CN106947780A - A kind of edit methods of rabbit MSTN genes - Google Patents

Abstract

The present invention relates to gene engineering technology field, more particularly to a kind of rabbit MSTN gene editing methods.This method is in rabbit MSTN locus fixed-point implementation genetic modifications using CRISPR/Cas9；Including being designed according to rabbit MSTN gene target sequences site with homing sequence, the molecular biology material that two-in-one plasmid mstn sgRNA1 and the mstn sgRNA2 of 2 kinds of CRISPR/Cas9, in-vitro transcription go out sgRNA 1, sgRNA 2 and Cas9mRNA and form two kinds of two-in-one compounds being built using homing sequence, the molecular biology material prepare transgenosis rabbit is recycled, the step of the mutation of the extron 4,881 4903 of induction MSTN gene coded sequences the 3rd and 4,796 4818 nucleotide sequences and missing.MSTN gene mutations and gene knockout can be realized using the inventive method, the gene editing rabbit of MSTN expression deletions or reduction is obtained, the present invention can be used for lean meat species rabbit gene editing breeding.

Description

A kind of edit methods of rabbit MSTN genes

Technical field

The present invention relates to gene engineering technology field, more particularly to a kind of rabbit MSTN genes mediated with CRISPR/Cas9 Edit methods, MSTN gene mutations and gene knockout can be realized using the technology, obtain MSTN expression deletions or the gene of reduction Rabbit is edited, the present invention can be used for lean meat species rabbit gene editing breeding.

Background technology

Myostatin (myostatin, MSTN) is the negative regulatory factor of Skeletal Muscle Growth development, belongs to conversion life Long factor-beta (transforming growth factor β, TGF-β) superfamily member, also known as Growth differentiation factor 8 (growth Differentiation factor 8, GDF-8).MSTN belongs to TGF-β superfamily member, therefore with TGF-β superfamily allusion quotation The architectural feature of type, includes secreting signal peptide, protease hydrolytic site (the proteolytic processing of N- ends Site, RSRR) and mature peptide area cysteine structure (cystine knot).The mutation of MSTN genes can cause skeletal muscle Popularity hyperplasia with it is loose, produce " double flesh symptoms ".MSTN gene structures between the different mammalian species studied at present Contain 3 extrons and 2 intrones, and ripe peptide amino acid sequence is very conservative, amino acid of differences very little, 3 with It is interior.The first two extron encodes N-terminal propetide, the 3rd exons coding C-terminal polypeptide jointly.C-terminal polypeptide contains by 9 cysteines The cysteine knot of composition, the performance of the stabilization and function of the three-dimensional structure of the peering MSTN gene coded proteins of the cysteine rises To key effect, its structural damage will suppress myostatin signal transduction.Double-muscled phenotype ox in Piemonte ox is exactly Caused by cysteine (C313Y) mutation.

The MSTN gene coded sequences of the species such as mouse, rat, people, pig, chicken, ox, sheep, baboon and zebra fish occur Point mutation or frameshift mutation, then typically exhibit the character that muscle mass is dramatically increased.It is many in people, ox, sheep, dog etc. at present The mutation of abiogenous MSTN genes is found that in kind of species, it has been found that what spontaneous mutation occurred for MSTN genes has Belgium Blue ox (Belgian blue), Piemonte ox (Piedmontese) etc., show double-muscling shape, and its mutation occurs exon3。

It was found that MSTN genes contain 3 extrons and 2 intrones in mammal, complete MSTN cDNA include (mouse and rat are that 376 amino acid are residual to 375 amino acid residues of one ORF (Opening Read Fracture) and coding Base) nucleotide sequence.MSTN is a kind of secreted polypeptides, has similar characteristic feature to TGF-β superfamily：N-terminal conduct Secretion signal, has identical amino acid sequence with TGF beta superfamilies；C-terminal has by 4 amino acid (RSRR, Arg-Ser-Arg- Arg trypsinlike enzyme hydrolytic sites) are constituted；There are 6 cysteine residues formation " cysteine knot " structures in C-terminal, and pass through Disulfide formation biological activity dimer.Homology of the MSTN maturation peptide sequences in different plant species is very high, mouse, rat, The homology of people, pig, horse, dog, chicken and turkey is 100%, ox, sheep, the difference of baboon only 1~3 base compared with goat Not.

MSTN precursor proteins include signal peptide, N-terminal propetide and C-terminal mature peptide, and wherein mature peptide is 109 of C- ends Amino acid residue.Precursor protein need to be activated through secondary proteolysis, remove signal peptide, and cutting precursor protein is produced before N- ends Peptide and C- ends polypeptide, C- ends polypeptide are connected to form dimer by disulfide bond, constitute MSTN maturation proteins and secrete to blood circulation, And with N- ends propetide with non-covalent bond form formation LAP (lantency-associated peptide, 40kDa).Someone uses Myostatin detection of specific antibody has arrived the presence of ox sarcoblast extract myostatin precursor peptide (52kDa) And LAP, it was demonstrated that MSTN is synthesized in sarcoblast and is hydrolyzed processing really.

The theme that modification is always the research of bioscience man is oriented to genome, by being dashed forward to MSTN genes The genetic modifications such as change, missing, knockout, obtain gene mutant animals, on the one hand can construct the animal with " double flesh symptoms " Model is used for biological study and pathogenic mechanism is studied, and on the other hand can reach the purpose for improving muscle quality and weight, raw Improved seeds domestic animal of the production with commercialization property.

Genome editor (genome editing) technology is that genome is carried out by insertion, missing or the means replaced Fixed point transformation, mutation base can be also replaced so as to obtain and can study gene instead of normal gene with mutator with normal gene Because come the scientific research technology of the function that carries out gene therapy.The principle of this technology is to build an artificial incision enzyme, predetermined Genomic locations cut off DNA, and the DNA of cut-out can produce mutation in by intracellular DNA repair system repair processes, so as to reach To the purpose of fixed point modifying gene group.DNA repair systems mainly pass through two kinds of approach DNA plerosis double-strand break (double- Strand break, DSB), i.e. non-homologous end joining (Non-homologous end joining, NHEJ) and homologous recombination (homologous recombination, HR).Genome editing technique can realize three kinds by both reparation approach The purpose of genome manipulation, i.e. gene knockout, gene knock-in and fixed point transgenosis, thus genome editing technique have it is wide Scientific research and disease treatment prospect.

People always search for simple efficient method and carry out targeting modification to genome.Traditional gene targeting according to The intracellular abiogenous homologues of Lai Yu recombinate exchange at random, and target practice efficiency is extremely low, and generally only 10^-6-10^-8, not by Extensive use.The genome targeting modification technology that nuclease is instructed in recent years is quickly grown.This kind of nuclease is generally by a DNA Recognize that domain and a non-specific nucleic acid inscribe enzyme domains are constituted, the identification target site of domain specifically recognized by DNA, Nuclease, which is navigated to, needs the genome area into edlin, then cuts off DNA double chain by non-specific nucleic acid restriction endonuclease, draws DNA break self-regeneration mechanism is played, so as to trigger the mutation of gene order and promote the generation of homologous recombination.

CRISPR/Cas9 systems are that bacterium resists the invasion of foreign particles or bacteriophage to evolve the one kind come for a long time Immunologic mechanism, the CRIPSR locus of bacterial host transcribes to form precursor CRIPSRRNA (pre-crRNA), in Cas9 and nucleic acid Under the assistance of enzyme (RNase III), pre-crRNA is processed to the crRNA of maturation, and outer to the cutting of related Cas9 protein-specifics Carry out DNA sequence dna, Given this function, CRISPR/Cas9 systems have turned into gene editing technology of new generation.

CRISPR/Cas9 is third generation gene editing technology, has obvious advantage compared with ZFN and TALEN technologies, because of it Build simply, conveniently, gene editing efficiency high when using, and cost is relatively low, and gene volume has been rapidly become from 2013 The study hotspot for the technology of collecting.Target spot distribution frequencies of the CRISPR/Cas9 in genome is very high, and average every 8 bp just have one Target spot, TALEN target spot is probably 1/125bp in the distribution frequency of genome, and ZFN distribution frequency is probably 1/ Some genomic locus can not be carried out fixed point editor by 500bp with ZFN and TALENs sometimes, can be with CRISPR/Cas systems Realize the fixed point editor of the genome.

Cell is identical, in the case of the identical of carrier structure phase Sihe site, CRISPR/Cas9 is in people's iPS cells Rite-directed mutagenesis efficiency is more than 2 times of TALEN, and CRISPR/Cas9 produces the more efficient of diallele mutation. CRISPR/Cas systems have more flexibility, because TALEN and ZFN technologies need to redesign to different target spots, and CRISPR/Cas9 only needs to change 20bp or so sgRNA sequences.But also several sgRNA can be cascaded to same Multiple sites of one gene are edited simultaneously or multiple different genes are edited simultaneously.

In terms of animals and plants rearing new variety, CRISPR/Cas9 tools have great advantage.Carried by building CRISPR/Cas9 Body, in-vitro transcription obtain RNA after, then microinjection fertilised non-human eggs and obtain target practice animal.Do not deposited during whole practice shooting In the integration of exogenous DNA, bio-safety problem caused by traditional transgenic technology is also avoided.CRISPR/Cas9 is the mankind A brand-new thinking is provided in terms of the field of biomedical research such as gene therapy, new drug development.CRISPR/Cas9 technologies exist The application prospect in the fields such as fundamental research, clinical treatment and farming, animal husbandry and fishery will increasingly have wide, and will produce Far-reaching influence.

The content of the invention

Present invention aims at a kind of rabbit MSTN gene editings method of offer and its in rabbit MSTN genes exon3 the 372nd, 374 cysteines knock out target site.

Term rabbit MSTN genes refer to that myogenesis suppresses GFP (myostatin) in the present invention.

In order to solve the above problems, this invention takes following technical scheme：

A kind of rabbit MSTN gene editing methods, are to be repaiied using CRISPR/Cas9 in rabbit MSTN locus fixed-point implementation genes Decorations；Specifically：

(1) according to the new zealand rabbit MSTN gene target sequences as shown in SEQ ID NO.1, for 4881-4903,4796- 4818 nucleotide sequences design sgRNA-1 and sgRNA-2 homing sequence,

(2) 2 kinds of CRISPR/Cas9 are built with the two-in-one plasmid construction kits of YSYCRISPR/Cas9 using homing sequence They are respectively designated as mstn-sgRNA1 and mstn-sgRNA2 by two-in-one plasmid

(3) mstn-sgRNA1 and mstn-sgRNA2 plasmids respectively as PCR expand sgRNA-1, sgRNA-2 and Cas9mRNA transcription templates, sgRNA-1, sgRNA-2 and Cas9mRNA are gone out according to transcription templates in-vitro transcription；SgRNA-1 or SgRNA-2 constitutes activation new zealand rabbit MSTN genes 4881-4903,4796- with Cas9mRNA two-in-one compound respectively The molecular biology material that 4818 nucleotide sequence mutations and new zealand rabbit MSTN genes are knocked out,

(4) the molecular biology material prepare transgenosis rabbit, the extron of induction MSTN gene coded sequences the 3rd are utilized The mutation of 4881-4903 and 4796-4818 nucleotide sequence and missing.

