CN106868215A - Primer sets and its application for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus - Google Patents
Primer sets and its application for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus Download PDFInfo
- Publication number
- CN106868215A CN106868215A CN201710173760.6A CN201710173760A CN106868215A CN 106868215 A CN106868215 A CN 106868215A CN 201710173760 A CN201710173760 A CN 201710173760A CN 106868215 A CN106868215 A CN 106868215A
- Authority
- CN
- China
- Prior art keywords
- sequence
- measured
- mycoplasma bovis
- pathogenic microorganism
- infectious bovine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer sets for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus and its application.The primer combination of present invention protection primer pair first and primer pair B composition.Primers F 1 of the primer pair first shown in sequence 1 and the primer R1 shown in sequence 2 are constituted.Primers F 2 of the primer pair B shown in sequence 3 and the primer R2 shown in sequence 4 are constituted.Using primer pair first and primer pair B, Mycoplasma bovis and infectious bovine rhinotrachetis virus are detected by double two warm formula PCR, have the advantages that specific good, sensitivity is high, universality is good, fast and easy, can be used for Clinical differential diagnosis and epidemiology survey.The present invention provides new technical method for the prevention and control of cattle disease, with clinical value very high.
Description
Technical field
The present invention relates to a kind of primer sets for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus and its application.
Background technology
Mycoplasma bovis (Mycoplasma bovis, MB) mainly cause ox to be had difficulty in breathing, pant, cough, while can also draw
Play arthritis, mammitis, genital tract inflammation, keratoconjunctivitis, otitis etc..Jianhua XIE et al. is between 2008-2013 to Chongqing ground
1606 parts of area cow's serum sample detected, as a result shows that MB positive rates are 49.00%.Guo Shu is strong et al. to 16, Ningxia scale
Changing 460 parts of cow's serums of plant has carried out the detection of Mycoplasma bovis antibody, as a result shows that MB positive rates are 32.17%.
Infectious bovine rhinotrachetis virus (bovine herpesvirus I, IBRV) is also called infectious bovine rhinotracheitis
Virus, mainly causes the diseases such as Niu Gaore, rhinitis, expiratory dyspnea and dam miscarriage.The disease influences the breeding of cows and gives milk, and gives
Cattle-raising causes huge economic loss, and China is classified as two class animal epidemics.Korea Spro is picked up between 2011 according to clear et al.
Totally 1840 parts of Serum of Yaks samples carry out infectious bovine rhinotrachetis for Tibet (988 parts), Qinghai (475 parts) and Sichuan (377 parts)
Antiviral antibody detects that as a result IBRV positive rates are respectively 38.6%, 44.6%, 27.9%.Including Sun Qing spaces et al. (2014)
2321 cow heads of 16 dairy cow farms in Mongolian area carry out ox infectiousness nose gas inflammation seroepidemiological survey, as a result show
IBRV average positive rates are 75.7%.Zhang Xian et al. (2015) is to the scale pasture of District of Shanghai 19 totally 920 parts of serum samples
Product carry out IBRV Serum Antibody Detections, as a result show that IBRV antibody positive rates are 46.74%.Li Yongqin etc. (2016) is to Ningxia
Regional 18 large-scale milch cow farms, 470 parts of serum carry out the serosurvey of infectious bovine rhinotrachetis, as a result show average sun
Property rate reaches 71.9%.
Mycoplasma bovis and infectious bovine rhinotrachetis virus are responsible for cattle respiratory disease, and clinical condition state is similar to be difficult to
Distinguish, therefore be badly in need of setting up the Fast Detection Technique of Mycoplasma bovis and infectious bovine rhinotrachetis virus, be Mycoplasma bovis and ox
The prevention and control of infectious bovine rhinotracheitis virus provide technical support.
The content of the invention
It is an object of the invention to provide a kind of primer sets for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus
And its application.
The present invention protects a kind of primer to combine first, is following (a1) or (a2) or (a3)：
(a1) it is made up of primer pair first and primer pair B；
(a2) the primer pair first；
(a3) primer pair B；
The primer pair first is made up of primers F 1 and primer R1；
The primers F 1 is following (b1) or (b2)：
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) sequence 1 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 1
The DNA molecular of identical function；
The primer R1 is following (b3) or (b4)：
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) sequence 2 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 2
The DNA molecular of identical function；
The primer pair B is made up of primers F 2 and primer R2；
The primers F 2 is following (c1) or (c2)：
(c1) single strand dna shown in the sequence 3 of sequence table；
(c2) sequence 3 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 3
The DNA molecular of identical function；
The primer R2 is following (c3) or (c4)：
(c3) single strand dna shown in the sequence 4 of sequence table；
(c4) sequence 4 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 4
The DNA molecular of identical function.
