- 108010053770 Deoxyribonucleases Proteins 0.000 description 2
- 102000016911 Deoxyribonucleases Human genes 0.000 description 2
- 235000008708 Morus alba Nutrition 0.000 description 2
- 240000000249 Morus alba Species 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 241000382353 Pupa Species 0.000 description 2
- 208000027418 Wounds and injury Diseases 0.000 description 2
- 229940043376 ammonium acetate Drugs 0.000 description 2
- 235000019257 ammonium acetate Nutrition 0.000 description 2
- 230000000295 complement effect Effects 0.000 description 2
- 238000013467 fragmentation Methods 0.000 description 2
- 238000006062 fragmentation reaction Methods 0.000 description 2
- 230000014509 gene expression Effects 0.000 description 2
- 230000001418 larval effect Effects 0.000 description 2
- KWGKDLIKAYFUFQ-UHFFFAOYSA-M lithium chloride Chemical compound [Li+].[Cl-] KWGKDLIKAYFUFQ-UHFFFAOYSA-M 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 230000035939 shock Effects 0.000 description 2
- 239000013598 vector Substances 0.000 description 2
- 229920000742 Cotton Polymers 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 241000588724 Escherichia coli Species 0.000 description 1
- 241000238631 Hexapoda Species 0.000 description 1
- WHUUTDBJXJRKMK-VKHMYHEASA-N L-glutamic acid Chemical compound OC(=O)[C@@H](N)CCC(O)=O WHUUTDBJXJRKMK-VKHMYHEASA-N 0.000 description 1
- 241000255777 Lepidoptera Species 0.000 description 1
- 108090000364 Ligases Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- HCHKCACWOHOZIP-UHFFFAOYSA-N Zinc Chemical compound [Zn] HCHKCACWOHOZIP-UHFFFAOYSA-N 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 239000003242 anti bacterial agent Substances 0.000 description 1
- 229940088710 antibiotic agent Drugs 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000006285 cell suspension Substances 0.000 description 1
- 239000013599 cloning vector Substances 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 230000006378 damage Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000018109 developmental process Effects 0.000 description 1
- 239000012153 distilled water Substances 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 239000013613 expression plasmid Substances 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 238000003209 gene knockout Methods 0.000 description 1
- 229930195712 glutamate Natural products 0.000 description 1
- 230000012447 hatching Effects 0.000 description 1
- 238000007654 immersion Methods 0.000 description 1
- 208000014674 injury Diseases 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 230000013011 mating Effects 0.000 description 1
- 239000002777 nucleoside Substances 0.000 description 1
- 125000003835 nucleoside group Chemical group 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 230000000149 penetrating effect Effects 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 239000000376 reactant Substances 0.000 description 1
- 230000000384 rearing effect Effects 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000010079 rubber tapping Methods 0.000 description 1
- 238000007480 sanger sequencing Methods 0.000 description 1
- 238000004659 sterilization and disinfection Methods 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 230000002103 transcriptional effect Effects 0.000 description 1
- 230000009261 transgenic effect Effects 0.000 description 1
- 238000013519 translation Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 239000002699 waste material Substances 0.000 description 1
- 239000011701 zinc Substances 0.000 description 1
- 229910052725 zinc Inorganic materials 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43586—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from silkworms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Insects & Arthropods (AREA)
- Mycology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained, category silkworm breeding and gene engineering technology field.The present invention applies CRISPR/Cas9 gene editing technologies in silkworm zinc finger protein gene mutant is obtained, realize and the methodology that gene editing explores gene function is carried out to zinc finger protein, a set of effective method is provided for the research transcription factor of later mass.
Description
Technical field
The present invention relates to application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained, belong to silkworm
Breeding and gene engineering technology field.
Background technology
Silkworm (Bombyx mori), Wan holometabolism Lepidoptera insects, are one of currently the most important ones economic insects.Support
The invention of silkworm filature is the outstanding contribution that Chinese people make to world civilization.Transcription factor is very important base in silkworm
Cause, many characters of silkworm are regulated and controled by transcription factor family gene, study the function of various transcription factors to silkworm breeding and silk
Matter is improved and had very important significance as bioreactor expression foreign protein.