In the present invention, the design of homing sequence is as follows：The homologous sequence intercepted and captured in genome target sequence SEQ ID NO.1 (4881-4900 nucleotides) as sgRNA-1 homing sequence, 4901-4903 nucleotides as sgRNA-1 PAM sequences Homologous sequence (the genome target sequence SEQ ID intercepted and captured in row, genome target sequence SEQ ID NO.1 reverse complementary sequence NO.1 4796-4815 positions nucleotides reverse complementary sequence) as sgRNA-2 homing sequence, 4816-4818 nucleotides are anti- To PAM sequence of the complementary series as sgRNA-2：

SgRNA-1 homing sequence：5’-CCATGGTAGTAGACCGCTGT-3’(SEQ ID NO.2)

SgRNA-1 PAM sequences (PAM-1)：5’-GGG-3’

SgRNA-2 homing sequence：5’-ATCTTTGTGGGAGTACAGCA-3’(SEQ ID NO.3)

SgRNA-2 PAM sequences (PAM-2)：5’-AGG-3’

SgRNA-1 and/or sgRNA-2 and Cas9mRNA preferably presses 1 in step (3) of the present invention：2-5 ratios are used cooperatively.

The gene site-directed knockout techniques of rabbit MSTN of the present invention, the fixed point knockout technique is editor's rabbit MSTN genome target sequences CRISPR/Cas9 gene Knockouts；

The rabbit MSTN genes target sequence nucleotide sequence, 4881-4903 and 4796-4818 as shown in SEQ ID NO.1 Nucleotides is Design guidance sequence site；

Described CRISPR/Cas9 gene editings instrument is applied to MSTN gene knockout application this patent characteristic materials： Obtain sgRNA-1, sgRNA-2 using mstn-sgRNA1 and mstn-sgRNA2 plasmids in-vitro transcription, by the sgRNA-1 of acquisition and SgRNA-2 and Cas9mRNA presses 1：2-5 ratios, which are used cooperatively, is used for embryonated egg microinjection, wherein mstn-sgRNA1, mstn- SgRNA2, PAM-1, PAM-2, sgRNA-1, sgRNA-2 and Cas9mRNA are this patent characteristic materials.

Applied the invention also discloses methods described in lean meat species transgene rabbit breeding.

The inventive method can effectively induce the 3rd extron of MSTN gene coded sequences 4881-4903 and 4796-4818 The mutation of nucleotide sequence and missing, and produce new zealand rabbit MSTN expression be obstructed and muscle growth strengthen.

Brief description of the drawings

Relative position of Fig. 1 target sites in MSTN genes.

Fig. 2 is the identification of sgRNA plasmids.

Fig. 3 is the sequencing result of sgRNA plasmids.

Fig. 4 is sgRNA and Cas9mRNA electrophoretograms.1:sgRNA1；2:sgRNA2；3:Cas9mRNA；M:λ- EcoT14digest DNA marker。

Fig. 5 is the kytoplasm microinjection of rabbit embryonated egg.

Fig. 6 is rabbit MSTN gene PCR product electrophoretograms

1：Sterilizing distilled water is used as blank control；2：Normal feminine gender rabbit genome is used as negative control；3~9：M1~M7； 10~18：M8~M16；M：DL2000DNA marker

Fig. 7 is M5 and normal rabbit MSTN gene PCR product Sequencing chromatograms

WT：Normal rabbit Sequencing chromatogram；M5：Diallele is mutated rabbit Sequencing chromatogram.

Fig. 8 is M12 and normal rabbit MSTN gene PCR product Sequencing chromatograms

WT：Normal rabbit Sequencing chromatogram；M12：The negative rabbit Sequencing chromatogram of MSTN mutation.

Fig. 9 is M10 and normal rabbit MSTN gene PCR product Sequencing chromatograms

WT：Normal rabbit Sequencing chromatogram；M10：Diallele mutant cell sample Sequencing chromatogram.

Figure 10 is the build comparison diagram of MSTN mutation rabbits and normal rabbit

WT：Normal rabbit；M3、M5、M6、M10：MSTN gene mutation rabbits.

Figure 11 is MSTN gene mutation rabbit muscle pictures

A、E：M9MSTN is mutated rabbit leg muscle；B：M9MSTN is mutated rabbit shoulder arm and back muscles；C：M9MSTN is mutated rabbit； D：Normal feminine gender rabbit.

Figure 12 is the 9-14 week old body weight curve maps of MSTN gene mutations rabbit and normal negative rabbit.

Figure 13 is MSTN mutation rabbit Genomic PCR products TA cloning and sequencings results (sgRNA-2).Wherein, target site is SgRNA-2, "-" represents base deletion, and "+" etc. represents that base increases, and lowercase letter base is replaced, the lowercase of italic The base increased is represented, " fs " represents that reading frame changes.

Figure 14 is MSTN mutation rabbit Genomic PCR products TA cloning and sequencings results (sgRNA-1).Wherein, target site is SgRNA-1, "-" represents base deletion, and "+" etc. represents that base increases, and lowercase letter base is replaced, and underlines italic The base that lowercase letter increases, " fs " represents that reading frame changes.

Embodiment

First, CRISPR/Cas9 plasmid constructions and in-vitro transcription

1. experiment material

1.1 key instruments and equipment

High speed tabletop centrifuge and low-temperature and high-speed centrifuge (German Eppendorf companies)；Gene-amplificative instrament (S1000 types, BIO-RAD companies of the U.S.)；DNA electrophoresis apparatuses and electrophoresis tank (DYY-6B types, Nanjing New Campus Biological Technology Institute)；Number is solidifying Glue imaging system (GIS-1000 types, Shanghai Tian Neng Science and Technology Ltd.s)；Constant-temperature shaking incubator (IS-RDV1, the smooth Xiang instrument in Nanjing Equipment Co., Ltd)；Water isolation type electro-heating standing-temperature cultivator (PYX-DHS-350-BII types, Shanghai leap medical apparatus and instruments factory)； Electric heating constant temperature tank (DK60 types, the upper grand experimental facilities Co., Ltd of Nereid)；(SIM-F124 types, SANYO GS is public for ice machine Department)；Electronic balance (FA1004, Shanghai balance equipment factory)；PH detectors (HA405-K2 types, plum Teller-support benefit group Shanghai Branch company)；Automatic dual pure water distiller (SZ-II types, Shanghai Jia Peng Science and Technology Ltd.s)；Superclean bench (SJ-CJ-1BQ Type, Suzhou purifying apparatus instrument factory)；- 80 DEG C of ultra low temperature freezers (SANYO GS company)；Nucleic acid-protein quantitative analysis instrument (One DropTM OD-1000+, gene population, Shanghai Yi Tao bio-instruments Co., Ltd)；One grade of ultrapure (EPED-20TF Type, Nanjing Yi Puyida developments in science and technology Co., Ltd).

1.2 molecular biology reagents and kit

The two-in-one plasmid construction kits of YSYCRISPR/Cas9 and Annealing Buffer are purchased from Nanjing Yao along Yu Sheng Thing Science and Technology Ltd., T4DNA Ligase are purchased from Promega companies, Phanta Super-Fidelity DNA Polymerase is purchased from purchased from Nanjing Vazyme Biotechnology Co., Ltd., Endo-free Plasmid Mini Kit I OMEGA (article No.s：D6948-01), tryptone (Tryptone) and yeast extract (Yeast Extract) are public purchased from Oxoid Department, 2 × Power Taq PCR MasterMix are purchased from BioTeKe (article No.s：PR1700)、ScriptMAX Thermo T7Transcription Kit (TSK-101) spin bio tech ltd's (article No. purchased from Japan：TSK-101 it is), anti-reverse Cap analog (ARCA) is purchased from NEB (article No.s：01.NEB.S1411S), poly (A) polymerase is purchased from NEB (article No.s： 01.NEB.M0276S), EasyPure PCR Purification Kit and E.coil Trans5 α competent cells are purchased from north Jing Quanshijin Bioisystech Co., Ltd (article No.：CD201-01), to be domestic analysis pure for other reagents, is revived respectively purchased from Shanghai Emerging biological Co., Ltd, Chemical Reagent Co., Ltd., Sinopharm Group etc. are given birth in virtuous chemical reagent Co., Ltd, Nanjing.

The preparation of 1.3 main agents

(1) LB fluid nutrient mediums

5g peptones, 2.5g dusty yeasts and 10g NaCl are weighed, 400mL distilled waters are dissolved in, 500mL is settled to, pH is adjusted extremely 7.5, it is stand-by that autoclaving is cooled to normal temperature.

(2) LB solid mediums

1g peptones, 0.5g dusty yeasts, 1g NaCl and 1g agar powders are weighed, 90mL distilled waters is dissolved in, is settled to 100mL, Autoclaving, treats that temperature is down to room temperature, adds stand-by after bed board after AMP is mixed.

(3) ampicillin (AMP)

With 4mL sterilizing distilled water dissolving 1g ampicillins, the liquid storage that concentration is 250mg/mL, packing, -20 DEG C of guarantors are made into Deposit.

(4) plasmid extraction solution

Solution I：Weigh 0.30285g Tris, 0.37224g Na₂EDTA and 0.9008g Glucose, plus the double steamings of 90mL Water dissolves, are settled to 100mL, adjust pH to 8.0, autoclaving, 4 DEG C of preservations.

Solution II：0.2M NaOH and 1%SDS solution is prepared respectively, using being 1:1 volume is mixed.

Solution III：3M NaAc, pH 5.5 is adjusted to glacial acetic acid.

(5) 50 × TAE store liquid

Weigh 242g Tris and 37.2g Na₂EDTA·2H₂O, measures 57.1mL HAc, plus distilled water is settled to 1L, room Temperature is preserved.1 is diluted to distilled water when using ×.

(6) 50 × EB store liquid

100mL distilled waters dissolve 1g ethidium bromide powder, be made into concentration be 10mg/mL liquid storage, 4 DEG C preservation, the used time with Distilled water is diluted to 1 ×.(7) RNaseA solution

RNaseA is dissolved in 10mmol/L Tris and 15mmol/LNaCl mixed liquors, and compound concentration is 10mg/mL, 100 DEG C Boil 15min, -20 DEG C of preservations.