The purposes of the primer combination is following (d1) or (d2) or (d3)：
(d1) Mycoplasma bovis and infectious bovine rhinotrachetis virus are differentiated；
(d2) identify whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus；
(d3) whether identification sample to be tested has infected Mycoplasma bovis and/or infectious bovine rhinotrachetis virus.
The present invention also protects application of the primer combination in reagent preparation box；The purposes of the kit is as follows
Or (d2) or (d3) (d1)：
(d1) Mycoplasma bovis and infectious bovine rhinotrachetis virus are differentiated；
(d2) identify whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus；
(d3) whether identification sample to be tested has infected Mycoplasma bovis and/or infectious bovine rhinotrachetis virus.
The present invention also kit of the protection containing primer combination；The purposes of the kit is following (d1) or (d2)
Or (d3)：
(d1) Mycoplasma bovis and infectious bovine rhinotrachetis virus are differentiated；
(d2) identify whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus；
(d3) whether identification sample to be tested has infected Mycoplasma bovis and/or infectious bovine rhinotrachetis virus.
The present invention also protects the preparation method of the kit, including the step of each bar primer is individually packed.
It is Mycoplasma bovis or infectious bovine rhinotrachetis virus that the present invention also protects a kind of discriminating pathogenic microorganism to be measured
Method, comprise the following steps：
(1) nucleic acid of pathogenic microorganism to be measured is extracted；
(2) nucleic acid for being obtained with step (1) carries out double two as template using the primer pair first and the primer pair B
Warm formula PCR, then makes the following judgment：If obtaining the amplified production that size is 412bp, pathogenic microorganism to be measured is former ox branch
Body；If obtaining the amplified production that size is 727bp, pathogenic microorganism to be measured is infectious bovine rhinotrachetis virus.
The pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus.
The present invention also protection one kind identifies whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis disease
The method of poison, comprises the following steps：
(1) nucleic acid of pathogenic microorganism to be measured is extracted；
(2) nucleic acid for being obtained with step (1) carries out double two as template using the primer pair first and the primer pair B
Warm formula PCR, then makes the following judgment：If obtaining the amplified production that size is 412bp, pathogenic microorganism to be measured is or candidate
It is Mycoplasma bovis；If obtaining the amplified production that size is 727bp, pathogenic microorganism to be measured is or candidate is ox infectiousness nose gas
The scorching virus of pipe.
The present invention also protects whether a kind of identification sample to be tested infects Mycoplasma bovis and/or infectious bovine rhinotrachetis virus
Method, comprise the following steps：
(1) nucleic acid of sample to be tested is extracted；
(2) nucleic acid for being obtained with step (1) carries out double two as template using the primer pair first and the primer pair B
Warm formula PCR, then makes the following judgment：If obtaining the amplified production that size is 412bp, sample to be tested infects or suspected infection
Mycoplasma bovis；If obtaining the amplified production that size is 727bp, sample to be tested infects or suspected infection infectious bovine rhinotrachetis
Virus.
It is Mycoplasma bovis or infectious bovine rhinotrachetis virus that the present invention also protects a kind of discriminating pathogenic microorganism to be measured
Method, comprise the following steps：Detect special shown in the sequence 5 whether in the nucleic acid of pathogenic microorganism to be measured with sequence table
DNA molecular or whether have sequence table sequence 6 shown in specific DNA molecular, if in the nucleic acid of pathogenic microorganism to be measured have
Specific DNA molecular, pathogenic microorganism to be measured shown in the sequence 5 of ordered list are Mycoplasma bovis, if pathogenic microorganism to be measured
Nucleic acid in have sequence table sequence 6 shown in specific DNA molecular, pathogenic microorganism to be measured be infectious bovine rhinotrachetis disease
Poison.The pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus.
The present invention also protection one kind identifies whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis disease
The method of poison, comprises the following steps：Detect the spy shown in the sequence 5 whether in the nucleic acid of pathogenic microorganism to be measured with sequence table
Different DNA molecular or whether have sequence table sequence 6 shown in specific DNA molecular, if in the nucleic acid of pathogenic microorganism to be measured
Specific DNA molecular, pathogenic microorganism to be measured shown in sequence 5 with sequence table are or candidate is Mycoplasma bovis, if to be measured
Specific DNA molecular, pathogenic microorganism to be measured in the nucleic acid of pathogenic microorganism shown in the sequence 6 with sequence table are or candidate is
Infectious bovine rhinotrachetis virus.
The present invention also protects whether a kind of identification sample to be tested infects Mycoplasma bovis and/or infectious bovine rhinotrachetis virus
Method, comprise the following steps：Whether there is the specific DNA point shown in the sequence 5 of sequence table in the nucleic acid of detection sample to be tested
Specific DNA molecular shown in sequence 6 sub and/or that whether there is sequence table, if having sequence table in the nucleic acid of sample to be tested
Sequence 5 shown in specific DNA molecular, sample to be tested infection or suspected infection Mycoplasma bovis, if in the nucleic acid of sample to be tested
The infection of specific DNA molecular, sample to be tested or suspected infection infectious bovine rhinotrachetis disease shown in sequence 6 with sequence table
Poison.