Modern biotechnology, includes the fast development of transgenic technology and sequencing technologies etc., is that traditional Silk Industry is brought newly
Opportunity to develop and wide prospect, particularly CRISPR/Cas9 systems, life science be started one it is complete
New technological revolution.
CRISPR/Cas9 systems are applied successfully in silkworm gene editing has been carried out to multiple genes, but do not had also
There is the research related to transcription factor gene to be reported.
The content of the invention
There is provided a kind of enforceable method it is an object of the invention to the research for transcription factor, there is provided CRISPR/Cas9
Application of the technology in silkworm zinc finger protein gene mutant is obtained.
Technical scheme is as follows：
The method that silkworm zinc finger protein gene mutant is obtained using CRISPR/Cas9 technologies, is obtained from ncbi database
Zinc finger protein gene (BGIBMGA014418-TA) complete sequence is obtained, CDS sequences are obtained, active structure domain is predicted, and in its vicinity
SgRNA sites are designed, the target site that then preliminary experiment detection is worked, by sgRNA the and cas9 mRNA worked by 1：1
Microinjection raises hatching newly-hatched silkworm with new fresh mulberry leaf and observes phenotype into silkworm egg after ratio mixing, when occur phenotype it
Afterwards to there is the silkworm of phenotype to carry out genotype detection, gene function is determined.
The sgRNA cores site sequence is cccAGATGCCTGACCCTAAGACT,
CctGACCCTAAGACTTACAAACA or cctAAGAACGATCTACCAGATGA；Three small letter bases of core site sequence are
PAM sites.
The sgRNA is obtained by the following method：
Step S1, obtains silkworm zinc finger protein gene base sequence, predicts active structure domain, and design in its vicinity
SgRNA sites；
Step S2, adds T7 promoter sequences, in sgRNA core bits in designed sgRNA cores site sequence front portion
Point sequence rear portion adds the sequence complementary with crRNA/tracrRNA, obtains the complete ends of sgRNA 5 ' DNA fragmentation；
The DNA fragmentation and 80bp crRNA/tracrRNA sequences obtained in step S3, artificial synthesized step S2, two pieces
The complete sgRNA DNA sequence dnas of section denaturation annealing extension generation；
The sgRNA deoxynucleotide sequences obtained in step S4, step S3 are transcribed into sgRNA nucleotide sequences in vitro.
The Cas9 mRNA are obtained by the following method：Cas9 carriers are linearized into enzyme digestion using NotI (NEB), obtained
The Cas9 carriers that must be linearized, then using in-vitro transcription kit mMESSAGET7 Kit are by Cas9
Carrier is transcribed into the Cas9 mRNA of translation activity.
Further, the Cas9 mRNA and sgRNA press 1：1 concentration is mixed, and Cas9 mRNA and sgRNA concentration are
1000ng/ul。
The mechanism of the present invention is as follows：Present invention application CRISPR/Cas9 gene editings technology has carried out zinc finger egg to silkworm
White gene knockout, it is first determined polyvoltine strain nistari silkworm zinc finger protein gene sequences, according to sequences Design coding strand and non-
Coding strand sgRNA target sites, then plus promoter and crRNA/tracrRNA conserved sequences, in-vitro transcription is into sgRNA nucleosides
Acid sequence；Cas9 carriers are linearized, cas9 mRNA are obtained, by sgRNA and cas9 mRNA co-injections into silkworm egg, cas9
MRNA carries out expressing obtaining cas9 albumen in silkworm, and sgRNA guides cas9 albumen to specified target spot, carries out fixed point to gene and cuts
Cut, gene editing is carried out to zinc finger protein gene by way of non-homogeneous restructuring, influence the normal of silkworm zinc finger protein gene
Expression.