(8) DEPC handles water：Pure water meter prepares ultra-pure water, then double steamings.It is water-soluble that 0.1%DEPC is prepared with the ultra-pure water of double steamings Liquid, fierce shaking, until bottom of bottle can't see oily particle, 37 DEG C of incubator overnights, second day, 121 DEG C of high pressure 40min, which take out, to be put in Normal temperature is cooled in super-clean bench.In the dactylethrae that no RNase 2mL is dispensed into the pipette tips without RNase, -20 DEG C freeze.

(9) 70% ethanol without RNase：Take 3mL DEPC water+7mL absolute ethyl alcohol.With the pipette tips without RNase In the dactylethrae for being dispensed into no RNase 2mL, -20 DEG C freeze.

2. experimental method

2.1mstn-sgRNA1 and mstn-sgRNA2 plasmid constructions and identification

Mstn-sgRNA1 and mstn-sgRNA2 matter is built using the two-in-one plasmid construction kits of YSYCRISPR/Cas9 Grain, using the plasmid as template, and the primer amplification sgRNA-1 and sgRNA-2 that Nanjing Yao Shunyu bio tech ltd is provided Transcription templates.(primer 1, primer 2, primer 3, primer 4 are shown in Table 2-1)

Table 2-1 primer information

2.1.1 the single-stranded annealing primers of sgRNA are designed

Corresponding sgRNA templates are designed for the sgRNA-1 and sgRNA-2 of rabbit MSTN genes homing sequence, form is gNNNNNNNNNNNNNNNNNNN[NGG]." g " is the first nucleotides of sgRNA templates；N is the specific nucleotide of target gene. NGG is PAM sequences, and it must be present on genomic DNA but is not present on sgRNA template DNA sequences.If 20 nucleotides SgRNA templates first place be not " g ", please add " g " in first place, now a length of 21 nucleotides of template.

According to the corresponding annealing primer of sgRNA stencil designs, by primer, Synesis Company synthesizes.

Form is：

Positive single-stranded annealing primer:TATAgNNNNNNNNNNNNNNNNNNN

Reverse single-stranded annealing primer:AAACNNNNNNNNNNNNNNNNNNNc

It is the reverse of gNNNNNNNNNNNNNNNNNNN to note reverse single-stranded annealing primer NNNNNNNNNNNNNNNNNNNc Complementary series；

If the sgRNA first places of 20 nucleotides are " g ", N number is 19, and forward and reverse single-stranded annealing primer is 24 Nucleotides is long；If it is not " g " that the sgRNA of 20 nucleotides is the first, above adding one " g ", then N number is 20, now Forward and reverse single-stranded annealing primer is that 25 nucleotides are long.

2.1.2 the single-stranded annealing primers of sgRNA are synthesized

SgRNA-1 single-stranded annealing primer (5 ' -3 ')：

Positive single-stranded annealing primer：TATAgCCATGGTAGTAGACCGCTGT(SEQ ID NO.8)

Reverse single-stranded annealing primer：AAACACAGCGGTCTACTACCATGGc(SEQ ID NO.9)

SgRNA-2 single-stranded annealing primer (5 ' -3 ')：

Positive single-stranded annealing primer：TATAgATCTTTGTGGGAGTACAGCA(SEQ ID NO.10)

Reverse single-stranded annealing primer：AAACTGCTGTACTCCCACAAAGATc(SEQ ID NO.11)

2.1.3 forward and reverse two primers are annealed

(1) single-stranded annealing primer is dissolved in ultra-pure water, to 100 μM

(2) 10 μ L reaction systems, reaction system such as table 1-1 are separately constituted by following formulas in 2 PCR pipes.

Table 1-1 primer annealing systems

(3) reaction system is mixed, it is then quick to centrifuge solution centrifugal to PCR bottoms.

(4) system after mixing is put into PCR instrument to be reacted, 95 DEG C be incubated 5min after, with 1.5 DEG C per minute gradually from 95 DEG C are down to 22 DEG C.

2.1.4 annealed product is connected with the two-in-one plasmids of YSYCRI SPR/Cas9 linearized

(1) by 10 μ L reaction systems of following formula compositions, reaction system such as table 1-2 in PCR pipe.Table 1-2DNA connectors System

(2) mix, then quickly centrifuge mixed liquor to PCR pipe bottom.

(3) 16 DEG C are stayed overnight or incubation at room temperature 30min.

(4) Trans5 α competence Escherichia coli are taken out from -80 DEG C of refrigerators, are immediately placed on ice.

(5) after after competent cell defrosting, the connection product that 50 μ L competent cells are gently added in 10 μ L (1) is i.e. Can, it is not necessary to which mixing, ice bath 30min are played in suction.

(6) 42 DEG C of water-bath heat shock 45s, after be immediately placed on and be incubated 2min on ice, centrifuge tube should not be rocked.

(7) 100 μ L LB culture mediums (antibiotic-free, room temperature) are added, (are covered tightly in 37 DEG C of constant-temperature table culture 40min~1h Lid).

(8) take all bacterium solutions to be spread evenly across on the LB agar plates containing 50 μ g/mL ampicillins, be inverted in incubated 37 DEG C of overnight incubations (14~18h) in case.

2.1.5 the bacterium colony PCR identifications of conversion flat board

(1) 3 1.5mL EP pipes are prepared, often pipe adds the LB liquid that 20 μ l contain 50 μ g/mL ammonia benzyls.

(2) pipette tips treated with autoclaving are directly placed into ready EP from picking monoclonal on LB agar plates and managed In.3 clones of picking on each plate.

(3) cover tightly after lid, vortex oscillation EP pipes.

(4) prepare 3 0.2mL PCR pipe, prepare 10 μ LPCR reaction systems respectively as follows in each pipe, It is loaded by following system, reaction system such as table 1-3.

Table 1-3 PCR systems

PCR reaction conditions：95 DEG C of pre-degeneration 2min；94 DEG C of denaturation 30sec, 56 DEG C of annealing 30sec, 72 DEG C of extension 30sec, Repeat 35 circulations；72 DEG C re-extend 10min, 20 DEG C of 5min；Terminate reaction.

113bp band should occur in (5) 2% agarose gel electrophoresis, positive colony.

2.1.6 bacterium solution is sequenced

The bacterium solution that warp let-off PCR checkings have positive band goes sequencing (sequencing primer select primer 3), confirm sgRNA-1 and SgRNA-2 homing sequence (removing PAM sites) and frame sequence is really in plasmid；Meanwhile, same bacterium is seeded in In LB pipes of the 10mL containing ampicillin, shake bacterium under the conditions of 37 DEG C and stay overnight, for follow-up a small amount of extraction plasmids and preservation strain With will confirm that homing sequence (remove PAM sites) and the plasmid of frame sequence containing sgRNA-1 and sgRNA-2 are named respectively For mstn-sgRNA1 and mstn-sgRNA2.

Frame sequence：gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagt Ggcaccgagtcggtgctttttt (SEQ ID NO.12) 2.1.7mstn-sgRNA1 and mstn-sgRNA2 DNAs it is small It is prepared by amount

Positive plasmid is extracted using OMEGA small extraction reagent kit, operating procedure is as follows：

(1) 1.5~5ml bacterium solutions are centrifuged 1min, operated at room temperature with 1000g/min.

(2) supernatant is removed, 250 μ L SolutionI (in advance plus good RNase A), and fully resuspended precipitation is added.

(3) 250 μ L Solution II are added into re-suspension liquid and are softly mixed makes bacterium fully crack.

(4) the Buffer N3 of 125 μ L ice precoolings are added into mixed liquor and are softly fully mixed until there is white flock Mixture.

(5) 4 DEG C or room temperature centrifuge 10min with 12000g/min.

(6) carefully supernatant is drawn into 1.5mL centrifuge tubes, tries not to be drawn onto precipitation.Add 0.1 times of volume ETR Solution.It is reverse to mix 7~8 times, it is placed in 10min on ice.

(7) solution in (6) is put in 42 DEG C of incubation 5min.3min is centrifuged with 12000g/min under the conditions of 25 DEG C.

(8) Aspirate supernatant adds the absolute ethyl alcohol of 0.5 times of volume into new 1.5mL centrifuge tubes, and gently overturns mixed Even 6~7 times.And it is stored at room temperature 1~2min.

(9) draw (8) in the μ L of mixed liquor 700 into DNA columns, at room temperature under with 10000g/min centrifuge 1min.

(10) discard efflux, 500 μ L Buffer HB added into column, at room temperature under centrifuged with 10000g/min 1min。

(11) efflux is discarded, 700 μ L DNA Wash Buffer, 10000g/min centrifugations are added into column 1min, discards efflux.

(12) step (11) is repeated.

(13) 2min is centrifuged from column (>=13000g/min) so that maximal rate is empty.

(14) column is put into 1.5mL centrifuge tubes, adds the Elution Buffer of 30~50 μ L endotoxin-free Or water, 1min is centrifuged with maximum velocity centrifugation column (>=13000g/min).

2.2mstn-sgRNA1 and mstn-sgRNA2 plasmid in-vitro transcriptions

2.2.1 sgRNA and cas9 transcription templates are prepared

(1) sgRNA1 transcription templates are prepared：By 50 μ L PCR reaction systems of following formula compositions, reactant in PCR pipe System such as table 1-4.

Table 1-4 PCR systems

PCR reaction conditions：95 DEG C of pre-degeneration 30sec；95 DEG C of denaturation 5sec, 52 DEG C of annealing 10sec, 72 DEG C of extension 5sec, Repeat 30 circulations；72 DEG C re-extend 5min；Terminate reaction.

(2) sgRNA2 transcription templates are prepared：Related PCR reagent is Vazyme Phanta Super-Fidelity DNA Polymerase, by 50 μ L PCR reaction systems of following formula compositions, reaction system such as table 1-5 in PCR pipe.

Table 1-5 PCR systems

PCR reaction conditions：95 DEG C of pre-degeneration 30sec；95 DEG C of denaturation 5sec, 52 DEG C of annealing 10sec, 72 DEG C of extension 5sec, Repeat 30 circulations；72 DEG C re-extend 5min；Terminate reaction.

(3) cas9 transcription templates are prepared：By 50 μ L PCR reaction systems of following formula compositions, reaction system in PCR pipe Such as table 1-6.

Table 1-6 PCR systems

PCR reaction conditions：95 DEG C of pre-degeneration 30sec；95 DEG C of denaturation 10sec, 56 DEG C of annealing 15sec, 72 DEG C of extensions 68sec, repeats 34 circulations；72 DEG C re-extend 5min；Terminate reaction.