Pathogenic microorganism to be measured described in any of the above is Mycoplasma bovis, infectious bovine rhinotrachetis virus, bovine viral abdomen
Diarrhea virus, foot and mouth disease virus, vesicular stomatitis virus, blue tongue virus, bovine rota or PPR virus.The ox
Viral diarrhea virus are bovine viral diarrhea virus Oregon plants, bovine viral diarrhea virus NADL plants or bovine viral diarrhoea
Viral yak strain.The foot and mouth disease virus is foot and mouth disease virus A types, foot and mouth disease virus is O-shaped or the types of foot and mouth disease virus Asia I.Institute
Vesicular stomatitis virus is stated for vesicular stomatitis virus NJ types or vesicular stomatitis virus IND types.The blue tongue virus is indigo plant
The type of glossopathy serum virus 4, the type of blue tongue virus serum 8, the type of blue tongue virus serum 9, the type of blue tongue virus serum 15, blue tongue disease
The type of serum virus 17 or the type of blue tongue virus serum 18.The bovine rota is bovine rota NCDV plants or bovine rota
014 plant.The PPR virus are PPR virus Nigeria75/1 plants.
Mycoplasma bovis described in any of the above are Mycoplasma bovis GL-1 plants or Mycoplasma bovis BS-1 plants.Ox described in any of the above passes
Metachromia rhinotracheitis virus is infectious bovine rhinotracheitis virus Nu/67 plants.
Sample to be tested described in any of the above is in vitro animal tissue, such as in beef, beef are processed into food, ox
It is dirty, food that ox internal organ are processed into etc..
Nucleic acid described in any of the above is the mixture of DNA and RNA.
The nucleic acid that sample to be tested is extracted described in any of the above is to use the RNA/DNA nucleic acid that extraction reagent kit extraction is obtained altogether.
Nucleic acid described in any of the above is genomic DNA.
The nucleic acid that sample to be tested is extracted described in any of the above is to carry out the nucleic acid that extracting genome DNA is obtained.
The annealing elongating temperature of double two warm formula PCR is 55 DEG C~68 DEG C, preferably 67 DEG C described in any of the above.To take up an official post
The peak optimization reaction program of double two warm formula PCR is described in one：42℃30min；94℃5min；94 DEG C of 30s, 67 DEG C of 30s, 35 are followed
Ring；72℃10min..
The initial reaction system of double two warm formula PCR is (25 μ L) described in any of the above：MgCl21~10mmol/L, Taq
1~5U of DNA Polymerase, 0.1~0.8mmol/L of dNTP, every primer 1~10pmol/ μ L.Two described in any of the above
The optimal initial reaction system for weighing two warm formula PCR is (25 μ L)：MgCl2 1.5mmol/L、Taq DNA Polymerase
2.5U, dNTP 0.2mmol/L, the 1pmol/ μ L of primers F 1, primer R1 1pmol/ μ L, the 1pmol/ μ L of primers F 2, primer R2
1pmol/ μ L, the μ L of 10 × buffer 2.5, the μ L of template 1, balance of water.
Multiplex PCR is a kind of efficient PCR, can detect multiple pathogens while differentiating in same PCR reaction tubes,
There is advantage and value for clinical application very high in the antidiastole of various cause of disease mixed infections.Two temperature formula PCR are in routine
The easier PCR detection techniques developed on the basis of PCR, two temperature formula PCR will be annealed and extension is completed at the same temperature,
Degenerate temperature formula PCR's warmer than conventional three is high, therefore not only increases the specificity of PCR, and two temperature formula PCR are eliminated and risen repeatedly
The time loss of temperature drop temperature, it is time-consuming, improve the diagnosis efficiency of disease.The method that the present invention is provided, it is whole only once to take out
Carry, PCR, an electrophoresis can detect two kinds of cause of diseases, be especially suitable for the sample of mixed infection, time saving and energy saving.
Cowboying in recent years raise industry scale continuous expansion, epidemic prevention and control work be faced with unprecedented pressure, it is necessary to
Easy, quick, high flux detection technique is ensureing the sound development of cattle-raising.The invention provides for identifying Mycoplasma bovis
(MB) primer pair first and the primer pair B for identifying infectious bovine rhinotrachetis virus (IBRV), and based on two primer pairs
Develop double two warm formula PCR methods.Using primer pair first and primer pair B, Mycoplasma bovis are detected by double two warm formula PCR
And infectious bovine rhinotrachetis virus, have the advantages that specific good, sensitivity is high, universality is good, fast and easy, can be used to face
Bed antidiastole and epidemiology survey.The present invention provides new technical method for the prevention and control of cattle disease, with clinic very high
Application value.