Because zinc finger protein gene is smaller, it is difficult to carry out large fragment knockout, it is also difficult to detected, we are in active structure
3 sites are devised near domain, the zinc finger protein gene mutant for having knocked out active structure domain has successfully been screened.
Compared with prior art, the invention has the advantages that：
The present invention applies CRISPR/Cas9 gene editing technologies in the functional study of transcription factor, realizes to transcription
Factor gene carries out gene editing, and its active structure domain of successful knockout is to study its function.
Brief description of the drawings
Fig. 1 is sgRNA structures and sequence.T7 promoter：T7 promoters, 20N regions are sgRNA variable sequences, i.e.,
SgRNA core sequences before PAM sites.
Fig. 2 is that zinc finger protein gene mutant detects upstream and downstream primer sequence.
Fig. 3 zinc finger protein genes knock out clone's detection.
Fig. 4 zinc finger protein genes knock out the Mutants homozygous gene order filtered out.
Fig. 5 zinc finger protein genes knock out Heterozygous mutants phenotype and polymorphism are presented.
Embodiment
Technical scheme is described in further details with specific embodiment below in conjunction with the accompanying drawings.
Embodiment 1
Silkworm zinc finger protein gene is obtained from silkDB silkworm databases, and (gene numbering is BG IBMGA014418-
TA), Nistari glutamate synthetase genes sequences are obtained after design primer checking gene order.Using online software
CRISPRdirect designs 20bp sgRNA core sequences, filters out three target site composition sequences
CccAGATGCCTGACCCTAAGACT, cctGACCCTAAGACTTACAAACA or cctAAGAACGATCTACCAGATGA distinguish
Above adding gaaattaatacgactcactata T7 promoter sequences, and the fragment complementary with crRNA/tracrRNA
Gttttagagctagaaatagc, the artificial synthesized preceding primer for 62bp passes through PCR journeys with rear primer crRNA/tracrRNA
Sequence, obtains complete sgRNA sequences, sees Fig. 1.
The reagent of use is as shown in table 1.PCR reaction conditions are as shown in table 2.
The sgRNA synthetic systems of table 1
The sgRNA of table 2 synthesizes PCR reaction temperatures and program
PCR primer is purified using the Minelute PCR purification kits of qaigen companies, PCR purifying has been obtained
Whole sgRNA sequences.Comprise the following steps that：
1st, 100ul PCR primers, plus 500ul buffer PB, are mixed；
2nd, add in ready centrifugal column, place 1min, 12 000 × g centrifugations 1min；
3rd, waste liquid is outwelled, 750ul buffer PE, 12 000 × g centrifugations 1min is added；
4th, blank pipe centrifugation 1min；
5th, the 1.5EP pipes plus 10ul aqua sterilisas renewed, stands 1min, centrifuges 1min.The sgRNA sequences of acquisition are used as body
Outer transcription masterplate.
SgRNA in-vitro transcriptions
Concrete operation step is referring to MAXIT7 Transcription Kit (the limited public affairs of Beijing China ocean science and technology
Department) add corresponding reagent according to the reaction system of table 3.
The sgRNA in-vitro transcription reaction systems of table 3
Mix, 37 DEG C of incubation 4h,
1 μ L TURBO DNase are added, are mixed, 37 DEG C of incubation 15min,
Adding 29 μ L water makes reaction volume reach 50 μ L,
5 μ L 5M Ammonium Acetate (ammonium acetate) are added, are mixed,
3 times of volume 100%ethanol (ethanol) are added, are mixed,
- 20 DEG C of 2h, 4 DEG C of centrifugation 20min are placed,
Supernatant is outwelled, be washed once with 70% ethanol, 4 DEG C of centrifugation 20min outwell supernatant, precipitation is dried, add appropriate
Water dissolves, and the as sgRNA available for injection is put into -80 DEG C of refrigerators standby.
Cas9 plasmid linearizations
Cas9 plasmids are linearized using NotI (NEB) enzymes, Cas9 linearisation systems, as shown in table 4.