2.2.2 sgRNA transcription templates and cas9 transcription templates are purified

SgRNA1, sgRNA2 and cas9 transcription templates are purified respectively with TRANSGEN PCR purification kits：

(1) 100 μ L PCR primers add the BB of 5 times of volumes, and mixing to add in centrifugal column (can stand 1min), 10000g/ Min, centrifuges 1min, discards efflux.

(2) 650 μ L WB, 10000g/min are added, 1min is centrifuged, discards efflux.(being repeated once)

(3) 10000g/min, centrifuges 1min, removes the WB of residual, and volatilization alcohol of uncapping.

(4) DEPC that 30~50 μ L of 60~70 DEG C of preheatings are added to centrifugal column handles water, is stored at room temperature 1min, 10000g/min, centrifuges 1min.(5) nucleic acid-protein quantitative analysis instrument surveys purified pcr product solubility and OD values, dispenses after purification PCR primer, 5 μ L/ pipes, -20 DEG C freeze.2.3 PCR primer using in 2.2.2 is template transcript mRNA

2.3.1 transcribe and purify sgRNA

(1) phase on ice in defrosting ScriptMAX Thermo T7Transcription Kit (TSK-101) kit Liquid is closed, and table 1-7 systems are loaded, and are added and fully mix sample after sample, 40 DEG C of incubation 4h.

After incubation terminates, 1 μ L TURBO DNase are added, 37 DEG C of incubation 15min after fully mixing.Table 1-7 in-vitro transcriptions System

(2) transcription product is purified：

30 μ L Nuclear-free water and 30 μ L LiCl solution are added in a, above-mentioned transcription product, are mixed, -20 DEG C Place at least 30min；

B, 4 DEG C, 16000g/min, centrifugation 15min；

C, except supernatant, the ethanol of 1mL 70% (no RNase water is prepared) cleaning precipitation, 16000g/min centrifuges 15min；

D, 70% ethanol of removing, super-clean bench place 5~10min, no RNase water dissolves precipitation；

E, nucleic acid-protein quantitative analysis instrument survey solubility, and no RNase water is diluted to 20ng/ μ L, are distributed into 5 μ L/ pipes, -80 DEG C Freeze standby.

2.3.2 transcribe and purify cas9mRNA

(1) phase on ice in defrosting ScriptMAX Thermo T7Transcription Kit (TSK-101) kit Liquid is closed, and by table 1-8 systems sample-adding, adds and fully mix sample after sample, 40 DEG C of incubation 4h

Table 1-8 in-vitro transcription systems

After incubation terminates, 1 μ L TURBO DNase are added, 37 DEG C of incubation 15min after fully mixing.

(2) cas9mRNA adds poly A.Related reagent in defrosting E.coil polymerase kits on ice, by table 1-9 systems are loaded, and are added and fully mix sample after sample, 37 DEG C of incubation 45min.

Table 1-9 adds polyA systems

(3) transcription product is purified：

40 μ L Nuclear-free water and 120 μ L are added in a, the transcription product that incubation terminates into 2.3.2 (2) LiCl solution, is mixed, -20 DEG C of placement at least 30min；

B, 4 DEG C, 13000g/min, centrifugation 15min；

C, except supernatant, the ethanol of 1mL 70% (no RNase water is prepared) cleaning precipitation, 13000g/min centrifuges 15min；

D, 70% ethanol of removing, super-clean bench place 5~10min, no RNase water dissolves precipitation；

E, nucleic acid-protein quantitative analysis instrument survey solubility, and no RNase water is diluted to 80ng/ μ L, are distributed into 5 μ L/ pipes, -80 DEG C Freeze standby.

3. design requirement and identification and analysis

3.1MSTN gene knockouts site design requirement

The relative position such as Fig. 1, sgRNA of target site on the extron of rabbit MSTN genes the 3rd homing sequence are generally 20bp, PAM sequence (NGG), this be design target sequence necessary to.Homing sequence to the sgRNA-1 and sgRNA-2 of design adds Plus cohesive end (TATAg), you can the forward and reverse single-stranded annealing primers of sgRNA-1 and sgRNA-2 are synthesized, form is：

Positive single-stranded annealing primer:TATAgNNNNNNNNNNNNNNNNNNN

Reverse single-stranded annealing primer:AAACNNNNNNNNNNNNNNNNNNNc

It is the reverse of gNNNNNNNNNNNNNNNNNNN to note reverse single-stranded annealing primer NNNNNNNNNNNNNNNNNNNc Complementary series；

SgRNA-1 single-stranded annealing primer (5 ' -3 ')：

Positive single-stranded annealing primer：TATAgCCATGGTAGTAGACCGCTGT

Reverse single-stranded annealing primer：AAACACAGCGGTCTACTACCATGGc

SgRNA-2 single-stranded annealing primer (5 ' -3 ')：

Positive single-stranded annealing primer：TATAgATCTTTGTGGGAGTACAGCA

Reverse single-stranded annealing primer：AAACTGCTGTACTCCCACAAAGATc

3.2mstn-sgRNA1 and mstn-sgRNA2 plasmid constructions and identification

Synthesize sgRNA-1, after sgRNA-2 forward and reverse single-stranded annealing primer, anneal respectively, annealed product with The two-in-one plasmid vector connections of YSYCRISPR/Cas9, are built into the two-in-one plasmids of CRISPR/Cas9, connection product conversion impression State, is coated with ammonia benzyl agar plate, picking monoclonal bacterium colony is thalline PCR after growth overnight, and 113bp sizes occurs in PCR primer electrophoresis Band is positive colony (such as Fig. 1-2).To further determine that the correctness of the two-in-one plasmids of CRISPR/Cas9, it will expand Go out the bacterium solution sequencing of positive band, carry out sequence alignment, identify the two-in-one plasmids of CRISPR/Cas9 correctly connected

Shown by Fig. 2,113bp positive band occur in 1,2,3 and 6 swimming lanes, and bacterium solution is sequenced respectively, then with rabbit The designed sgRNA-1 and sgRNA-2 of MSTN genes homing sequence are compared, as a result consistent, such as Fig. 3.Finally successfully obtain Can recognize the plasmid of rabbit MSTN gene sgRNA-1 and sgRNA-2 target sites, they are named respectively mstn-sgRNA1 and mstn-sgRNA2。

4.mstn-sgRNA1 and mstn-sgRNA2 plasmid in-vitro transcriptions

With mstn-sgRNA1, mstn-sgRNA2 plasmids are template PCR amplifications sgRNA-1, sgRNA-2 (primer 3 and primer 4) and Cas9mRNA (primer 1 and primer 2) transcription templates, its size is respectively 224bp, 224bp and 4343bp.Produced with PCR Thing is transcription templates, in the presence of t7 rna polymerase, in-vitro transcription sgRNA-1, sgRNA-2 and Cas9mRNA.Wherein Cas9mRNA needs to translate into Cas9 albumen in the cell, therefore need to promote cell plus ARCA caps and poly A structures in vitro It is interior to translate and prevent that mRNA from degrading.Show that sgRNA-1, sgRNA-2,3 swimming lane that 1,2 swimming lanes are in-vitro transcription are external by Fig. 4 Transcribe and add ARCA caps and the Cas9mRNA of poly A structures.

2nd, the preparation of MSTN gene mutations rabbit

1. material

1.1 experimental animals

Experimental animal used by this patent can be regular grade NZw or other kind rabbit, doe 6~August age, 3.5~5kg of body weight, the monthly age of breeding male rabbit 10~12.Rearing conditions：18~25 DEG C of room temperature, humidity 40%~50%, ventilation are good, Feeding in one day twice, adds 80g pellets, and provide the drinking water of abundance every time.

1.2 key instruments

Stereomicroscope (Xiamen company of Mike Audi；TMS, NIKON, Japan)；Fluorescence inverted microscope and micromanipulation Instrument (Leica companies, Germany；Eppendorf TransferMan NK2 companies；IX-71, Olympus, Japan)；Draw pin instrument (MODEL P-97,INSTRUMENT,USA)；CO₂Incubator (MCO-18M ThermoForma)；Gene-amplificative instrament (S1000 Type, BIO-RAD companies of the U.S.)；Superclean bench (SJ-CJ-1BQ types, Suzhou purifying apparatus instrument factory)；DNA electrophoresis apparatuses and electricity Swimming groove (DYY-6B types, Nanjing New Campus Biological Technology Institute)；Digital gel imaging instrument (GIS-1000 types, Shanghai Tian Neng sections Skill Co., Ltd)；Ice machine (SIM-F124 types, SANYO GS company)；Water isolation type electro-heating standing-temperature cultivator (PYX-DHS-350- BII types, Shanghai leap medical apparatus and instruments factory)；Electronic balance (FA1604, Shanghai precision balance)；PH detectors (HA405-K2 types, Plum Teller-Shanghai branch company of support benefit group)；Electric constant-temp drying box (MICRO-4HYBAID)；Table-type high-speed refrigerated centrifuge (Biofuge companies, Germany；Eppendorf companies, Germany)；(80-2 types, Shanghai Medical apparatus is limited for low speed desk centrifuge Operating theater instruments factory of company)；One grade of ultrapure (EPED-20TF types, Nanjing Yi Puyida developments in science and technology Co., Ltd)；Electricity Hot Water Tank with Temp.-controlled (DK600 types, the upper grand experimental facilities Co., Ltd of Nereid)；Pipettor (Eppendorf companies, Germany)；Commonly Refrigerator (Qingdao company of Haier)；- 80 DEG C of ultra low temperature freezers (SANYO GS company)；(IS-RDV1, Nanjing is smooth for constant-temperature shaking incubator Xiang instrument and equipment Co., Ltd)；Nucleic acid-protein quantitative analysis instrument (One DropTM OD-1000+, gene population, Shanghai Yi Tao bio-instruments Co., Ltd)；Ultrasonic cleaner (KQ-300DE types, Kunshan Ultrasonic Instruments Co., Ltd.).

1.3 main equipment

Toy routine Shelf for keeing, capillary glass tube (DCG-10, DC-10 type, Narishige, Japan), syringe, silicon Change plate and slide, self-control ovum shifting tube and suction pipe, Embryo Culture side's cup connects ovum cup etc., platform balance.

1.4 main agents and medicine

The cell tests such as NaH2CO3, KCl, KH2PO4, K2HPO4, Na2HPO4, EDTANa2, NaCl level reagent (is purchased from Sigma companies)；M16 (M7292-100ML, Sigma company)；M2 (M7167-100ML, Sigma company)；FSH (110044629, Ningbo Sansheng Pharmaceutical Co., Ltd.)；HCG (091217B, Livzon Pharmaceutical Factory, Livzon Group)； Penicillin-streptomycin (PS) and Fetal Bovine Serum (FBS) is purchased from HyClone companies；pGEM-T Easy Vector (A1360, Promega) T-4ligase (is purchased from Promaga companies)；Archaeal dna polymerase (DNA Polymerase), dNTP, DNA Marker (DL2000) are purchased from precious bioengineering (Dalian) Co., Ltd, other in experiment It is pure that reagent is domestic analysis, gives birth to emerging biological Co., Ltd purchased from Nanjing respectively, the Shanghai biological Co., Ltd of life work, and Nanjing promise is only Biological Co., Ltd is praised, etc..