Brief description of the drawings
Fig. 1 is the result of embodiment 4.
Fig. 2 is the result of embodiment 5.
Fig. 3 is the result of embodiment 6.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, unless otherwise specified, is conventional method.Test material used in following embodiments, unless otherwise specified, is certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following examples, is respectively provided with three repetitions and tests, and as a result makes even
Average.The common extraction reagent kits of RNA/DNA：Dalian treasured biotech firm.PEASY-T1 carriers：Dalian treasured biotech firm.Used in embodiment
To each strain be shown in Table 1.
Table 1
The design of embodiment 1, primer
The genomic DNA of genomic DNA and infectious bovine rhinotrachetis virus to Mycoplasma bovis carries out sequence analysis,
Target spot is selected on the basis of sequence analysis and primer is designed, the primer pair storehouse being made up of thousands of primer pairs is obtained.To primer
Carry out preliminary experiment one by one to each primer pair in storehouse, the sensitivity of detection primer pair, specific and universality finally give use
Primer pair B in the primer pair first of identification Mycoplasma bovis and for identifying infectious bovine rhinotrachetis virus.
Primer pair first is made up of (5 ' → 3 ') following primers F 1 and primer R1：
F1 (sequence 1 of sequence table)：GCAACATGAAACCTTATACGA；
R1 (sequence 2 of sequence table)：ATCCTCATAGAATTGTTCAAAGA.
Primer pair B is made up of (5 ' → 3 ') following primers F 2 and primer R2：
F2 (sequence 3 of sequence table)：CGGCGTCATTTACAAGGAGAA；
R2 (sequence 4 of sequence table)：GGCCGTGAAGCGGAAGTT.
The target sequence of primer pair first is 412bp.The target sequence of primer pair B is 727bp.
Embodiment 2, parameter optimization
Primer pair first and primer pair B carry out the parameter optimization of double two warm formula PCR.Optimised parameter includes reactant
The parameter of system and the parameter of response procedures.The parameter of reaction system includes (25 μ L)：In initial reaction system, MgCl2Concentration,
The content of Taq DNA Polymerase, the concentration of dNTP, the concentration of each bar primer.The parameter of response procedures includes：Annealing is prolonged
Stretch temperature.
Suggestion initial reaction system is (25 μ L)：MgCl21~10mmol/L, 1~5U of Taq DNA Polymerase,
0.1~0.8mmol/L of dNTP, every primer 1~10pmol/ μ L.Optimal initial reaction system is (25 μ L)：MgCl2
1.5mmol/L, Taq DNA Polymerase 2.5U, dNTP 0.2mmol/L, the 1pmol/ μ L of primers F 1, primer R1
1pmol/ μ L, the 1pmol/ μ L of primers F 2, primer R2 1pmol/ μ L, the μ L of 10 × buffer 2.5, the μ L of template 1, balance of water.
Suggestion annealing elongating temperature is 55 DEG C~68 DEG C.Optimal annealing elongating temperature is 67 DEG C.Peak optimization reaction program is：42
℃30min；94℃5min；94 DEG C of 30s, 67 DEG C of 30s, 35 circulations；72℃10min.
The foundation of embodiment 3, method
1st, the nucleic acid of sample to be tested is extracted using the common extraction reagent kits of RNA/DNA.
2nd, the nucleic acid that step 1 is obtained is taken, as template, double two warm formula PCR is carried out.
Initial reaction system is (25 μ L)：MgCl2 1.5mmol/L、Taq DNA Polymerase 2.5U、dNTP
0.2mmol/L, the 1pmol/ μ L of primers F 1, primer R1 1pmol/ μ L, the 1pmol/ μ L of primers F 2, primer R2 1pmol/ μ L, 10
The μ L of × buffer 2.5, the μ L of template 1, balance of water.
Response procedures are：42℃30min；94℃5min；94 DEG C of 30s, 67 DEG C of 30s, 35 circulations；72℃10min.
3rd, the product of step 2 is taken, 1% agarose gel electrophoresis is carried out.
Embodiment 4, specificity experiments
Sample to be tested is：The cDNA of all RNA virus in all DNA virus, table 1 in table 1 is (by each RNA virus
Extract total serum IgE and reverse transcription obtain cDNA), and Mycoplasma bovis BS-1 plants and infectious bovine rhinotracheitis virus Nu/67 plants
Mixture.
The method set up according to embodiment 3 is detected.
Setting beef as sample to be tested negative control.
Partial results are shown in Fig. 1.In Fig. 1, M corresponding DNAs marker (100bp ladder), 1 corresponding infectiousness nose of an ox tracheae
Scorching virus N u/67 plants, 2 corresponding Mycoplasma bovis BS-1 plants, 3 corresponding mixtures, 4 corresponding foot and mouth disease virus A types, 5 correspondences are vesiculovirus
Stomatovirus NJ types, the 6 corresponding types of blue tongue virus serum 4,7 corresponding bovine viral diarrhea virus Oregon plants, 8 corresponding bull wheel shapes
Virus N CDV plants, 9 corresponding PPR virus Nigeria75/1 plants, 10 corresponding negative controls.
