CN106939040A - Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed - Google Patents

Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed Download PDF

Info

Publication number
CN106939040A
CN106939040A CN201710206520.1A CN201710206520A CN106939040A CN 106939040 A CN106939040 A CN 106939040A CN 201710206520 A CN201710206520 A CN 201710206520A CN 106939040 A CN106939040 A CN 106939040A
Authority
CN
China
Prior art keywords
prostate cancer
pfn1
serum
curative effect
albumen
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710206520.1A
Other languages
Chinese (zh)
Inventor
朱嗣博
朱乃硕
谢君
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201710206520.1A priority Critical patent/CN106939040A/en
Publication of CN106939040A publication Critical patent/CN106939040A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57434—Specifically defined cancers of prostate
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/54—Determining the risk of relapse

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The invention belongs to the molecular indexes technical field that tumor diagnosis and therapy curative effect and recurrence judge, specially carry out specific detection prostate cancer risk degree using the epitope peptide making specific antibody of PFN1 albumen closely related with tumour in serum and treat the diagnostic reagent of curative effect.The present invention with largely detecting the haemocyanin before and after prostate cancer therapy with iTRAQ first changes of contents, finds the classification of risks of PFN1 albumen and prostate cancer and to treat curative effect closely related.Then screen and the functional epitope peptide in artificial synthesized PFN1, and corresponding antibodies are made using these peptides as antigen-immunized animal, obtained antibody can more delicately detect low danger, middle danger and high-risk prostate cancer patient, and curative effect to prostate cancer and recurrence have preferably assessment effect；The molecular marker can be used as examination criteria control and prepare antibody for producing corresponding diagnosing tumor and research kit.