1.5 main agents are prepared

(1) egg liquid

Weigh 10g NaCl, 0.25g KH₂PO₄, 0.25g KCl and 1.44g Na₂HPO₄, plus after the dissolving of 900 distilled waters calmly Hold to 1000mL, autoclaving, dispense 50mL/ bottles, -4 DEG C of preservations.

(2) Tissue lysates

Weigh 2.4228g Tris-Base, 7.444g EDTANa₂After 1g SDS, plus 150mL sterilizing distilled water dissolvings It is settled to 200mL, autoclaving, packing, -20 DEG C of preservations.

(3) LB fluid nutrient mediums

5g peptones, 2.5g dusty yeasts and 10g NaCl are weighed, 400mL distilled waters are dissolved in, 500mL is settled to, pH is adjusted extremely 7.5, it is stand-by that autoclaving is cooled to normal temperature.

(4) LB solid mediums

1g peptones, 0.5g dusty yeasts, 1g NaCl and 1g agar powders are weighed, 90mL distilled waters is dissolved in, is settled to 100mL, Autoclaving, treats that temperature is down to room temperature, adds stand-by after bed board after AMP is mixed.

(5) ampicillin (AMP)

With 4ml sterilizing distilled water dissolving 1g ampicillins, the liquid storage that concentration is 250mg/mL, packing, -20 DEG C of guarantors are made into Deposit.

(6) X-gal solution

Weigh 20mg X-gal powder and be added to the mixing of 1mL dimethyl formamide solutions, packing, lucifuge is preserved in -20 DEG C.

(7) IPTG solution

2g IPTG powder is weighed, distilled water, constant volume to 10mL is added.Packing, lucifuge is in -20 DEG C of preservations.

(8) plasmid extraction solution

Solution I：Weigh 0.30285g Tris, 0.37224g EDTANa₂With 0.9008g Glucose, plus the double steamings of 90mL Water dissolves, are settled to 100mL, adjust pH to 8.0, autoclaving, 4 DEG C of preservations.

Solution II：0.2M NaOH and 1%SDS solution is prepared respectively, using being 1:1 volume is mixed.

Solution III：3M NaAc, pH5.5 is adjusted to glacial acetic acid.

2. method

2.1 donor rabbits superfecundation are with supplying acceptor estrus synchronization

Female rabbit of every group of experiment picking two only non-heat is as super row's donor rabbits, female rabbit vulva whiting, slightly dry it is believed that Non- heat.Using continuous 6 dose of FSH diminishing methods to often injecting FSH only for the leg muscle of the female rabbit of body, FSH total amount is 60IU, morning and afternoon respectively injection once (8:00 and 20:00), successively decrease and be followed successively by 15IU, 15IU, 10IU, 10IU, 5IU, 5IU.Most Afterwards after shot FSH 12h, every donor rabbits auricular vein injects 100IU hCG, is bred therewith with normal buck.

The female rabbit 2~4 of acceptor is selected after the completion of donor rabbits breeding immediately and is only used as acceptor, good female rabbit moves as acceptor for heat Plant pregnancy rate high.To ensure to inject 100IUhCG with donor rabbits synchronization of estrus, every recipient rabbits auricular vein, be used as recipient rabbits. Nature enemy will be done for recipient rabbits.

2.2 reclaim donor rabbits embryonated egg

18~20h after donor rabbits injection hCG, conventional fimbriae tubae portion reclaims embryonated egg, picked under stereomicroscope by Smart ovum, counts and moves in M16 nutrient solutions, is placed in 38 DEG C, 5%CO2, cultivates in saturated humidity incubator.

2.3mRNA microinjection rabbit embryonated eggs

(1) injection needle (10~15 μm of diameter, 0.5 μm~1.5 μm of pin mouthful at 50 μm away from needle point) is prepared, and preparation is held Ovum fixes pin (120~150 μm of external diameter, 10~20 μm of internal diameter).

(2) cas9mRNA and sgRNA dispense is taken out from -80 DEG C of ultra low temperature freezers, is mixed in equal volume, cas9mRNA with SgRNA end solubility is respectively 40ng/ μ L and 10ng/ μ L.

(3) in the good injection needle of inverted microscope over-assemble and fixed pin, with the siphon pipe without RNAse draw cas9mRNA and In sgRNA mRNA mixtures injection injection needle, focal length is then debugged, makes injection needle clearly visible in the visual field.

(4) embryonated egg is moved in M2 operation drops, adjustment microscope is until that can be clearly observed embryonated egg in the visual field.

(5) injection needle and fixed pin are gently fallen, the focusing of alignment ovum surface is basic in same plane with embryonated egg.

(6) fixed pin gently fixes embryonated egg, and the focusing of injection tip alignment ovum center makes needle point high-visible, Then carefully it is pierced into the kytoplasm of embryonated egg.

(7) syringe applies pressure slightly, it was observed that injection needle point have liquid outflow, that is, complete once it is complete penetrate, repeat The process is finished up to the injection of all embryonated eggs, such as Fig. 5.

2.4 embryo transfers

Need to observe the survival rate of microinjection ovum before conventional embryo transfer, transplanting, reject dead ovum and ovum out of order.It is defeated Whether oviduct and ovary, observation ovary have ovulation point or folliculus i.e. portable.Embryo moves into fallopian tubal, in ampulla of uterine tube Inject embryonated egg.Generally, female rabbit pregnancy 30 days or so can spontaneous labor, conventional mother's rabbit postnatal care and young rabbit lactation.

3. technique effect judges and detection in Gene Mutation

3.1MSTN detection in Gene Mutation

3.1.1 the extraction of rabbit genome

(1) the sterile clip have sharp ears tissue of young rabbit of 2~3 weeks after being born, and clip normal rabbit ear tissue, are put into dactylethrae And shred, add 750 μ L

Tissue lysates and 7.5 μ L Proteinase Ks (25mg/mL), 55 DEG C of rotation digestion, until visually observing less than tissue block Untill.

(2) 12000rpm is centrifuged, 10min, is taken sticky supernatant in another clean dactylethrae, is added 750 μ L phenol, overturns mixed It is even, 12000rpm

Centrifugation, 10min.

(3) supernatant is taken in another clean dactylethrae.

(4) 750 μ L 1 are added:1 phenol:Chloroform mixture, overturns and mixes, 12000rpm centrifugations, 10min.

(5) supernatant is taken in another clean dactylethrae, 750 μ L chloroforms are added, and is overturned and is mixed, 12000rpm centrifugations, 10min。

(6) supernatant is taken in another clean dactylethrae, the absolute ethyl alcohol 1mL of precooling is added, overturns and mixes, and precipitates genome DNA (white flock).(7) picking white DNA agglomerates, add the ethanol of 1mL 70% and fully wash, 12000rpm centrifugations, 5min.

(8) supernatant is abandoned, deposit is through 37 DEG C of drying.

(9) 20~50 μ L sterilizing distilled water dissolvings are added according to the amount of genome, -20 DEG C save backup.

3.1.2 the detection of son rabbit MSTN gene PCRs and sequencing

The MSTN gene knockout situations of rabbit are reliably detected for convenience, and application software Primer5.0 is directed to rabbit MSTN bases Because primer is designed in mutational site, primer information is shown in Table 2-1.

Table 2-1 primer information

PCR reaction systems are prepared by table 2-2,

Table 2-2 PCR systems

PCR reaction conditions：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 50sec, 48 DEG C of annealing 45sec, 72 DEG C of extension 1min, Totally 33 circulations；72 DEG C re-extend 10min, 4 DEG C of preservations.

5 μ LPCR products are taken in 1.0% agarose gel electrophoresis, preliminary judgement son's rabbit MSTN gene mutation situations.

In order to which whether the MSTN genes for further verifying the young rabbit obtained undergo mutation, PCR primer is subjected to sequence survey It is fixed, and compared using DNAStar sequence analysis softwares with amplification template standard sequence, with Chromas softwares observation sequencing peak Figure set peak situation.

3.1.3 young rabbit MSTN gene PCR amplified productions TA is cloned

For the mutation type of identification of M STN positive gene mutation rabbits, PCR primer sequencing result is further shown as MSTN Gene mutation PCR primer is connected with pGEM-T cloning vectors.Purify examination with TRANSGEN PCR before connection pGEM-T cloning vectors Agent box purified pcr product.Purify the calculating that the PCR primer obtained is measured as follows with pGEM-T cloning vectors：

According to connection enzyme system explanation, reaction system is prepared, reaction system is shown in Table 2-3：

Table 2-3 DNA linked systems

Reaction condition：4 DEG C of connections are stayed overnight.

The benefit and production performance that 3.2 the art of this patent are produced, which are improved, to be judged

3.2.1 evaluation method

Weigh the body weight of experimental group rabbit (M1~M11) and normal negative rabbit (WT1~WT10) day by day from 9 week old.Carry out Record.

Calculate male rabbit (including the male rabbit of MSTN mutation and normal cloudy of 9~14 week old respectively with the statistical softwares of SPSS 20.0 Property male rabbit), doe (including MSTN mutation does and normal negative doe) and MSTN be mutated the body of rabbit (including male rabbit and doe) Weight Zhou Zengliang carries out systematic variance analysis and carries out DuncanShi methods progress Multiple range test, with P<0.05 is that the significance of difference judges Standard.

Initial experimental design purpose is to prepare the MSTN gene mutation rabbits with double-muscled phenotype.In order to make mutation as far as possible MSTN genes drop or loss of biological activity, and cause to produce inhibitory action to the functions of MSTN genes as far as possible, simultaneously In view of being removed before 266 amino acid functions at N- ends, it is to avoid 266 amino acid of the design in excision will be mutated It is interior and cause to occur situation of the mature peptide function without influence, therefore by the design of MSTN genes target site in mature peptide region.Examine Consider later stage young rabbit MSTN detection in Gene Mutation situations, with DNAStar software analysis rabbit MSTN gene mature peptides area restriction enzyme site, Because conventional restriction enzyme site is rare, and design CRISPR/Cas9 target sites need PAM sequences, therefore do not look for and be suitable for the later stage The target site of the conventional restriction enzyme site of abrupt climatic change so that the Preliminary detection in later stage can only use gene sequencing means.