Mycoplasma bovis GL-1 plants, Mycoplasma bovis BS-1 plants shows specific band between 300bp-500bp, through sequencing
It is 412bp.Infectious bovine rhinotracheitis virus Nu/67 plants shows specific band between 700bp-800bp, equal through sequencing
It is 727bp.Mixture shows two specific bands, and through sequencing, one is 412bp, and another is 727bp.Other each strains
Any band is not shown.
Result shows, using primer pair first and primer pair B by double two warm formula PCR detections Mycoplasma bovis and Niu Chuanran
Property rhinotracheitis virus has the following advantages that：Do not exist non-specific amplification to other viruses, do not exist to host animal (ox)
Non-specific amplification, specificity is excellent；There is good universality to Mycoplasma bovis, the amplification that each strain obtains 412bp is produced
Thing；The detection to Mycoplasma bovis and infectious bovine rhinotrachetis virus mixing sample can be realized, and reads result simultaneously.
Embodiment 5, sensitivity experiments
By the double chain DNA molecule shown in the sequence 5 of sequence table, pEASY-T1 carriers are cloned into, obtain standard items plasmid first.
By the double chain DNA molecule shown in the sequence 6 of sequence table, pEASY-T1 carriers are cloned into, obtain standard items plasmid second.
With standard items plasmid first and standard items plasmid second as solute, with distilled water as solvent, each standard solution is obtained.
In standard solution 1, the concentration of standard items plasmid first and standard items plasmid second is 1 × 108Copy/μ L.Standard solution 2
In, the concentration of standard items plasmid first and standard items plasmid second is 1 × 107Copy/μ L.In standard solution 3, standard items plasmid
The concentration of first and standard items plasmid second is 1 × 106Copy/μ L.In standard solution 4, standard items plasmid first and standard quality
The concentration of grain second is 1 × 105Copy/μ L.In standard solution 5, the concentration of standard items plasmid first and standard items plasmid second is equal
It is 1 × 104Copy/μ L.In standard solution 6, the concentration of standard items plasmid first and standard items plasmid second is 1 × 103Copy/μ
L.In standard solution 7, the concentration of standard items plasmid first and standard items plasmid second is 1 × 102Copy/μ L.Standard solution 8
In, the concentration of standard items plasmid first and standard items plasmid second is 10 copies/μ L.In standard solution 9, standard items plasmid first and
The concentration of standard items plasmid second is 1 copy/μ L.
With standard solution as template, the method (step 2 and step 3) set up according to embodiment 3 is detected.
Result is shown in Fig. 2.In Fig. 2, M corresponding DNAs marker (100bp ladder), 1 to 9 is corresponding in turn to standard solution 1
To standard solution 9.
Result shows, using primer pair first and primer pair B by double two warm formula PCR detections Mycoplasma bovis and Niu Chuanran
Property rhinotracheitis virus has the following advantages that：Lowest detection to Mycoplasma bovis is limited to 10000 copies, to ox infectiousness nose
The lowest detection of bronchitis virus is limited to 10000 copies.
Embodiment 6, interference is tested
The standard items plasmid first and standard items plasmid second prepared with embodiment 5, with distilled water as solvent, obtain each as solute
Individual sample solution.In sample solution A, the concentration of standard items plasmid first is 104Copy/μ L, the concentration of standard items plasmid second is 108
Copy/μ L.In sample solution B, the concentration of standard items plasmid first is 105Copy/μ L, the concentration of standard items plasmid second is 107Copy
Shellfish/μ L.In sample solution C, the concentration of standard items plasmid first is 106Copy/μ L, the concentration of standard items plasmid second is 106Copy/μ
L.In sample solution D, the concentration of standard items plasmid first is 107Copy/μ L, the concentration of standard items plasmid second is 105Copy/μ L.Sample
In product solution E, the concentration of standard items plasmid first is 108Copy/μ L, the concentration of standard items plasmid second is 104Copy/μ L.
With sample solution as template, the method (step 2 and step 3) set up according to embodiment 3 is detected.
Result is shown in Fig. 3.In Fig. 3, M corresponding DNAs marker (100bp ladder), 1 to 5 is corresponding in turn to sample solution A extremely
Sample solution E.
Result shows, using primer pair first and primer pair B by double two warm formula PCR detections Mycoplasma bovis and Niu Chuanran
Property rhinotracheitis virus has the following advantages：When the target concentration of a primer pair is higher, and the target of another template compared with
When low, two kinds of targets can be still detected simultaneously by, not influence amplification efficiency, it is mutually interference-free.