The Cas9 of table 4 linearizes system
Rubber tapping is reclaimed, using the glue reclaim kit (QIA of qaigen companiesGel Extraction Kit) enter
Row is reclaimed, and specific steps are used as in-vitro transcription masterplate referring to reagent specification, the linearization plasmid of acquisition.
Cas9 in-vitro transcriptions
Specific steps are referring to mMESSAGET7 Kit with Manual specifications are according to the reactant of table 5
System adds corresponding reagent.
The Cas9 mRNA in-vitro transcriptions of table 5
Mix, 37 DEG C of incubation 3h,
1 μ L TURBO DNase are added, are mixed, 37 DEG C of incubation 15min,
Adding 30 μ L water makes reaction volume reach 50 μ L, adds 30 μ L LiCl Precipitation Solution, mixes
Even, -20 DEG C of placements 2h, 4 DEG C of centrifugation 15min outwell supernatant, washed once with 70% ethanol, outwell supernatant, precipitation is dried,
Suitable quantity of water dissolving is added, the as Cas9 mRNA with transcriptional activity for injection are put into -80 DEG C of refrigerators standby.
Prepare before experiments Microinjection
All things to be used in an experiment are sterilized or sterilized in microinjection the previous day, such as to distilled water
Sterilized, injection pin used, aseptic cotton hatches box etc., to carrying out ultraviolet disinfection in microinjection room after injection.To be laid eggs paper
On apply glue, dry standby.
Inject the preparation of ovum
The moth of mating should be in advance put into after refrigerator overnight and be taken out again from refrigerator, and dark surrounds is manufactured during spawning,
And temperature can not be too low, 25-28 DEG C should be maintained at.When find female moth out of order or silkworm seed out of order when, silkworm seed is lost.
Microinjection preliminary experiment
Will be by 1：1 Cas9 mixed and sgRNA is expelled in the ovum being already prepared to, and is put into 37 DEG C of incubator cultures 2
By 3 days, 84 injection ovum (plate) are taken to extract genome, PCR detections, the site of screening operation efficiency high is used for later stage micro- note
Penetrate.
Microinjection
The ovum produced under dark surrounds on the spawning paper for scribbling glue in advance is put into aseptic double-distilled water, immersion five is arrived
Ten minutes, until can easily be swept down with conllinear pen, then washed with clear water 3 times, until ovum is by wash clean；Then by silkworm seed according to
Thicker one puts ovum neatly facing to the rule of the one side of injection, and drying is stained with the secondary fixation of glue, then dry up；With micro- note
The crosspointer injecting systems for penetrating instrument carry out microinjection by 1：1 Cas9 mRNA and the sgRNA mixtures mixed, Cas9
MRNA and sgRNA concentration is 1000ng/ul, and wound is small when injection, to reduce the injury to silkworm seed.During injection
Injected towards the middle part of the thicker one side of silkworm seed, to improve survival rate and knock out efficiency.
Raised and Phenotypic Observation after microinjection
The newly-hatched silkworm hatched after microinjection is raised at ambient temperature, the new fresh mulberry leaf of feeding.Observed during raising
Phenotype, it is found that the silkworm 80% after injection is all dead in larval phase, and individual cocoon layer of successfully pupating is also very thin, in continuously rearing and pure
Closing every generation in screening mutant has large quantities of silkworms dead in larval phase, and the offspring of Mutants homozygous can not pass on, and heterozygosis is dashed forward
Polymorphism (thin cocoon, exarate pupa) is presented in variant pupa time.
Detection has phenotype individuals genotype, determines gene function
Dead silkworm genes of individuals group is extracted, PCR amplification genes, cloning and sequencing determines genotype.It was found that dead individuals are big
Part is all Heterozygous mutants, can thereby determine that missing zinc finger protein can make silkworm die down, influences its normal growth.