3.2.2 this technology obtains the uniformity of effect and design

Normal rabbit MSTN genes are expanded with the pair of primers (CAS9SG123-1 and CAS9SG123-2) of design, obtained The purpose band size arrived is 498bp, and equally obtained to this experiment 16 son's rabbit MSTN genes are expanded, then 1% Gel electrophoresis, EB is dyed, and observation of being taken pictures under ultraviolet light, experimental result is shown in Fig. 6.If MSTN gene delections or to increase band larger, It can be distinguished with the contrast of normal band, can the young rabbit MSTN gene mutation situations of preliminary judgement.For lacking or increasing bar The situation of base replacement only occurs for band, is only reflected by sequencing after follow-up PCR primer sequencing or PCR primer TA clones It is fixed.Observe MSTN gene PCR electrophoresis graph discoveries, the 6th, 8, the electrophoretic band of 12 swimming lanes be significantly less than the normal control of the 2nd swimming lane Band, remaining swimming lane stripe size, which changes, visually to be recognized, can only subsequent gene sequencing judgement.Have 3 in the young rabbit obtained Individual young rabbit can preliminary judgement be the success of MSTN gene knockouts, rabbit gene mutation situation is obtained by further identification, by the 16 of acquisition The only PCR primer sequencing of young rabbit and normal control rabbit.

Result is shown after the completion of the MSTN Genomic PCR products sequencing of 16 young rabbits and normal rabbit：M1~M9, M11 and M13 There are a variety of bases in sgRNA-1 location proximates in~M16 PCR primer sequencing peak figure display set peak, M1~M7 Sequencing chromatogram There are a variety of base signals in sgRNA-2 location proximates in signal, M8~M9, M11 and M13~M16 Sequencing chromatogram, show M1~ There is mutation in the MSTN genes of M9, M11 and M13~M16 rabbits, be MSTN gene mutation rabbits.Such as Fig. 7,8,9.

There is set peak structure in M5 rabbit PCR Sequencing chromatograms, and the PCR Sequencing chromatograms contrast with normal rabbit finds that multiple bases are dashed forward Become, black arrow meaning represents base replacement in figure, black triangles meaning represents base deletion, contrasted from Fig. 9 that M5 is produced Two base replacements：T → A and G → A, a base deletion.The PCR primer sequencing peak figure of normal rabbit, M10 and M12 has no set Peak structure.By M10 and M12 PCR primer sequencing result and normal rabbit MSTN genome alignments, M12 sequencing sequence is found Consistent with normal rabbit sequence, i.e., M12 rabbits do not find MSTN gene mutations, are the negative rabbit of MSTN gene mutations.

M10 sequencing sequences find that it lacks 136bp, 6 base replacements with normal rabbit MSTN postgenomes, and peak figure is sequenced Only single base signal, shows that two chromosome mutation situations of M10 MSTN genes are consistent, i.e. M10 is homozygote, M10 and normal rabbit peak figure contrast situation are shown in Fig. 9, and the signified base of black arrow represents to replace base positions, M12 and normal rabbit PCR primer sequencing peak figure contrast is visible, and both results are consistent, have no set peak.

Two equipotential bases of fubaritic MSTN genes are sequenced in the young rabbit MSTN Genomic PCR products produced using this technology The catastrophe of cause.Therefore, young rabbit MSTN Genomic PCR products are inserted into TA carriers, identifies each by TA cloning and sequencings The mutation type of two allele of MSTN gene mutation rabbits.As a result show, the mutation type of 15 MSTN gene mutation rabbits There are gene delection, gene insertion, base to replace, mainly based on gene delection, missing base number is between 1~169bp, part The MSTN gene delections of young rabbit also exist simultaneously base replace or (and) base insertion, 10 MSTN mutation rabbits are obtained altogether, are referred to Figure 13 and Figure 14.

M1~M6 MSTN Genomic PCR products TA cloning and sequencing results show two dyes of this 6 young rabbit MSTN genes Colour solid is undergone mutation, and base mutation situation refers to table 2-4, shows mstn-sgRNA1 plasmids designed by rabbit MSTN genes SgRNA-1 target sites are active, and knock out ultrahigh in efficiency, have reached 100%.Table 2-4 is except M6 Article 2 chromosome On outer remaining sequence reading frame frameshit caused by target position point mutation of MSTN sequences.Mono- MSTN gene delection 10bp of M1, separately One missing 2bp, replaces 3 bp, causes the 372nd, 374 cysteine of two articles of allele codings of MSTN of M1 rabbits to lack Lose, the 375th amino acids of the MSTN gene codes of item chromosome turn into cysteine.A MSTN gene delections for M2 rabbits 52bp so that the 372nd, the 374 cysteine missing of MSTN gene codes, the 361st amino acids turn into cysteine, another Bar lacks 2bp, replaces 1 bp, also causes the 372nd, the 374 cysteine missing of MSTN gene codes, after frameshift mutation, the 378 amino acids are into cysteine.A MSTN gene delections 26bp for M3 rabbits, another increases 7bp, replaces 1 bp, makes 372nd, 374 cysteine of two articles of allele codings of MSTN of M3 rabbits is lacked.A MSTN gene for M5 rabbits replaces 5 Individual bp, inserts 31 bp, 1 bp of another missing, replaces 1 bp, after translation, the 372nd, 374 of two articles of MSTN gene codes the Position cysteine is lacked, and the 378th amino acids of the latter's coding turn into cysteine.A MSTN gene delections 10 for M6 rabbits Individual bp, 9 bp of another missing, the 372nd, 374 cysteine of two articles of MSTN gene codes is lacked, and the latter does not move Code mutation, has only lacked 3 amino acid, comprising 2 cysteines, the former occurs frameshift mutation, except 2 half Guang ammonia of missing Acid, the 375th turns into cysteine.Two MSTN genes of M4 lack more, a missing 159bp, replace 1bp, another Lack 169bp so that the 339th, 340, the 372 of two articles of MSTN gene codes, 374 cysteines are lacked, coded by the latter The 322nd amino acids turn into cysteine.Mstn-sgRNA1 plasmids are in sgRNA-1 target sites designed by rabbit MSTN genes For the 372nd cysteine, M1~M6 MSTN Genomic PCR products TA cloning and sequencings result is understood, M1~M6 rabbits 372nd, 374 cysteine of two articles of allele codings of MSTN is lacked, and reaches sgRNA-1 target site purposes of design, again Due to one of M1, M2, M4, M5, M6 rabbit or two gene frameshift mutations, form new cysteine, but with wild type MSTN The amino acid sequence of gene code is compared, and the new cysteine of formation is different from being pre-designed the cysteine site of knockout 's.

M8~M11 MSTN Genomic PCR products TA cloning and sequencing results show two dyes of this 4 young rabbit MSTN genes Colour solid is undergone mutation, and base mutation situation refers to table 2-6, table 2-6 in addition to M9-1 and M11-1 remaining sequence because of target site Mutation causes reading frame frameshit.M10 rabbits are MSTN gene mutation homozygote rabbits, and two allele of its MSTN genes lack 136bp is lost, 6bp is replaced, causes MSTN gene codes to stop translation to the 290th amino acids, causes remaining 85 bit amino Acid is lost, including the 309th, 313,339,340,372,374 cysteines.A MSTN gene for M8 rabbits increases 2bp, Another scarce 2bp, replaces 2bp, cause respectively two articles of gene codes the 340th, 372,374 cysteine missings, the 346th, 351 turn into cysteine and the 340th cysteine missing.12 bp of a MSTN gene delections of M9 rabbits, another is inserted Enter 1bp, 1 base is replaced, the former causes the 339th of MSTN gene codes the, 340 cysteine missings, the latter causes the 340th, 372,374 cysteine missings.The bp of MSTN gene delections 3 of M11 mono-, another increases 1bp, and the former causes MSTN The 339th cysteine missing of gene code, the latter causes the 340th cysteine missing.By the ammonia of above sequencing result From the point of view of base acid translation result, the 309th, 340,372,374 cysteine of two articles of allele codings of M8~M11 rabbits MSTN is equal There is different degrees of missing, it is active in sgRNA-2 target sites designed by rabbit MSTN genes to show mstn-sgRNA2 plasmids , and activity is higher, has reached 88.9%.

Data above shows：The art of this patent be used to preparing MSTN gene editings rabbit and design requirement be it is completely the same, Have the technical effect that feasible, reliable and accurately.

3.2.3 the production performance analysis of this technology

Rabbit is in growth animated period at 2~3 monthly ages, chooses MSTN gene mutations rabbit and the normal negative week old of rabbit 9~14 Growth phase be used for the production performance difference for comparing MSTN gene mutations rabbit and normal negative rabbit.

The build contrast of MSTN gene mutations rabbit and normal rabbit

Collecting part MSTN is mutated the build contrast photo of rabbit and normal rabbit, such as Figure 10, M3, M5, M6 and M10 shoulder and Buttocks seems broad and solid compared with normal rabbit；Plentiful muscle just can be seen to peel off M9 rabbits in Figure 11.

M9 rabbits, because anaesthetizing improper death, carry out peeling off fur observation, it is seen that its whole body many places muscle groups in 18 week old to it Knit plentiful, show double-muscled phenotype, rear quarters the muscle plentiful visible M9 of A, C, E and vigorous and graceful arm and shoulder back from Fig. 2-9 Muscle.And D represents the normal negative rabbit that week old is close, its musculature richness substantially, double fleshy exteriors is not showed with M9 differences Type.

The body weight increase situation of MSTN gene mutations rabbit and normal rabbit in 9~14 week old

In the case where keeping MSTN gene mutations rabbit and normal feminine gender rabbit feeding and management level consistent, from 9 week old by Weigh the body weight of MSTN gene mutations rabbit and normal negative rabbit day, 14 week old are claimed always.Make a record.MSTN genes are calculated to dash forward Become the average weight weekly of rabbit and normal negative rabbit.And it is organized into form, such as table 2-6 and 2-7.

Week old body weight table (the unit of table 2-6 MSTN gene mutations rabbit 9~14：G/ is only)

The normal negative week old body weight table (units of rabbit 9~14 of table 2-7：G/ is only)

MSTN gene mutations rabbit is entered with normal negative rabbit in the body weight Zhou Zengliang of 9~14 week old with the softwares of SPSS 21.0 Row systematic variance is analyzed.In the experiment, processing (MSTN gene mutations and normal negative rabbit), sex, week are resolved into total variation Age (9,10,11,12,13,14 week old), processing and interaction, the interaction of sex and week old, processing and the sex of week old Between interaction and processing, week old and sex interaction.