SEQUENCE LISTING
<110>Veterinary Institute of Guangxi Zhuang Autonomous Region
<120>Primer sets and its application for identifying Mycoplasma bovis and infectious bovine rhinotrachetis virus
<130> GNCYX170639
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
gcaacatgaa accttatacg a 21
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
atcctcatag aattgttcaa aga 23
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
cggcgtcatt tacaaggaga a 21
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence
<400> 4
ggccgtgaag cggaagtt 18
<210> 5
<211> 412
<212> DNA
<213>Artificial sequence
<400> 5
gcaacatgaa accttatacg aaaatggctt gttaataaaa aacaaagact ataacttttg 60
gattaatcag tttaataaaa ttaaagaaat tttaagtttc aaaaacaata attatattaa 120
tgaactaact aacaaaatgc atcaagcagc caataatatg caatttgaac ttgcattatt 180
tttgcgtgat ggcttaacat atttaaaaaa gttaaaagaa agtcaaatta tagagctaag 240
tcaatataaa aatattgacg tatttgctta taaaacagac gaaaaattaa tttttgctac 300
agttttgttc tatcgctatg gaatattaat caacaaggtt aatttaacaa ttccactagg 360
tttaagtgtt gatgaatcac ttagagtttt ctttgaacaa ttctatgagg at 412
<210> 6
<211> 727
<212> DNA
<213>Artificial sequence
<400> 6
cggcgtcatt tacaaggaga acatcgcgcc gtacacgttc aaggcctaca tttactacaa 60
aaacgtgctc gtgaccggga aaagcccggg gggcacgtac gcggccatta caaaccagta 120
cacggaccgc atgcccgtgg gcatgggcga gatcacggac ctggtggaca agaagtggca 180
ctgcctttcg aaagccgagt acctgcgcag cgggcgcaag gtggtggcct ttgaccgcga 240
cgacgacccc tgggaggcgc cgctgaagcc tgcgcggctg agcgcgcccg gggtgcgggg 300
ctggcacacg acggacgatg tgtacacggc gctgggctcg gcggggctct accgcacggg 360
cacctctgtg aactgcatcg tggaagaagt ggaggcgcgc tcggtgtacc cgtacgactc 420
gttcgcgctc tcgaccgggg acattatcta catgtcgccc ttttacgggc tgcgcgaggg 480
cgcgcaccgc gagcacacca gctactcgcc ggagcgcttc cagcagatcg agggctacta 540
caagcgcgac atggccacgg gccggcgcct caaggagccg gtctcgcgga actttttgcg 600
tacacagcac gtgacggtag cctgggactg ggtgcccaag cgcaaaaacg tgtgctcgct 660
ggccaagtgg cgcgaggcgg acgaaatgct gcgagacgag agccgcggga acttccgctt 720
cacggcc 727
Claims (10)
1. primer combination, is following (a1) or (a2) or (a3)：
(a1) it is made up of primer pair first and primer pair B；
(a2) the primer pair first；
(a3) primer pair B；
The primer pair first is made up of primers F 1 and primer R1；
The primers F 1 is following (b1) or (b2)：
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) sequence 1 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 1 identical
The DNA molecular of function；
The primer R1 is following (b3) or (b4)：
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) sequence 2 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 2 identical
The DNA molecular of function；
The primer pair B is made up of primers F 2 and primer R2；
The primers F 2 is following (c1) or (c2)：
(c1) single strand dna shown in the sequence 3 of sequence table；
(c2) sequence 3 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 3 identical
The DNA molecular of function；
The primer R2 is following (c3) or (c4)：
(c3) single strand dna shown in the sequence 4 of sequence table；
(c4) sequence 4 is had by the substitution of one or several nucleotides and/or missing and/or addition and with sequence 4 identical
The DNA molecular of function.
2. application of the primer combination in reagent preparation box described in claim 1；The purposes of the kit be following (d1) or
Or (d3) (d2)：
(d1) Mycoplasma bovis and infectious bovine rhinotrachetis virus are differentiated；
(d2) identify whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus；
(d3) whether identification sample to be tested has infected Mycoplasma bovis and/or infectious bovine rhinotrachetis virus.
3. the kit of primer combination described in claim 1 is contained；The purposes of the kit be following (d1) or (d2) or
(d3)：
(d1) Mycoplasma bovis and infectious bovine rhinotrachetis virus are differentiated；
(d2) identify whether pathogenic microorganism to be measured is Mycoplasma bovis or infectious bovine rhinotrachetis virus；
(d3) whether identification sample to be tested has infected Mycoplasma bovis and/or infectious bovine rhinotrachetis virus.
4. the preparation method of kit described in claim 3, including the step of each bar primer is individually packed.