Specific method is as follows：
DNA is extracted using Tiangeng blood/tissue extracts kit, using the primer conduct of previously determined gene fragment order
PCR primer, using PMD19-T carriers as skeleton carrier, detection primer is that M13 universal primers carry out cloning and sequencing, acquisition
Sequence application SeqMan softwares are analyzed.PCR programs are specific such as table 6 (mix is the product that health is reagent).PCR reaction conditions
As shown in table 7.PCR carries out Sanger sequencings, cloning vector application Takara pMD 19-T Vector Cloning after terminating
Kit clones system, and 16 DEG C connect overnight, are then transferred to Escherichia coli, and specific reaction is as shown in table 8, and specific method is as follows：
1st, 100 μ l competent cell suspensions are taken to put on ice from -80 DEG C of refrigerators；
2nd, add above-mentioned plasmid DNA solution (10 μ l are all added) to shake up, place 30 minutes on ice；
3rd, 42 DEG C of water-bath heat shocks 50 seconds, are immediately placed in cooled on ice 2 minutes after heat shock；
4th, 500ul LB fluid nutrient mediums (being free of Amp) are added into pipe, 37 DEG C of shaken cultivations 1 hour, make thin after mixing
Bacterium restore normal growth state, and the antibiotics resistance gene (Ampr) of expression plasmid coding；
5th, take 100 μ l to be coated in the screening flat board containing Amp after above-mentioned bacterium solution is shaken up, face up placement half an hour,
It is cultured completely after base absorbs after bacterium solution and is inverted culture dish, 37 DEG C is cultivated 8 hours；
6th, cloning and sequencing.
The PCR reaction systems of table 6
The PCR reaction temperatures of table 7 and program
The pMD of table 8TM19-T Vector Cloning Kit clone system
Claims (1)
- Application of the 1.CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710310315.XA CN107012174A (en) | 2017-05-04 | 2017-05-04 | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710310315.XA CN107012174A (en) | 2017-05-04 | 2017-05-04 | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107012174A true CN107012174A (en) | 2017-08-04 |
Family
ID=59450016
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710310315.XA Pending CN107012174A (en) | 2017-05-04 | 2017-05-04 | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012174A (en) |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107760715A (en) * | 2017-10-17 | 2018-03-06 | 云南瑞火生物科技有限公司 | A kind of precisely efficient transgene carrier and its construction method and application |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN109136262A (en) * | 2018-08-10 | 2019-01-04 | 江苏科技大学 | Domestic silkworm gene based on CRISPR/Cas9 two incision zymotechnic precisely knocks out system and its application |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11999947B2 (en) | 2023-02-24 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1543510A (en) * | 2001-08-17 | 2004-11-03 | ������������ʽ���� | Zinc finger domain libraries |
| CN102628037A (en) * | 2012-03-31 | 2012-08-08 | 西南大学 | Bombyx mori oily silkworm gene BmBlos 2 genetic modification system and preparation method and application thereof |
| CN106222203A (en) * | 2016-08-10 | 2016-12-14 | 云南纳博生物科技有限公司 | CRISPR/Cas technology is utilized to obtain bombyx mori silk fibroin heavy chain gene mutant and mutation method and application |
-
2017
- 2017-05-04 CN CN201710310315.XA patent/CN107012174A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1543510A (en) * | 2001-08-17 | 2004-11-03 | ������������ʽ���� | Zinc finger domain libraries |
| CN102628037A (en) * | 2012-03-31 | 2012-08-08 | 西南大学 | Bombyx mori oily silkworm gene BmBlos 2 genetic modification system and preparation method and application thereof |
| CN106222203A (en) * | 2016-08-10 | 2016-12-14 | 云南纳博生物科技有限公司 | CRISPR/Cas technology is utilized to obtain bombyx mori silk fibroin heavy chain gene mutant and mutation method and application |
Non-Patent Citations (5)
| Title |
|---|