Table 2-8 MSTN gene mutations rabbits and the normal negative week old changes of weight variance table of rabbit 9~14

F tables are looked into, work as df1=1, during df2=70, F0.05 (1,60)=4.00, F0.05 (1,80)=3.96；Work as df1= When 1, df2=70, F0.01 (1,60)=7.08, F0.01 (1,80)=6.96；Work as df1=4, during df2=70, F0.05 (4, 60)=2.53, F0.05 (4,80)=2.49；Work as df1=4, during df2=70, F0.01 (4,60)=3.65, F0.01 (4,80) =3.56.

The F ＞ F0.01 of processing (MSTN gene mutations and normal negative rabbit) are understood by table 2-8, show MSTN gene mutations There is pole significant difference in terms of body weight increase with normal negative rabbit；Because 9~14 week old just grow animated period for rabbit, week old F is naturally larger than F0.01, sex, week old (9,10,11,12,13,14 week old), processing and the interaction of week old, sex and week The F ＜ F0.05 of the interaction of interaction and processing, week old and sex between interaction, processing and the sex in age, table Bright, sex, the interaction between week old and processing is not notable, shows that MSTN gene mutations rabbit increases with normal negative rabbit in body weight The pole significant difference of long side is caused by the factor of MSTN gene mutations.

Multiple range test is carried out and to MSTN bases to MSTN gene mutations rabbit and normal negative rabbit with Duncan methods simultaneously Because the Different Individual for being mutated rabbit carries out Multiple range test, as a result represented with body weight Zhou Zengliang average values and standard deviation.

The table 2-9 hero week old weight average Zhou Zengchang table (units of rabbit 9~14：G/ is only)

Note：Different lowercase letter indication differences significantly (P<0.05), there is identical lowercase letter indication difference not notable.

Understand that the male rabbit (M2, M6 and M8) of MSTN gene mutations exists with normal negative male rabbit (WT1~WT5) by table 2-9,2-10 There is significant difference in the weight average Zhou Zengliang of 9~14 week old, same MSTN gene mutations doe (M1, M3, M4 and M5) with just Often there is significant difference in feminine gender doe (WT6~WT10) in the weight average Zhou Zengliang of 9~14 week old, and M10 and normal feminine gender are female Rabbit (WT6, WT8~WT10) although not notable in the weight average Zhou Zengliang differences of 9~14 week old, weight average Zhou Zengliang's Average value is above normal negative doe group.Pass through many of the weight average Zhou Zengliang of 9~14 week old of MSTN gene mutation rabbits Weight is it was found that (being shown in Table 2-11), whether male or female MSTN gene mutation rabbits, the weight average of their 9~14 week old Zhou Zengliang differences are not notable.

Body weight growth tendency for global analysis MSTN gene mutations rabbit and the Liang Ge colonies of normal negative rabbit and both Growth variation, while consider influence of the sex to MSTN gene mutations rabbit and normal negative rabbit individual, therefore analysis homology Other MSTN gene mutations rabbit and the body weight growing state of normal negative rabbit, male and female MSTN bases are sorted out by table 2-7 and 2-8 respectively Because of mutation rabbit and the negative week old average weight situation of rabbit 9~14 of male and female, disposal data is shown in Table 2-13, and according to table 2-13 data The rate of body weight gain weekly for calculating MSTN gene mutations rabbit and normal negative rabbit is shown in Table 2-14.

The week old weight average Zhou Zengchang table (units of table 2-10 does 9~14：G/ is only)

Note：Different lowercase letter indication differences significantly (P<0.05), there is identical lowercase letter indication difference not notable.

The week old weight average Zhou Zengchang table (units of table 2-11 MSTN gene mutations rabbit 9~14：G/ is only)

Table2-12 The MSTN gene mutation rabbit s'average weekly growth of body weight from 9to 14weeks old(unit:g/each)

Note；Different lowercase letter indication differences significantly (P<0.05) identical lowercase or not marking-up matrix, show difference It is not notable.

Table 2-12 MSTN gene mutations rabbits and normal 9~14 negative week old average weight situation (units：G/ is only)

9~14 week old weight gain rates of the identical sex MSTN gene mutations rabbits of table 2-13 than normal negative rabbit

Note：- represent male MSTN gene mutations rabbit negative rabbit weight gain rate more normal than male

♀+/ ♀-expression female MSTN gene mutations rabbit negative rabbit weight gain rate more normal than female

It can be seen that and compare in same week old section male MSTN gene mutation rabbit average weight numerical value from table 2-12 and Figure 12 Male normal negative rabbit is big, and same female MSTN gene mutation rabbits average weight negative rabbit more normal than female is big, shows same One growth period MSTN gene mutation rabbit body weight value is bigger than normal negative rabbit.It is can be seen that from table 2-13 in 9~14 week old male The negative rabbit weightening 13.05~26.74% more normal than male of the average weight of MSTN gene mutation rabbits, female MSTN gene mutations rabbit Average weight negative rabbit weightening 1.63~17.91% more normal than female, to during 14 week old male and female MSTN gene mutation rabbits it is flat The equal normal negative rabbit weightening 17.91% and 26.74% of weight ratio male and female.It is can be seen that by Fig. 2-9 and table 2-14 in 9~14 weeks age grades Section MSTN gene mutations rabbit extends and is continuously increased over time with normal negative rabbit body weight, and the MSTN genes of identical sex It is mutated rabbit and normally increase trend of all rates of body weight gain of body weight of negative rabbit between 9~14 week old is obvious all the more.

Data above shows：The art of this patent can realize the gene mutation of rabbit MSTN specific sites, the mutation position of design The achievable muscle of point increases the purpose for accelerating to significantly improve with individual muscle overall content, in terms of husbandry sector and breed improvement There is higher application value.