5. it is a kind of to differentiate that pathogenic microorganism to be measured is Mycoplasma bovis or the method for infectious bovine rhinotrachetis virus including as follows
Step：
(1) nucleic acid of pathogenic microorganism to be measured is extracted；
(2) nucleic acid for being obtained with step (1) as template, using the primer pair first and the primer pair B in claim 1
Double two warm formula PCR are carried out, is then made the following judgment：If obtaining the amplified production that size is 412bp, the micro- life of cause of disease to be measured
Thing is Mycoplasma bovis；If obtaining the amplified production that size is 727bp, pathogenic microorganism to be measured is infectious bovine rhinotrachetis disease
Poison.
6. it is a kind of identify pathogenic microorganism to be measured whether be Mycoplasma bovis or infectious bovine rhinotrachetis virus method, including such as
Lower step：
(1) nucleic acid of pathogenic microorganism to be measured is extracted；
(2) nucleic acid for being obtained with step (1) as template, using the primer pair first and the primer pair B in claim 1
Double two warm formula PCR are carried out, is then made the following judgment：If obtaining the amplified production that size is 412bp, the micro- life of cause of disease to be measured
Thing is or candidate is Mycoplasma bovis；If obtaining the amplified production that size is 727bp, pathogenic microorganism to be measured is or candidate is ox
Infectious bovine rhinotracheitis virus.
7. it is a kind of to identify the method whether sample to be tested infects Mycoplasma bovis and/or infectious bovine rhinotrachetis virus, including such as
Lower step：
(1) nucleic acid of sample to be tested is extracted；
(2) nucleic acid for being obtained with step (1) as template, using the primer pair first and the primer pair B in claim 1
Double two warm formula PCR are carried out, is then made the following judgment：If obtaining the amplified production that size is 412bp, sample to be tested infection
Or suspected infection Mycoplasma bovis；If obtaining the amplified production that size is 727bp, sample to be tested infects or suspected infection Niu Chuanran
Property rhinotracheitis virus.
8. it is a kind of to differentiate that pathogenic microorganism to be measured is Mycoplasma bovis or the method for infectious bovine rhinotrachetis virus including as follows
Step：Detect the specific DNA molecular shown in the sequence 5 whether in the nucleic acid of pathogenic microorganism to be measured with sequence table or whether have
Specific DNA molecular shown in the sequence 6 of ordered list, if the sequence 5 with sequence table in the nucleic acid of pathogenic microorganism to be measured
Shown specific DNA molecular, pathogenic microorganism to be measured are Mycoplasma bovis, if having sequence in the nucleic acid of pathogenic microorganism to be measured
Specific DNA molecular, pathogenic microorganism to be measured shown in the sequence 6 of table are infectious bovine rhinotrachetis virus.
9. it is a kind of identify pathogenic microorganism to be measured whether be Mycoplasma bovis or infectious bovine rhinotrachetis virus method, including such as
Lower step：Detect specific DNA molecular shown in the sequence 5 whether in the nucleic acid of pathogenic microorganism to be measured with sequence table or whether
Specific DNA molecular shown in sequence 6 with sequence table, if the sequence with sequence table in the nucleic acid of pathogenic microorganism to be measured
Specific DNA molecular, pathogenic microorganism to be measured shown in 5 are or candidate is Mycoplasma bovis, if the nucleic acid of pathogenic microorganism to be measured
In have sequence table sequence 6 shown in specific DNA molecular, pathogenic microorganism to be measured be or candidate be infectious bovine rhinotrachetis
Virus.
10. it is a kind of to identify the method whether sample to be tested infects Mycoplasma bovis and/or infectious bovine rhinotrachetis virus, including such as
Lower step：Whether there is the specific DNA molecular shown in the sequence 5 of sequence table in the nucleic acid of detection sample to be tested and/or whether have
Specific DNA molecular shown in the sequence 6 of ordered list, if in the nucleic acid of sample to be tested shown in the sequence 5 with sequence table
Specific DNA molecular, sample to be tested infection or suspected infection Mycoplasma bovis, if the sequence with sequence table in the nucleic acid of sample to be tested
The infection of specific DNA molecular, sample to be tested or suspected infection infectious bovine rhinotrachetis virus shown in row 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710173760.6A CN106868215B (en) | 2017-03-22 | 2017-03-22 | For identifying the primer sets and its application of Mycoplasma bovis and infectious bovine rhinotrachetis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710173760.6A CN106868215B (en) | 2017-03-22 | 2017-03-22 | For identifying the primer sets and its application of Mycoplasma bovis and infectious bovine rhinotrachetis virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106868215A true CN106868215A (en) | 2017-06-20 |
| CN106868215B CN106868215B (en) | 2019-11-12 |
Family
ID=59172685