| HYE KYUNG LEE等: "Functional assessment of CTCF sites at cytokine-sensing mammary enhancers using CRISPR/Cas9 gene editing in mice", 《NUCLEIC ACIDS RESEARCH》 * |
| 刘婷婷等: "靶向家蚕丝素重链基因的锌指蛋白结构域的人工构建", 《中山大学学报（自然科学版）》 * |
| 周洪英等: "CＲISPＲ/Cas9 系统及其在家蚕基因组编辑中的应用", 《蚕业科学》 * |
| 张冬杰等: "猪ZBED6 基因有效突变位点的筛选与验证", 《遗传育种》 * |
| 徐豫松等: "一个新的家蚕锌指蛋白基因的克隆及基因组结构分析", 《蚕业科学》 * |
Cited By (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN107760715B (en) * | 2017-10-17 | 2021-12-10 | 张业胜 | Transgenic vector and construction method and application thereof |
| CN107760715A (en) * | 2017-10-17 | 2018-03-06 | 云南瑞火生物科技有限公司 | A kind of precisely efficient transgene carrier and its construction method and application |
| CN109136262B (en) * | 2018-08-10 | 2022-07-01 | 江苏科技大学 | Accurate silkworm gene knockout system based on CRISPR/Cas9 double-nickase technology and application thereof |
| CN109136262A (en) * | 2018-08-10 | 2019-01-04 | 江苏科技大学 | Domestic silkworm gene based on CRISPR/Cas9 two incision zymotechnic precisely knocks out system and its application |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12006520B2 (en) | 2019-06-14 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11999947B2 (en) | 2023-02-24 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107012174A (en) | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained | |
| CN105132427B (en) | A kind of dual-gene method for obtaining gene editing sheep of specific knockdown mediated with RNA and its dedicated sgRNA | |
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| CN106222203A (en) | CRISPR/Cas technology is utilized to obtain bombyx mori silk fibroin heavy chain gene mutant and mutation method and application | |
| CN107287245A (en) | A kind of construction method of the Glrx1 Gene Knock-Out Animal Model models based on CRISPR/Cas9 technologies | |
| CN108949824A (en) | The method that method based on HMEJ mediates Ipr1 fixed point insertion to obtain transgenic cow fetal fibroblast | |
| CN107418974A (en) | It is a kind of to sort the quick method for obtaining CRISPR/Cas9 gene knockout stable cell lines using monoclonal cell | |
| CN104531705A (en) | Method for knocking off animal myostatin gene by using CRISPR-Cas9 system | |
| CN108285906A (en) | A kind of construction method of site-directed integration exogenous DNA transgene pig | |
| CN111778252B (en) | SgRNA for targeted knockout of SST gene, CRISPR/Cas9 system and application thereof | |
| CN106119284A (en) | A kind of product for building immunodeficient animals model and application thereof | |
| CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
| CN108642054A (en) | Reduce immunogenicity sgRNA, low immunogenicity dressing and preparation method thereof | |
| CN106282231A (en) | The construction method of mucopolysaccharidosis II type animal model and application | |
| CN105505879B (en) | A kind of method and culture medium for cultivating transgenic animal embryo cell or transgenic animals | |
| CN109234278A (en) | Construct the kit and method of ApoC2 gene knockout Hamster model | |
| CN107699571A (en) | A kind of porcine somatostatin gene editing site and its application | |
| CN108611338A (en) | Oedaleus asiaticus B lactase-Phlorizin hydrolase LPH and its encoding gene and application | |
| CN104313031B (en) | Freshwater shrimp molt-inhibiting hormone gene and its application in accelerating freshwater shrimp to cast off a skin and grow | |
| CN104232643B (en) | RNAi interference fragments, interference carrier, preparation method and applications | |
| CN110583581A (en) | Construction method of novel Bemisia tabaci nymph RNA interference method | |
| CN104726490B (en) | Express the targeting vector and its construction method of human serum albumins | |
| CN112899279B (en) | Method for constructing Fzd6 gene knockout mouse model and application | |
| CN108949769B (en) | Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof | |
| CN108374003A (en) | Migratory locusts Protein-tyrosine-phosphatase PTP1B and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170804 |