SEQUENCE LISTING

<110>Yangzhou University

<120>A kind of edit methods of rabbit MSTN genes

<130>

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 6980

<212> DNA

<213>New zealand rabbit

<400> 1

atgcaaaaac tgcaaatcta tgtttatatt tacctgttta tgctgatcgt ggctggccca 60

gtggatctaa atgaaaacag tgagcaaaaa gaaaatgtgg aaaaagacgg gctgtgtaat 120

gcatgcactt ggagacaaaa cagtaaatat tcaagaatag aagccataaa gattcaaatc 180

ctcagtaaac ttcgcctgga aacagctcct aacatcagca aagatgctat aagacaactt 240

ttacccaaag ctcctccact ccgggaactg attgatcagt acgacgttca gagggatgac 300

agcagtgatg gctctttgga agatgacgat tatcacgcta cgacggaaac aatcattact 360

atgcctaccg agtgtaagta gtcctattag tgtatgtcaa cagttctgct gactgttgtt 420

ctagtgttta tgggaaacag atctattttc aggctctttt aataagctgt cagcttttat 480

gtaagaagca ggaaagacag tctcttcttt tcaagatttt gtgagaaata tgttgaaact 540

gaaatctgtc acactgtctg tttccttaaa aagctaaaaa gctaaaagat aaaaagcttg 600

cacagcgtta atattatcta gtttaattgg caaatacagc atgcttatgc cttcacagcc 660

tcataccaac cagcaaggcg aggactggca gatactacag caatgttaaa aactcacagg 720

gaattttata agtgcacttg taaaccaaaa tatgcattta ttacaataag cttttcacta 780

gtaataaaga aaggaaggaa cttgctagaa ttttaagctt ctttgagcac tgctgaacac 840

ctccagtgat ttctgttatt ccaaactcct tcacagtgtt ttgtgtgctt cacagattaa 900

aatgtttcct ttcggaggct attacactga ggagcaagaa aatattttaa atactttatg 960

tattagtaag agcaatgacg aaataaaccg tgacttcaaa ttcagaaaat gtctaggaaa 1020

taaacacttc agttgggcaa gttacggctc ctgaagtcct ctcgtacctt gaccatggtg 1080

ctattgttgg cagtactgag tgtgtgtatt tccaagcagg cgtactgctt aataaccttc 1140

gcgaatattt cattcttcat aatggaacga ctattacctg tagtatcaac gttgctcctg 1200

gaagaaaatg tatttcctac aattcctctt tcggtaggct cgaaagaata ctttcacccg 1260

gaaagggaaa cagacacctt gacagagaag gcacggcaag aatgattttg aggccatgtg 1320

tctgtgatct tgctttaaca cagttctttg taagctttaa accggactca aaacagtttc 1380

atagtattgt ttcccttatt cagtaatcag attacagtgc aacaaataat tttcctttaa 1440

gaatttccta ccaaatagtg ctggagtaga ttgaccttat ttatcaatga tttttgaaag 1500

ccaaaagaat ttgttcatgc ttgtctttag aatgacagct cagacataaa ggcaaacttt 1560

tgagacagcc tgaatataac atcaaacttc tctcctaatt acttgcttag ttttgtttct 1620

ttaaaaggat attcctgagc caaaacctcc cggaaatact atattttcta ctgtttccta 1680

aggctcagta agttgctcag tgcgtcttgt ccccaggtaa ttcaggcctg ggggaagggt 1740

tccttcttcc agactgatcg gtacagctgc tccgtcagcg taactactca gattcccaaa 1800

gaattctaag tggatgttcc tccacagtgt ctcttgttct ctctaatcat catcattttc 1860

aaatttcatc cactgctcat tccttcccag aattttcctt agcctgcagt tccttggaag 1920

gggagcagat tcttcacaaa tggttgaaag tacctatgtc taaagaattc tgaaaagcca 1980

gactaattat tttccttgat attttctcgg tattatgaat gaagttttac ctagtatttc 2040

atttacatat gcatgcatta tcccaataga aaaaataccc aactattagt aaggagggat 2100

tttgttaact tattaatgaa aaataatttc aggaactctt gtcttattcg tttatagctg 2160

attttctaat gcaagtggaa ggaaaaccca aatgttgctt ctttaaattt agctctaaaa 2220

tacaatacaa taaagtagta aaggcacaac tatggatata tctgagaccc gtgaagactc 2280

ctacaacagt gtttgtgcaa atcctgaggc tcatcaaacc tatgaaagac ggtacaaggt 2340

atactggaat ccgatctctg aaacttgaca tgaacccagg cactggtatt tggcagagca 2400

ttgatgtgaa gacagtgttg caaaattggc tcaaacaacc tgaatccaac ttaggcattg 2460

aaatcaaagc tttagatgag aatggtcatg atcttgctgt aaccttccca ggaccaggag 2520

aagatgggct ggtaagtgat aactgaaaag aaccctctag taaccttgtt atgtttttgt 2580

tcctaatatg aatgaataaa agtgggaaac aactaccgat ttcctatgct catgagccag 2640

acaaaggtat cttactccaa tggtagccct gtacccaata aaagtaggtg tccaatttca 2700

tatcctatga aaaactccct tgataccctt cgtttgcatg agagtttata aaaacaatta 2760

taccatggtt cttaacttct taagaagttc ttttgaattg agaatgaaat ataaactgct 2820

tttcattgat atgctacatg cttatatgaa taaaatatga actgtatata atgaattcca 2880

gttcataccc caaaaatcag acttttcttt tcctctccaa agggtgccaa atgtgttgac 2940

aagttctggc ttagtataaa gcaagaaaaa aacctaactt tagtctgctt ctttttatct 3000

ctgtctttca aataaaatga aaaaatgtaa agcatcataa tgaaagtaaa atactttcat 3060

ttgtagcaat taactaatta gtataaaaat tatattataa taaatatatt atatttaagg 3120

tccctaatgg taagcatgtt cattacttga tgcacttatc tatggattat tatgtgaaat 3180

accctctaag gacagtttta gtttctaagc cagttagctt ttaccactta acttatttct 3240

aagctggttt agcattcttg cacaagaatt tgacaactaa cttagtatca ggcaaaatag 3300

atggcaatat tttgcatatt ataaaatgaa taaaaactat tttaaaacct agcataaatt 3360

tagggctact cttttggcct atctatgttt ctgtttactt ctgctttcaa aaacttattt 3420

aatatgacaa tattttttca tggacatcta ctgacataat tttcaataga atatacttat 3480

aaaaatgaac attagttatc tttttaatct ctaactggtc ttgtttataa acattatata 3540

ataagtaaat cagatctatt tcaaatgaaa acattcttta aaagactata caattttcta 3600

aatgacttgt ttttcttata tgtattaatt taaatgctat gaattcccaa aaataacatt 3660

ggtttggact gggttaaata acagtaacta tcacatctgt tttcatttta ataaaggaca 3720

aaagctatta tcaattattt aaaaaagcat tcttttttac aagtagtatc ttaatgatca 3780

aagttgatga tatcacagct tttaattatt aaacacgtgg ttaatatggt gcattcttat 3840

ctttccatat aatacagaac aaaatctcaa atgcattaga agactgggag agtgacagta 3900

ctaacaaatg attatatgaa tatgtgaatg aaaacattct gcaacaccta cttttctgaa 3960

tttttctcat aggggttctc ttttcagtcc aatatacaca tcaccacctt catcaatcac 4020

ttagctttct tttcccatta taacttatac actgctggga ggtagctcta gctttaatac 4080

ccaagtttcc ctgagtaaag atccacagat acagaggata gatgactata ctcatccctc 4140

caggaatcat ctcacatatt tggccaacat attgaatcaa cgcatgtgaa gagaaggagc 4200

ccatcttttt cttcctctgc ctctccttcc acctccccct ccctttctcg ccagacagat 4260

tttcaggaca tctatcatgt gctaggcagt tggatactac aactagggac aacaaaaatt 4320

aaaagcacat agaactggcc tcagggggat ttgcattact gctataatct ttgagctatg 4380

aggggaaaat caaaactatt ataaatcaaa tccttagtat gatgcctttt aaatataaag 4440

gtattccaag caaaatgatt catttttctt aaggtaaaaa aagtgcttta gaataaattg 4500

atatacttat cgttctttcc ttttcacaca gaatcccttt ttagaggtca aggtaacgga 4560

cacaccaaaa agatccagaa gagattttgg tcttgactgt gatgagcact caacagaatc 4620

acgatgctgt cgctaccctc taactgtgga ttttgaagct tttggatggg attggattat 4680

tgcgcccaag agatacaagg ccaattactg ctctggagag tgtgaatttg tgtttttaca 4740

aaagtatcct catactcatc ttgtacacca agcaaacccc agaggttcag caggtccttg 4800

ctgtactccc acaaagatgt ctccaattaa tatgctatat tttaatggca aagaacaaat 4860

aatatatggg aaaattccag ccatggtagt agaccgctgt gggtgctcat gagatttgca 4920

tttggttttt aacttcctaa aacatggaag gtcttcccct caacaatttt gaaactgtga 4980

aattatgtac cataggctat aggcctagag tatgctatag tcacttaaac acaagttaca 5040

gtgtatgaac taaaagagag aatacatgca atggttggca tttaaccatc aaaataaatc 5100

atacaatagg aagttttatg atttccagag tttttgaact agaaggagat caaattatat 5160

ttacattcaa ctatgttaca acctaatcaa aaaagtaaag caattctcct tgtgttctga 5220

tgaatcaaag gagtatgtgt taaagtttat ttctttgcag ttttgtttaa tatttacagc 5280

aaaatccatg tatagtattg gtaaaatgca ggactgttat atgccatcat ttgaatcatc 5340

cttaaacact tgaactttta ttttatgata gcatacttgg taagataaaa ttccacaaaa 5400

atagggatgg tctaccatat gcaagtttcc attcctatta tgattggtac catacattaa 5460

caatccatgc caatggtgct aggataatag gctggatgac tggtgttatc aggatttcaa 5520

atataaaaca ttcggtaaaa tgagtttctc cttttttcag gtgcattttc atacatctcc 5580

aaatgaggaa tagattttct ttaatcaaag aaggatcatt tttctagagg tcaactttga 5640

attctgtagc atattggagg aactatacta tattaagagg cagccaaata atattaattt 5700

taaatgaaat tttaagacca cagcctgcct ttgcaacact gcagttttta tgacaaaata 5760

atggaaatga ttatatcaat attgtataaa aagactttaa aacaattgca tttatgtaat 5820

atgtatacaa tattgttttg taaataaatg tctccttttt tatttacttt ggtatatttt 5880

tacactaagg acatttcaaa ttaagtatta aggcacaaaa atgtatcaca gaaaagcaat 5940

tgctcatatt tcagagcaaa ttagcagatt aaatagtggt cttaaaacac catatgttaa 6000

tggttagatg gttatattac aatcatttta tattttttta cattattaac attcactatg 6060

gattcataat gactgtataa tgtgaatgtg gaatttcaat ggtttactgt cattgtattc 6120

aaatctcaac gttccattat tttaatatgt ataatattac taagtatatc aaaatgatta 6180

actccattat ctgaaatgaa gaataataaa ctgatgacat ctcaacaaaa actgttactt 6240

tattttataa tttgataatg aatatatgtc tgcatttgtt tacttctatt ctgtaaattg 6300

ggatttttgt caatcaaatt cattgtactt atgactaggt gaaattattt cttacatcta 6360

atatgtagac actattcaaa ttttattaaa gttttcacat ttttagaaaa atgtgttata 6420

aaattatgtt ataatgatga attctagatt tctgattttc actctattat aagcctaatg 6480

ttttagaaca aaagtttgac ttgagaattt taggtctgtt gctcaagttc tcacaagtaa 6540

aattcctgtt gaattggtct tggtcaagtt tctttacaca tacaaaggca aggactagtt 6600

atatctgttt catttctctt tatcttgacc tgaaaactat ttatatgttt tcataggttc 6660

aatttccaaa tgcattgcag ttggcaagga tatatggtcc tagagttaca agttcttctg 6720

aagccacagg gacacagggg agctacgtct ttttcctagc actaatgata ctggtacctt 6780

catttgagct ttggaagcat taattttcaa attgaatagc aaaaccatta aaaatcactt 6840

agaaatcatt aaatgtgata ttatacataa atatttttga agtgatatct cctctccact 6900

ccccatcact ttagcaactt agttataaag caatgactat tttactgtta gggttcctaa 6960

ataatccaca attaatggca 6980

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

ccatggtagt agaccgctgt 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<400> 3

atctttgtgg gagtacagca 20

<210> 4

<211> 18

<212> DNA

<213>Artificial sequence

<400> 4

tgtaaaacga cggccagt 18

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<400> 5

tggcaccgag tcggtgcttt 20

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence

<400> 6

attaaccctc actaaaggga 20

<210> 7

<211> 25

<212> DNA

<213>Artificial sequence

<400> 7

aaaaaaagca ccgactcggt gccac 25

<210> 8

<211> 25

<212> DNA

<213>Artificial sequence

<400> 8

tatagccatg gtagtagacc gctgt 25

<210> 9

<211> 25

<212> DNA

<213>Artificial sequence

<400> 9

aaacacagcg gtctactacc atggc 25

<210> 10

<211> 25

<212> DNA

<213>Artificial sequence

<400> 10

tatagatctt tgtgggagta cagca 25

<210> 11

<211> 25

<212> DNA

<213>Artificial sequence

<400> 11

aaactgctgt actcccacaa agatc 25

<210> 12

<211> 82

<212> DNA

<213>Artificial sequence

<400> 12

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt tt 82

<210> 13

<211> 18

<212> DNA

<213>Artificial sequence

<400> 13

cttatcgttc tttccttt 18

<210> 14

<211> 18

<212> DNA

<213>Artificial sequence

<400> 14

cctatagcct atggtaca 18

Claims (4)

1. a kind of edit methods of rabbit MSTN genes, it is characterised in that pinpointed using CRISPR/Cas9 in rabbit MSTN locus real Existing genetic modification；Specifically：

(1) according to the new zealand rabbit MSTN gene target sequences as shown in SEQ ID NO.1, for 4881-4903,4796-4818 Position nucleotide sequence designs sgRNA-1 and sgRNA-2 homing sequence,

(2) 2 kinds of CRISPR/Cas9 bis- are built using homing sequence and the two-in-one plasmid construction kits of YSYCRISPR/Cas9 to close They are respectively designated as mstn-sgRNA1 and mstn-sgRNA2 by one plasmid

(3) mstn-sgRNA1 and mstn-sgRNA2 plasmids expand sgRNA-1, sgRNA-2 and Cas9 mRNA as PCR respectively Transcription templates, sgRNA-1, sgRNA-2 and Cas9mRNA are gone out according to transcription templates in-vitro transcription；SgRNA-1 or sgRNA-2 points Activation new zealand rabbit 4881-4903,4796-4818 nucleosides of MSTN genes are not constituted with Cas9mRNA two-in-one compound The molecular biology material that acid sequence is mutated and new zealand rabbit MSTN genes are knocked out,

(4) the molecular biology material prepare transgenosis rabbit, the extron 4881- of induction MSTN gene coded sequences the 3rd are utilized The mutation of 4903 and 4796-4818 nucleotide sequence and missing.

2. according to the method described in claim 1, it is characterised in that the homing sequence of the sgRNA-1 and sgRNA-2 is： SgRNA-1 homing sequence：5’-CCATGGTAGTAGACCGCTGT-3’

SgRNA-2 homing sequence：5’-ATCTTTGTGGGAGTACAGCA-3’.

3. according to the method described in claim 1, it is characterised in that in step (3) sgRNA-1 and/or sgRNA-2 and Cas9mRNA presses 1：2-5 ratios are used cooperatively.

4. the method described in claim 1 is applied in lean meat species transgene rabbit breeding.