Description

Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed
Technical field
The invention belongs to the technical field of tumor diagnosis and therapy recruitment evaluation, and in particular to in a kind of serum and tissue Molecular indexes PFN1 albumen (Profilin1) in epitope peptide make specific antibody, then utilize this antibody test serum Middle PFN1 content, so as to assess prostate cancer risk classification and therapeutic effect.
Background technology
Worldwide, prostate cancer incidence is number two in male tumor, and 2012 with regard to new cases 110 Ten thousand, in China, prostate cancer is the male malignancy being number two.And at past more than 20 years, fatal rate was added 10 times.How prostate cancer is found early, and the effective assessment of the therapeutic effect progress to prostate cancer is that current urgent need is solved The problem of.But the classification of risks of current prostate cancer is before being incited somebody to action according to patients serum PSA, Gleason scoring and clinical stages Row gland cancer is divided into three classes of basic, normal, high danger, and this stage division is related to three kinds of indexs, Gleason scorings therein and clinical stages Index is diagnosed according to variforms such as the shape of tumour and borders, it is more difficult to held.It is prior that there is presently no on preceding The unified metric that row gland cancer therapeutic effect is assessed.
The content of the invention
It is an object of the present invention to provide a serum molecules index can conveniently and accurately diagnosis of prostate cancer dangerous journey Spend and can be used to assess the therapeutic effect of prostate cancer.
Technical scheme：
(1) this research detects the different dangerous serum eggs by stages with treatment different phase of prostate cancer by iTRAQ first White group expression change, finds PFN1, and expression has significant differences (p ＜ 0.001) in different dangerous prostate cancers by stages, and In the different phase of heavy particle therapy, tumor manifestations take a turn for the better during (based on gross tumor volume size and pathological index), this point The content of sub- index has obvious different (p ＜ 0.001) (table 1 and accompanying drawings 1).
Express spectra of the 1 four kinds of segments of table during different dangerous prostate cancer therapies by stages
(2) analysis is enriched with by differential protein and finds that the molecule passes through actin cytoskeleton regulating networks (integrin signaling Part in the cell membrane of path) influence the effect (accompanying drawing 2) of heavy particle therapy.
(3) by bioinformatics and the method and B cell epitope analysis method of structure biology, four kinds of peptide epitopes are obtained Sequence (Seq No.3, No.4, No5, No6), by the artificial synthesized required peptide of mixed anhydride method, is immunized animal and produces anti-PFN1 The high-affinity antibody of protein epitope.The diagnostic reagent made according to the antibody, can with the degree of danger of diagnosis of prostate cancer and Treat curative effect (accompanying drawing 3).
The serum molecules index PFN1 gene orders and amino acid sequence that the present invention is provided be respectively SeqNo.1 and SeqNo.2。
The epitope peptide that the present invention is provided is SeqNo.3, SeqNo.4, SeqNo5, SeqNo6 (sequence annex), discovery These four peptides can cause strong immunization to be reacted, and produce specific antibody, content and presence available for detection PFN1.
The present invention is to provide based on these four Epitope peptide sequences and its prepared specific antibody production diagnosis prostatitis The detection kit of gland cancer degree of danger and treatment curative effect, the kit can differentiate low danger, middle danger and BPH in high risk carninomatosis people (P ＜ 0.05) and prostate cancer therapy effect (that is taken a turn for the better before treatment with treatment has obvious difference, P ＜ 0.05)
Brief description of the drawings
Fig. 1 be four kinds of albumen flakes break in different classification of risks cases for prostate cancer treat before in after expression figure.
Fig. 2 is difference expression gene (pink) figure in KEGG actin cytoskeleton regulating networks.Test method is The expression sequencing of iTRAQ protein groups.
Fig. 3 is that the polyclonal antibody made by four kinds of epitope peptides monitors heavy particle therapy prostate cancer curative effect figure.
Embodiment
1. human peripheral blood is sampled.Handled at once in 2 hours after blood drawing.
2. after room temperature blood natural coagulation 10-20 minutes, centrifugation 20 minutes or so (2000-3000 revs/min) takes supernatant
3. by 1: 1-1: 500 in 150 μ l small test tubes gradient dilution it is to be measured
4. setting blank well respectively on 96 or 48 orifice plates, (blank control wells are not added with sample and enzyme marking reagent, remaining each step behaviour Make identical), gauge orifice, testing sample hole.Standard items are accurately loaded test sample product in 50 μ l, testing sample hole on enzyme mark coating plate 50μl.Sample is added on ELISA Plate bottom hole portion by sample-adding, is not touched hole wall as far as possible, is gently rocked mixing；Gauge orifice is to be separately added into Certain density each target target protein and epitope peptide (sequence is SEQ ID No.2, No.3, No.4, No5, No6)；
5. incubating, with liquid, wash and enzyme-added：With shrouding film shrouding, rearmounted 37 DEG C incubate 30 minutes；By 30 times of (20 of 48T Times) concentrated cleaning solution is with standby after the dilution of 30 times of distilled water；Carefully take shrouding film off, discard liquid, dry, washing is filled it up with per hole Liquid, discards after standing 30 seconds, is so repeated 5 times, pats dry；Added per hole except the μ l of enzyme marking reagent 50, blank well；
6. colour developing：Developer A50 μ l are first added per hole, developer B50 μ l are added, gently concussion is mixed, 37 DEG C of lucifuges Colour developing 10 minutes；(k) terminate：Add the μ l of terminate liquid 50, terminating reaction per hole (now blueness is vertical turns yellow)；
7. with blank air-conditioning zero, 450nm wavelength sequentially measures the absorbance (OD values) in each hole.Measure should be after terminate liquid be added Carried out within 15 minutes.Using the concentration of reference material as abscissa, OD values are ordinate, and standard curve, root are drawn on graph paper Corresponding concentration is found by standard curve according to the OD values of sample；Multiplied by with extension rate；Or the concentration with reference material is counted with OD values The linear regression equation of standard curve is calculated, the OD values of sample are substituted into equation, sample concentration is calculated, multiplied by with dilution The actual concentrations of multiple, as sample.
8. prostate cancer diagnosis index：With normal for control, if concentration of specimens is normal 1.2-2 times, for low danger disease People；2-3 times, be middle danger patient；More than 3 times are high risk patient.Therapeutic effect is assessed：Middle danger and high risk patient, if treatment Afterwards, concentration of specimens returns less than 2 times, and as treatment takes a turn for the better.Such as return normal level, i.e., it is basic to recover.
Sequence table
SeqNo.1 gene nucleotide series,
CCCGCAGGGTCCACACGGGTCGGGCCGGGCGCGCTCCCGTGCAGCCGGCTCCGGCCCCGACCGCCCCATGCA CTCCCGGCCCCGGCGCAGGCGCAGGCGCGGGCACACGCGCCGCCGCCCGCCGGTCCTTCCCTTCGGCGGAGGTGGGG GAAGGAGGAGTCATCCCGTTTAACCCTGGGCTCCCCGAACTCTCCTTAATTTGCTAAATTTGCAGCTTGCTAATT

Claims (4)

1. a kind of molecular indexes for diagnosis of prostate cancer risk factor, it is characterised in that with the core shown in SEQ ID No.1 The protein sequence of nucleotide sequence and SEQ ID No.2.
2. a kind of epitope peptide based on PFN1 albumen, its sequence signature is SEQ ID No.3, No.4, No5, No6.
3. a kind of specific antibody made based on the epitope peptide such as SEQ ID No.2 and No.3, No.4, No5, No6, the antibody can be compared with The content of PFNI albumen in serum is monitored well, so as to reach tumour risk factor of the detection including prostate cancer and control curative effect The purpose of fruit.
4. albumen or peptide that a kind of sequence as described by claims 1. and 2. makes are compareed as standard protein molecule, with The immunity detection reagent that antibody molecule described by claims 3 is constituted as nucleuses such as probes, available for serum With PFN1 determining the protein quantity in tissue, analyzing and diagnosing is carried out with the risk factor and therapeutic effect to corresponding tumour and recurrence.
CN201710206520.1A 2017-03-31 2017-03-31 Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed Pending CN106939040A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710206520.1A CN106939040A (en) 2017-03-31 2017-03-31 Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710206520.1A CN106939040A (en) 2017-03-31 2017-03-31 Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed

Publications (1)

Publication Number Publication Date
CN106939040A true CN106939040A (en) 2017-07-11

Family

ID=59464529

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710206520.1A Pending CN106939040A (en) 2017-03-31 2017-03-31 Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed

Country Status (1)

Country Link
CN (1) CN106939040A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114113633A (en) * 2021-12-27 2022-03-01 复旦大学 Molecular index and kit for prostate cancer risk degree diagnosis and curative effect evaluation
CN114441768A (en) * 2022-01-17 2022-05-06 复旦大学 Molecular index ApoA1 epitope peptide for prostate cancer assessment and kit

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103237901A (en) * 2010-03-01 2013-08-07 卡里斯生命科学卢森堡控股有限责任公司 Biomarkers for theranostics
CN103898211A (en) * 2014-03-10 2014-07-02 江苏雄鸣医药科技有限公司 Genetic diagnosis kit for amyotrophic lateral sclerosis
US20140296096A1 (en) * 2013-03-27 2014-10-02 Oslo Universitetssykehus Hf Prostate cancer markers and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103237901A (en) * 2010-03-01 2013-08-07 卡里斯生命科学卢森堡控股有限责任公司 Biomarkers for theranostics
US20140296096A1 (en) * 2013-03-27 2014-10-02 Oslo Universitetssykehus Hf Prostate cancer markers and uses thereof
CN103898211A (en) * 2014-03-10 2014-07-02 江苏雄鸣医药科技有限公司 Genetic diagnosis kit for amyotrophic lateral sclerosis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
URŠA PEČAR FONOVIĆ等: "Profilin 1 as a target for cathepsin X activity in tumor cells", 《PLOS ONE》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114113633A (en) * 2021-12-27 2022-03-01 复旦大学 Molecular index and kit for prostate cancer risk degree diagnosis and curative effect evaluation
CN114113633B (en) * 2021-12-27 2024-05-24 复旦大学 Molecular index and kit for diagnosing risk and evaluating curative effect of prostate cancer
CN114441768A (en) * 2022-01-17 2022-05-06 复旦大学 Molecular index ApoA1 epitope peptide for prostate cancer assessment and kit

Similar Documents

Publication Publication Date Title
CN104450901B (en) The nucleic acid markers of quick diagnosis mucocutaneous lymphnode syndrome and test kit thereof
Bodaghi et al. Biomarkers: Promising and valuable tools towards diagnosis, prognosis and treatment of Covid-19 and other diseases
CN106405104B (en) A kind of new cirrhosis or hepatic fibrosis markers
Li et al. A prognostic 4‐gene expression signature for squamous cell lung carcinoma
CN109478231A (en) The method and composition of the obvious Lung neoplasm of benign and malignant radiograph is distinguished in help
CN105572355B (en) Detect the biomarker of the cancer of the esophagus
CN108957011A (en) Serum/plasma polypeptide marker relevant to gestational diabetes auxiliary early diagnosis and its application
CN105040111A (en) Construction method of systemic lupus erythematosus map model
CN110272990A (en) Excretion body microRNA is as depression marker and its application
RU2013141965A (en) DIAGNOSIS AND TREATMENT OF CANCER
CN107045062A (en) Detect colloidal gold immuno-chromatography test paper strip, kit of human neutrophil genatinase associated lipocalin and preparation method thereof
CN106841593B (en) Application of the LACC1 and FHL2 genes in preparing scoliosis detection product
CN106939040A (en) Serum and tissue element index that a kind of prostate cancer risk degree and therapeutic effect are assessed
CN105899673A (en) Keratins as biomarkers for cervical cancer and survival
CN104818322B (en) MiRNA and Cyfra21 1 combine the application in detection non-small cell lung cancer
CN108362884A (en) A kind of serum and tissue element index of tumour danger level and therapeutic effect assessment
CN108732351A (en) EPS8L2 is as tubercle and the biomarker of early warning liver cancer in instruction liver
EP2757376A1 (en) Molecular marker for early indentification of pleural mesothelioma patients, and expression analysis method for same
CN107422123B (en) It is a kind of for diagnosing the kit of oral squamous cell carcinoma
CN110218796A (en) New target drone PCDHB2 for Bone of Breast Cancer transfer diagnosis and treatment
CN106255765A (en) SRM/MRM for receptor tyrosine kinases UFO (AXL) protein measures
CN103797369B (en) The assay method of anti-WT1 antibody
CN105675572B (en) A kind of screening lung cancer kit
CN109085359A (en) Serum protein markers combine the application in colorectal cancer screening and diagnosis and treatment
Zhang et al. Comparison of biological behavior of lacrimal gland adenoid cystic carcinoma with high-grade transformation cells

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20170711

WD01 Invention patent application deemed withdrawn after publication