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710173760.6A Active CN106868215B (en) | 2017-03-22 | 2017-03-22 | For identifying the primer sets and its application of Mycoplasma bovis and infectious bovine rhinotrachetis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106868215B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107447056A (en) * | 2017-09-29 | 2017-12-08 | 广西壮族自治区兽医研究所 | For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis |
| CN114634996A (en) * | 2022-02-28 | 2022-06-17 | 广东海大畜牧兽医研究院有限公司 | Primer-probe combination for detecting bovine respiratory diseases, kit and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030054356A1 (en) * | 2000-09-21 | 2003-03-20 | Jacobson James W. | Multiple reporter read-out for bioassays |
| US20110129479A1 (en) * | 2009-12-02 | 2011-06-02 | Tobin Monte B | Immunogen selection directed in immunoglobulin packages in plasma and colostrum and method of making and using same |
-
2017
- 2017-03-22 CN CN201710173760.6A patent/CN106868215B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030054356A1 (en) * | 2000-09-21 | 2003-03-20 | Jacobson James W. | Multiple reporter read-out for bioassays |
| US20110129479A1 (en) * | 2009-12-02 | 2011-06-02 | Tobin Monte B | Immunogen selection directed in immunoglobulin packages in plasma and colostrum and method of making and using same |
Non-Patent Citations (2)
| Title |
|---|
| 肖淦文: "牛支原体肺炎混合感染细菌学调查及多重PCR检测方法的建立", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 郭利 等: "牛呼吸道疾病综合征相关病毒BVDV、BPIV3、IBRV和BRSV多重PCR检测方法的建立", 《特产研究》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107447056A (en) * | 2017-09-29 | 2017-12-08 | 广西壮族自治区兽医研究所 | For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis |
| CN107447056B (en) * | 2017-09-29 | 2020-10-20 | 广西壮族自治区兽医研究所 | Complete set of primers for identifying mycoplasma bovis and infectious rhinotracheitis and application thereof |
| CN114634996A (en) * | 2022-02-28 | 2022-06-17 | 广东海大畜牧兽医研究院有限公司 | Primer-probe combination for detecting bovine respiratory diseases, kit and application thereof |
| CN114634996B (en) * | 2022-02-28 | 2024-05-07 | 广东海大畜牧兽医研究院有限公司 | Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106868215B (en) | 2019-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399590B (en) | Universal nucleic acid isothermal detection reagent for respiratory tract infection related adenovirus | |
| CN103160615B (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| CN108531629A (en) | A kind of PCR amplification primer of quick detection Friedlander's bacillus and its application | |
| CN101624636A (en) | LAMP-LFD detection method of infectious spleen and kidney necrosis virus (ISKNV) | |
| CN106978511A (en) | A kind of method for detecting feline herpetovirus | |
| CN108950068A (en) | A kind of avian infectious bronchitis virus QX type strain identification detection kit | |
| CN107988340A (en) | A kind of PCR amplification primer of quick detection mycoplasma ovine pneumoniae and its application | |
| CN106868215B (en) | For identifying the primer sets and its application of Mycoplasma bovis and infectious bovine rhinotrachetis virus | |
| CN106754911A (en) | Primer sets and its application for identifying Mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotrachetis virus | |
| CN110438260A (en) | A kind of African swine fever virus nucleic acid test strips detection kit | |
| CN113174446A (en) | One-step double RT-PCR detection method for bovine viral diarrhea virus typing | |
| CN107881259A (en) | A kind of pcr amplification primer thing of quick detection infectious bovine rhinotrachetis virus and its application | |
| CN110643740B (en) | Real-time fluorescent quantitative RT-PCR detection primer, probe and detection kit for Pariemam serogroup virus | |
| CN108384893A (en) | Real-time fluorescence quantitative RT-PCR kit for detecting foot and mouth disease virus and Sai Nika paddy viruses and its application | |
| CN112210619A (en) | Primer pair for detecting Erjiangqi yeast and application thereof | |
| CN101875974A (en) | Primer group for detecting Bordetella pertussis, detection test kit and detection method | |
| CN104004842A (en) | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals | |
| CN103276104A (en) | RT-LAMP nucleic acid test strip kit for detection of porcine reproductive and respiratory syndrome virus, and applications | |
| CN104975077B (en) | Pig source eperythrozoon fluorescent quantificationally PCR detecting kit and its application | |
| CN112359148B (en) | PCR primer group for rapidly detecting three fish viruses and application thereof | |
| CN113265488B (en) | RPA-LFD primer, probe and kit for jointly detecting epidemic hemorrhagic disease virus and palieimia serogroup virus | |
| CN113755565B (en) | Quadruple quantitative fluorescent probe primer combination, kit and identification method for identifying wild strain and vaccine strain of African swine fever | |
| CN115094164A (en) | Multiple qPCR (quantitative polymerase chain reaction) kit and detection method for ASFV (advanced specific immunodeficiency syndrome) with different gene deletion types | |
| CN106834285A (en) | Primer sets and its application for identifying Mycoplasma bovis and bovine viral diarrhea virus | |
| CN107447056A (en) | For differentiating primer set and its application of Mycoplasma bovis and infectious bovine rhinotracheitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |