CN106866818A - The proteineus yolk antibody of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis and its preparation technology and application - Google Patents
The proteineus yolk antibody of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis and its preparation technology and application Download PDFInfo
- Publication number
- CN106866818A CN106866818A CN201710256369.2A CN201710256369A CN106866818A CN 106866818 A CN106866818 A CN 106866818A CN 201710256369 A CN201710256369 A CN 201710256369A CN 106866818 A CN106866818 A CN 106866818A
- Authority
- CN
- China
- Prior art keywords
- pira
- pirb
- immune
- seq
- yolk
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
- C07K16/1239—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Vibrionaceae (G)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/02—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies from eggs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/35—Valency
Abstract
Proteineus yolk antibody and its preparation technology and application the present invention relates to the acute Hepatopancreatic necrosis syndrome of immunodiagnosis, the Yolk antibody is using pirA and pirB albumen as antigen immune egg-laying bird, and extracted from the yolk of its ovum, can be combined with pirA the and pirB protein-specifics.The proteineus yolk antibody that the present invention is prepared has good active and specificity, with good stability and resistance to hypertonicity, the features such as preparation method of the invention has high efficiency, safety, low cost, environmental protection and efficiently prevents simultaneously, for the preventing and treating and detection of acute Hepatopancreatic necrosis syndrome provide effective way.
Description
Technical field
The invention belongs to bioengineering and aquatic products epidemic disease detection technique field, and in particular to one kind resists acute Hepatopancreatic necrosis
Syndrome Toxin proteineus yolk antibody, its preparation method and application.
Background technology
Since two thousand nine, Deaths syndrome (EMS), also known as acute Hepatopancreatic necrosis syndrome (AHPNS) to Asia
The prawn culturing industry of continent, particularly Southeast Asia and China causes unprecedented impact.In addition to the extensive underproduction, the disease
Disease also brings many negative issues, for example：The prawn culturing problem of employment, social welfare problem, prawn supply and demand problem and the whole world
Prawn average price problem etc..
In May, 2013, it is comprehensive that Arizona, USA university aquatic products Pathology Lab (UAZ-APL) defines acute Hepatopancreatic necrosis
It is the specific strain of vibrio parahaemolytious to close disease (AHPNS) cause of disease, and the bacterial strain can produce toxin and induce healthy prawn to cause a disease.
2014, worldwide generally confirm the cause of disease of current APHND with expressed by the toxin plasmid entrained by vibrio parahaemolytious
Two kinds of toxin of PirA and PirB it is related.
Diagnosis currently for the disease concentrates on the genetic test of contratoxin plasmid.A kind of business has been occurred in that at this stage
The gene detecting kit of change and three kinds of different primers drawn by basic research design the diagnostic method for obtaining.
The A of CN 103667498 disclose the detection method of vibrio parahemolyticus.Methods described is examined for vibrio parahemolyticus
The specific primer of survey is that a pair of peripheries according to designed by the conservative region of vibrio parahemolyticus species-specific genes tlh are drawn
Thing, a pair of cross primer and a pair of specificity detection probes；Vibrio parahemolyticus species-specific genes tlh is coding parahemolyticas
The virulence gene of the thermo-labile hemotoxin TLH of vibrios.Detection method：The extraction of vibrio parahemolyticus template DNA；Peripheral primer
Checking；The foundation of cross primer isothermal amplification reactions system；Cross primer constant-temperature amplification program；The detection of amplified production.CN
102747148 A disclose a kind of vibrio parahemolyticus detection primer sets, including following primer：F3 primers：
GACGTACCATGTACTAGATC；B3 primers：GCCATCACTAGCCATAGCG；FIP primers：
CGATCGCCAGCATGCGCGGCATGTCTATTGGTGAGAGGTCTTG；BIP primers：
CATGATTTCAATGACGTCCCATTCTGAACCCAAAATCCGGGC.The invention is also provided one kind and is detected using above-mentioned primer sets
The method of vibrio parahemolyticus.
The weak point that diagnostic method at this stage is present is main at three aspects：(1) gene diagnosis need PCR instrument device with
And the operating process of complexity, and the time typically more than hour, be unfavorable for the quick diagnosis of basic unit and scene to epidemic situation at 4.
And the diagnostic method also product without commercialization at home at present, three kinds of gene testers in global range are by state
Outer offer, one of which has obtained commercialization.(2) gene diagnosis can only detect whether there is toxin expressing gene, can not examine
Break and whether toxin is expressed.And acute Hepatopancreatic necrosis syndrome obtain basic reason be expression toxin protein to body
Damage, therefore only detection toxin protein could more accurately judge the outburst of epidemic disease, reduce false positive.(3) current gene
Diagnostic techniques only has 95% accuracy, need further raising.
The content of the invention
It is an object of the invention to provide the proteineus yolk antibody and its system of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis
Standby technique and application.Pioneering immune examine can be provided to the preventing and treating of acute this kind of disease of Hepatopancreatic necrosis syndrome and detection
Disconnected technology.
To reach the purpose of this invention, the present invention uses following technical scheme：
In a first aspect, resist acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody the invention provides one kind, with
PirA and pirB albumen is extracted as antigen immune egg-laying bird from its yolk, can be with pirA the and pirB albumen
Specific binding.
PirA and pirB albumen of the invention can be obtained by being expressed in appropriate host, it is also possible to by conventional peptide
Synthetic technology chemical synthesis is obtained, and preferably expresses obtaining in appropriate host.
In the present invention, described pirA and pirB as a kind of toxin protein, by genetic engineering means from secondary haemolysis arc
Obtained in bacterium, the albumen of specific antibody can be produced as a species specificity, the antibody that it is produced has anti-acute hepatopancrease bad
Dead syndrome, compared to directly antibody is produced with vibrio parahaemolytious direct immunization, with resisting that pirA and pirB protein immunizations are produced
Body, selectivity is stronger, and effect is more preferable；In addition, the Yolk antibody for being produced by the immune egg-laying birds of pirA and pirB, is compared
In other antibody, resistance is stronger, in hgher efficiency.
Preferably, the pirA albumen contains 111 amino acid.
Preferably, the amino acid sequence of the pirA albumen includes the fragment as shown in SEQ ID NO.1, and the sequence is such as
Under：
Preferably, the pirB albumen contains 438 amino acid.
Preferably, the amino acid sequence of the pirB albumen includes the fragment as shown in SEQ ID NO.2, and the sequence is such as
Under：
Second aspect, the present invention also provides a kind of anti-acute Hepatopancreatic necrosis Syndrome Toxin egg as described in relation to the first aspect
The preparation method of light yolk antibody, the described method comprises the following steps：
(1) pirA the and pirB proteantigens are prepared；
(2) pirA the and pirB proteantigens and adjuvant are used, injecting immune is carried out to egg-laying bird, search immune fowl
The immune egg that class is produced；
(3) yolk of the immune egg is taken, IgY Yolk antibodies are isolated and purified.
Preferably, the step (1) specifically includes：
A () obtains the gene order of the pirA and pirB by PCR amplification techniques, and by the gene sequence of pirA and pirB
Row are recombinated in expression vector, build recombinant vector；Specifically, the pcr amplification primer thing SEQ ID of pirA gene orders are used
The pcr amplification primer thing SEQ ID NO.5-6 of NO.3-4 and pirB gene orders, are mould with the plasmid in the vibrio parahaemolytious extracted
Plate, enters the gene order that performing PCR amplification obtains the pirB shown in pirA the and SEQ ID NO.8 shown in SEQ ID NO.7, then will
Above-mentioned sequence is recombinated in expression vector, can be pET-28a (+) carrier；
B be transformed into recombinant vector in clone bacterium by (), positive transformants of the screening containing pirA the and pirB gene orders
Bacterium；Specifically, clone bacterium can be DH5 α Escherichia coli etc., and screening can be screened by methods such as X-Gal and contain the pirA
With the positive transformants bacterium of pirB gene orders；
C () extracts the recombinant vector from the positive transformants bacterium, and be transformed into expression bacterium, obtains containing described
The positive expression bacterium of pirA and pirB gene orders, to the positive expression bacterium Amplification Culture, induces pirA the and pirB eggs
White expression；Specifically, expression bacterium can be BL21 Escherichia coli etc., induction can by the methods such as IPTG induce the pirA and
PirB protein expressions；
D () isolates and purifies pirA the and pirB albumen, specifically, can be by the side such as Ni-NTA post affinitive layer purifications
Formula isolates and purifies pirA the and pirB albumen.
Preferably, the primer of the PCR amplifications is：
Wherein, the pcr amplification primer thing of the pirA gene orders is：
Sense primer：5 '-CGCGGATCC ATGAGTAACAATATAAAACATGAAAC-3 ' (SEQ ID NO.3),
Anti-sense primer：5’-CCCGCGGCCGC TTAGTGGTAATAGATTGTACAGAAA-3’(SEQ ID NO.4).
Wherein, the pcr amplification primer thing of the pirB gene orders is：
Sense primer：5 '-CGCGGATCC ATGACTAACGAATACGTTGTAACAA-3 ' (SEQ ID NO.5),
Anti-sense primer：5’-CCCGCGGCCGC CTACTTTTCTGTACCAAATTCATCG-3’(SEQ ID NO.6).
Preferably, the PCR annealing temperatures are 57-58 DEG C.
Preferably, the method for step (2) described immunization laying hen be by pirA after purification and the recombinant antigen of pirB with
Freund's adjuvant presses 1:1 mixing and emulsifying 3-5h, carries out the immune egg-laying bird of 4 intramuscular injection.
Preferably, the injecting immune is carried out five times, and the second week after third time is immune starts to collect egg, and determines anti-
Body potency, specifically, after first time is immune carried out second every two weeks and is immunized, then third time was carried out every two weeks to be immunized, every one
The 4th time is carried out after month to be immunized, and the 5th time was finally carried out every 40 days and is immunized；Diluted by distilled water and ammonium sulfate, Ran Houchen
The method such as form sediment and dialyse extracts the IgY, finally the antibody IgY with SDS-PAGE and Wester bolt electrophoresis detections after purification
Purity, with the titre of Dot blot detection antibodies, and the potency of IgY is detected with indirect competitive ELISA.
Preferably, the preparation method is comprised the following steps：
(1) pirA the and pirB proteantigens are prepared, is comprised the following steps that：
A () obtains the gene order of the pirA and pirB by PCR amplification techniques, and by the gene sequence of pirA and pirB
Row are recombinated in expression vector, build recombinant vector；
Wherein, the pcr amplification primer thing of the pirA gene orders is：Sense primer as shown in SEQ ID NO.3, draw by downstream
Thing is as shown in SEQ ID NO.4；
Wherein, the pcr amplification primer thing of the pirB gene orders is：Sense primer as shown in SEQ ID NO.5, draw by downstream
Thing is as shown in SEQ ID NO.6；
B recombinant vector is transformed into clone's strain, positive transformants of the screening containing pirA the and pirB gene orders by ()
Bacterium；
C () extracts the recombinant vector from the positive transformants bacterium, and be transformed into expression bacterium, obtains containing described
The positive expression bacterium of pirA and pirB gene orders, to the positive expression bacterium Amplification Culture, induces pirA the and pirB eggs
White expression；
D () isolates and purifies pirA the and pirB albumen；
(2) pirA the and pirB proteantigens and adjuvant are used, injecting immune is carried out to egg-laying bird, search immune fowl
The immune egg that class is produced, comprises the following steps that：
The method of the immunization laying hen is by 1 by pirA after purification and the recombinant antigen of pirB with adjuvant:1 mixing breast
Change 3-5h, carry out the immune egg-laying bird of 4 intramuscular injection；
Wherein, the injecting immune is carried out five times, and the second week after third time is immune starts to collect egg, and determines antibody
Potency；
(3) yolk of the immune egg is taken, IgY Yolk antibodies are isolated and purified.
According to the present invention, the preparation method use of the anti-acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody
It is the conventional method of this area.
The third aspect, the present invention provides a kind of anti-acute Hepatopancreatic necrosis Syndrome Toxin albumen as described in relation to the first aspect
Application of the Yolk antibody in the medicine and/or reagent that resist acute Hepatopancreatic necrosis syndrome is prepared；
Preferably, the syndrome is the acute Hepatopancreatic necrosis syndrome of anti-prawn.
Fourth aspect, the present invention provides a kind of detection kit, it is characterised in that the kit is comprising such as first aspect
Described anti-acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody.
Compared with prior art, the present invention has the advantages that：
The present invention is by preparing pirA and pirB proteantigens；Using pirA the and pirB proteantigens, to egg fowl
Class carries out injecting immune；Then from the yolk of the immune egg, extract and resist acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk
Antibody.Immune diagnostic technique of the invention is the first among the whole country, and the proteineus yolk antibody for preparing has good active and spy
The opposite sex, with good stability and resistance to hypertonicity, while preparation method is a kind of brand-new high efficiency, safety, low cost, ring
The features such as protecting and efficiently prevent, for the preventing and treating and detection of acute Hepatopancreatic necrosis syndrome provide creative new departure.
Specific embodiment
Further to illustrate technological means and its effect that the present invention is taken, it is preferable to carry out below in conjunction with of the invention
Example further illustrates technical scheme, but the present invention is not limited in scope of embodiments.
In the examples where no specific technique or condition is specified, according to the technology or condition described by document in the art,
Or carried out according to product description.Agents useful for same or the unreceipted production firm person of instrument, be can be by regular channel commercially available from
The conventional products of acquisition.
Embodiment 1：Prepare pirA and pirB albumen
(1) clone of vibrio parahemolyticus pirA and pirB genes, the structure of expression vector and identification
The primers of (a) according to vibrio parahemolyticus pirA and pirB gene：
The pcr amplification primer thing of pirA gene orders is：
Sense primer：5’-CGCGGATCCATGAGTAACAATATAAAACATGAAAC-3 ' (SEQ ID NO.3), wherein
Underscore part is BamH I restriction enzyme sites；
Anti-sense primer：5’-CCCGCGGCCGCTTAGTGGTAATAGATTGTACAGAAA-3 ' (SEQ ID NO.4), its
Middle underscore part is Not I restriction enzyme sites.
The pcr amplification primer thing of pirB gene orders is：
Sense primer：5’-CGCGGATCCATGACTAACGAATACGTTGTAACAA-3 ' (SEQ ID NO.5), wherein
Underscore part is BamH I restriction enzyme sites；
Anti-sense primer：5’-CCCGCGGCCGCCTACTTTTCTGTACCAAATTCATCG-3 ' (SEQ ID NO.6), its
Middle underscore part is Not I restriction enzyme sites.
It is the plasmid of alkaline lysis method of extracting vibrio parahemolyticus using conventional a small amount of DNA of bacteria extracting method.
PCR is expanded：Enter performing PCR as template with the plasmid for extracting to expand, reaction system is as follows：
One group of negative control with water as sample is set.
Reaction condition is as follows：
Obtained PCR primer carries out 1.2% agarose gel electrophoresis identification blend compounds QIAquick Gel Extraction Kit (QIAquick
Gel Extraction) purifying.It is attached with reference to specification system using TAKARA pMD18-T kit.
B () is verified, pirA the and pirB gene orders that will be obtained are converted and cloned checking；Specifically, the conversion
To take during 10ul connection products add to 100ul DH5 α competent cells, 30min, 42 DEG C of heat shock 30s are placed on ice, immediately on ice
Cooling 2min.Add 890ul LB culture mediums.37 DEG C of culture 1h.
Cloned using blue hickie preliminary screening, take after 40ul X-Gal and 8ul IPTG are well mixed and coat ammonia benzyl resistance
On culture medium, drying is stored at room temperature, 100ul conversion culture bacterium nights, 37 DEG C of incubated overnights are coated with thereon.
Specifically, the PCR checkings M13 primers, to entering performing PCR through the clear, colorless single bacterium colony after incubated overnight, specifically
It is as follows：
The single bacterium colony of the pre-selection on mark flat board, 10ul sterile deionized waters are resuspended in pipette tips successively picking single bacterium colony
In, boiling water 10min treatment.12000g is centrifuged 1min, takes supernatant for template, and PCR system is as follows：
One group of negative control with water as sample is set.
Reaction condition is as follows：
The digestion using by the bacterium night of incubated overnight using kit extraction method plasmid purification, electrophoresis detection without
Double digestion is carried out after by mistake, digestion system is as follows：
While digestion Pet28a plasmids, used as negative control, digestion temperature is 37 DEG C, time 1h.Obtained digestion products
The Ago-Gel for carrying out 1.2% reclaims purpose band.
B () is (public purchased from TAKARA to expression vector body pET-28a (+) by connection product restructuring by homologous recombination method
Department) in, build recombinant vector；The recombinant vector is transformed into clone bacterium DH5 α Escherichia coli, screening contains the pirA
With the positive transformants bacterium of pirB gene orders；Tool screening can be screened by methods such as X-Gal and contain pirA the and pirB bases
Because of the positive transformants bacterium of sequence；
Specifically, the purpose fragment and carrier being recovered in will be above-mentioned are attached.Enzyme system is connected using TAKARAT4
It is as follows：
Connection product is transformed into DH5 α competence as stated above, and is cultivated in LB (Kan+) flat board, 37 DEG C of mistakes
Night, picking single bacterium colony enters performing PCR identification.
C () extracts the recombinant vector, PCR checkings and digestion verification from the positive transformants bacterium, verify genetic fragment
Size, it was demonstrated that the sequence that PCR is obtained is correct.The recombinant vector that the sequencing is justified is transformed into expression bacterium BL21 large intestines
In bacillus, the positive expression bacterium containing pirA the and pirB gene orders is obtained；
Specifically, 37 DEG C of the single bacterium colony of picking 6 incubated overnight.By the bacterium solution of incubated overnight with 1:100 ratio adds 5ml
In Amp+LB culture mediums, 37 DEG C of 220rpm cultivate 2h.1ml bacterium solutions are taken out as control is not induced, remaining is added according to volume
IPTG to final concentration of 0.4mM, 37 DEG C of 180rp cultivate 4h.1ml bacterium solutions 12000g centrifugation 10min are taken, supernatant is abandoned, is gone with 100ul
The resuspended precipitation of ionized water, adds isometric 2 × SDS loadingbuffer, boiling water bath 10min, takes supernatant 12%SDS-
PAGE electrophoresis detections.
Successful bacterial strain Amplification Culture and induction will be after testing induced, by the bacterium solution 1 of incubated overnight:100 are diluted to 200ml
In fresh LB, it is induced according to above-mentioned inductive condition.
10min, collects thalline is centrifuged through the bacterium solution 12000g after induction.With the resuspended bacterium of the lysis buffer of 1/10 volume
Body, ultrasonication controls power 200W, and condition of work is ultrasound 4s pauses 10s 90 times, is lowered the temperature with ice bath, is repeated 3 times with thorough
Bottom crushes bacterium.After the bacterium solution 12000g centrifugations 10min that will be processed through ultrasonication, supernatant precipitation is taken respectively through 12%SDS-
PAGE verifies protein expression mode.
D () isolates and purifies pirA the and pirB albumen, specifically, can be by the side such as Ni-NTA post affinitive layer purifications
Formula isolates and purifies pirA the and pirB albumen.
Specifically, can be using Ni-NTA affinity chromatographys prepacked column (the NiSepharose High of GE companies
Performance) according to product description purifying destination protein pirA and pirB.In experiment, with the linear flow of 50-100cm/h
Speed distillation 5 column volumes of washing, balance pillar, then with the linear flow rate of 150cm/h with 6 combination buffers of column volume
Pretreated sample is added, is washed with buffer solution, baseline is reached until absorbing.Washed with elution buffer using progressively elution method
It is de-, collect each stage sample, SDS-PAGE detection protein purification effects.
Embodiment 2：Immune Laying Hens
It is immune, pirA and pirB albumen is mixed as antigen with isometric Fei Shi adjuvants, using subcutaneous multi-point injection
Immune Laying Hens；
Specifically, determine the concentration of toxin protein after purification, with PBS by the concentration of recombinant protein after purification adjust to
0.01~0.1mg/ml, by the recombinant protein after adjustment and adjuvant according to 1:1 ratio mix after distinctive five times according to company
The immune mode Immune Laying Hens of two approach.For the first time be immunized for 1ml recombinant proteins and 1ml Freund's complete adjuvants be sufficiently mixed it is laggard
The 4 points of injections of row chest muscle, chest muscle four is carried out after being sufficiently mixed with 0.5ml recombinant proteins and 0.5ml incomplete Freund's adjuvants after two weeks
Point injecting immune.Operated more than being repeated again after two weeks, but immune accumulated dose is changed to 1.5ml.Be immunized for 4th time for one month with
Afterwards, wing venous injecting immune is carried out after being sufficiently mixed using 0.75ml recombinant proteins and 0.5ml incomplete Freund's adjuvants.After 40 days
Operated more than repeating.So far five immune completions altogether.；The immune end of third time starts to collect egg extraction purification after 7 days
IgY。
Embodiment 3：Extract and resist acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody
(1) initial gross separation of Yolk antibody：The acidifying water buffer solution of yolk liquid and Acetic acid-sodium acetate is pressed 1：10 mixing, 4
Degree stands overnight, 10000g centrifugation 20min, stays supernatant.Saturated ammonium sulfate to final concentration of 35% is slowly added to, 4 degree stand extremely
Substantially layering.Mixed liquor 10000g is centrifuged 20min, goes supernatant, precipitation 30ml PBS to dissolve.It is slowly added to saturated ammonium sulfate
To final concentration of 35%, 4 degree stand to substantially layering.10000g is centrifuged 20min, removes supernatant, and precipitation is dissolved with PBS；
(2) immunoaffinity chromatography of anti-PEDV special yolk antibodies：The Pri toxin proteins and HiTrap for obtaining will be recombinated
It is coupled, is prepared affinity column.Yolk antibody slightly is carried through Pri toxin protein affinity chromatographys by what step (1) was obtained
Post crosses post with the speed of 1ml/min, and the special yolk that the anti-Pri toxin proteins hung on post are finally washed down with eluent resists
Body, is precipitated with the resuspended antibody of PBS after centrifugation and obtains anti-Pri toxin proteins special yolk antibody liquid.
Embodiment 4：The purity of proteineus yolk antibody and titration
(1) with 1:100 ratio determines solution protein liquid concentration after being diluted with 0.01M PBS；
Specifically, returned to zero with PBS, protein content is surveyed with ultraviolet specrophotometer, as follows：Protein content (mg/
Ml)=(1.45 × OD280-0.74 × OD260) × sample dilution, calculates protein content.It is pure with SDS-PAGE electrophoresis detections
Change antibody IgY, collection of illustrative plates is presented single band.
(2) potency of IgY is detected with indirect competitive ELISA；
Specifically, the potency of IgY is 1:12500-1:48300
Embodiment 5：External suppression of the proteineus yolk antibody to acute Hepatopancreatic necrosis syndrome
6 test tubes equipped with 10mL fluid nutrient mediums are taken, individual addition 1mL indicates bacteria suspension, make bacterial concentration be 106- 7Cfu/mL, 5 test tubes thereto are separately added into the IgY of 1mL various concentrations, make antibody final concentration respectively 1mg/mL,
5mg/mL, 6mg/mL, 8mg/mL and 10mg/mL, remaining one used as control, the PBS for adding 1mg/mL aseptic.By 6 examinations
Pipe is placed in 37 DEG C of insulating boxs and always cultivates, and takes nutrient solution in 1h, 3h and 5h respectively, and viable count is calculated with dilution-plate method.
Result shows that the proteineus yolk antibody IgY of preparation has when concentration reaches 6mg/mL to vibrio parahaemolytious
Obvious growth inhibition effect.
Applicant states that the present invention illustrates method detailed of the invention by above-described embodiment, but the present invention not office
It is limited to above-mentioned method detailed, that is, does not mean that the present invention has to rely on above-mentioned method detailed and could implement.Art
Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention
Addition, selection of concrete mode etc., within the scope of all falling within protection scope of the present invention and disclosing.
SEQUENCE LISTING
<110>Bao Shuntai scientific and technological industrys limited company of Shenzhen
<120>The proteineus yolk antibody of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis and its preparation technology and application
<130> 2015
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 111
<212> PRT
<213>Artificial sequence
<400> 1
Met Ser Asn Asn Ile Lys His Glu Thr Asp Tyr Ser His Asp Trp Thr
1 5 10 15
Val Glu Pro Asn Gly Gly Val Thr Glu Val Asp Ser Lys His Thr Pro
20 25 30
Ile Ile Pro Glu Val Gly Arg Ser Val Asp Ile Glu Asn Thr Gly Arg
35 40 45
Gly Glu Leu Thr Ile Gln Tyr Gln Trp Gly Ala Pro Phe Met Ala Gly
50 55 60
Gly Trp Lys Val Ala Lys Ser His Val Val Gln Arg Asp Glu Thr Tyr
65 70 75 80
His Leu Gln Arg Pro Asp Asn Ala Phe Tyr His Gln Arg Ile Val Val
85 90 95
Ile Asn Asn Gly Ala Ser Arg Gly Phe Cys Thr Ile Tyr Tyr His
100 105 110
<210> 2
<211> 438
<212> PRT
<213>Artificial sequence
<400> 2
Met Thr Asn Glu Tyr Val Val Thr Met Ser Ser Leu Thr Glu Phe Asn
1 5 10 15
Pro Asn Asn Ala Arg Lys Ser Tyr Leu Phe Asp Asn Tyr Glu Val Asp
20 25 30
Pro Asn Tyr Ala Phe Lys Ala Met Val Ser Phe Gly Leu Ser Asn Ile
35 40 45
Pro Tyr Ala Gly Gly Phe Leu Ser Thr Leu Trp Asn Ile Phe Trp Pro
50 55 60
Asn Thr Pro Asn Glu Pro Asp Ile Glu Asn Ile Trp Glu Gln Leu Arg
65 70 75 80
Asp Arg Ile Gln Asp Leu Val Asp Glu Ser Ile Ile Asp Ala Ile Asn
85 90 95
Gly Ile Leu Asp Ser Lys Ile Lys Glu Thr Arg Asp Lys Ile Gln Asp
100 105 110
Ile Asn Glu Thr Ile Glu Asn Phe Gly Tyr Ala Ala Ala Lys Asp Asp
115 120 125
Tyr Ile Gly Leu Val Thr His Tyr Leu Ile Gly Leu Glu Glu Asn Phe
130 135 140
Lys Arg Glu Leu Asp Gly Asp Glu Trp Leu Gly Tyr Ala Ile Leu Pro
145 150 155 160
Leu Leu Ala Thr Thr Val Ser Leu Gln Ile Thr Tyr Met Ala Cys Gly
165 170 175
Leu Asp Tyr Lys Asp Glu Phe Gly Phe Thr Asp Ser Asp Val His Lys
180 185 190
Leu Thr Arg Asn Ile Asp Lys Leu Tyr Asp Asp Val Ser Ser Tyr Ile
195 200 205
Thr Glu Leu Ala Ala Trp Ala Asp Asn Asp Ser Tyr Asn Asn Ala Asn
210 215 220
Gln Asp Asn Val Tyr Asp Glu Val Met Gly Ala Arg Ser Trp Cys Thr
225 230 235 240
Val His Gly Phe Glu His Met Leu Ile Trp Gln Lys Ile Lys Glu Leu
245 250 255
Lys Lys Val Asp Val Phe Val His Ser Asn Leu Ile Ser Tyr Ser Pro
260 265 270
Ala Val Gly Phe Pro Ser Gly Asn Phe Asn Tyr Ile Ala Thr Gly Thr
275 280 285
Glu Asp Glu Ile Pro Gln Pro Leu Lys Pro Asn Met Phe Gly Glu Arg
290 295 300
Arg Asn Arg Ile Val Lys Ile Glu Ser Trp Asn Ser Ile Glu Ile His
305 310 315 320
Tyr Tyr Asn Arg Val Gly Arg Leu Lys Leu Thr Tyr Glu Asn Gly Glu
325 330 335
Val Val Glu Leu Gly Lys Ala His Lys Tyr Asp Glu His Tyr Gln Ser
340 345 350
Ile Glu Leu Asn Gly Ala Tyr Ile Lys Tyr Val Asp Val Ile Ala Asn
355 360 365
Gly Pro Glu Ala Ile Asp Arg Ile Val Phe His Phe Ser Asp Asp Arg
370 375 380
Thr Phe Val Val Gly Glu Asn Ser Gly Lys Pro Ser Val Arg Leu Gln
385 390 395 400
Leu Glu Gly His Phe Ile Cys Gly Met Leu Ala Asp Gln Glu Gly Ser
405 410 415
Asp Lys Val Ala Ala Phe Ser Val Ala Tyr Glu Leu Phe His Pro Asp
420 425 430
Glu Phe Gly Thr Glu Lys
435
<210> 3
<211> 35
<212> DNA
<213>Artificial sequence
<400> 3
cgcggatcca tgagtaacaa tataaaacat gaaac 35
<210> 4
<211> 36
<212> DNA
<213>Artificial sequence
<400> 4
cccgcggccg cttagtggta atagattgta cagaaa 36
<210> 5
<211> 34
<212> DNA
<213>Artificial sequence
<400> 5
cgcggatcca tgactaacga atacgttgta acaa 34
<210> 6
<211> 36
<212> DNA
<213>Artificial sequence
<400> 6
cccgcggccg cctacttttc tgtaccaaat tcatcg 36
Claims (10)
1. it is a kind of to resist acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody, it is characterised in that with pirA and pirB albumen
As antigen immune egg-laying bird, and extracted from its yolk, it is combined with pirA the and pirB protein-specifics.
2. Yolk antibody according to claim 1, it is characterised in that the amino acid sequence of the pirA albumen is comprising such as
Fragment shown in SEQ ID NO.1.
3. Yolk antibody according to claim 1 and 2, it is characterised in that the amino acid sequence of the pirB albumen is included
Fragment as shown in SEQ ID NO.2.
4. the system of a kind of anti-acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody as described in claim any one of 1-3
Preparation Method, it is characterised in that the described method comprises the following steps：
(1) pirA the and pirB proteantigens are prepared；
(2) pirA the and pirB proteantigens and adjuvant are used, injecting immune is carried out to egg-laying bird, search Immunizing Birds institute
The immune egg for producing；
(3) yolk of the immune egg is taken, IgY Yolk antibodies are isolated and purified.
5. preparation method according to claim 4, it is characterised in that the step (1) specifically includes：
A () obtains the gene order of the pirA and pirB by PCR amplification techniques, and by the gene order weight of pirA and pirB
Group builds recombinant vector in expression vector；
B recombinant vector is transformed into clone's strain, positive transformants bacterium of the screening containing pirA the and pirB gene orders by ()；
C () extracts the recombinant vector from the positive transformants bacterium, and be transformed into expression bacterium, obtain containing the pirA with
The positive expression bacterium of pirB gene orders, to the positive expression bacterium Amplification Culture, induces pirA the and pirB protein expressions；
D () isolates and purifies pirA the and pirB albumen.
6. preparation method according to claim 5, it is characterised in that the primer of the PCR amplifications is：
Wherein, the pcr amplification primer thing of the pirA gene orders is：
As shown in SEQ ID NO.3, anti-sense primer is as shown in SEQ ID NO.4 for sense primer；
Wherein, the pcr amplification primer thing of the pirB gene orders is：
As shown in SEQ ID NO.5, anti-sense primer is as shown in SEQ ID NO.6 for sense primer；
Preferably, the PCR annealing temperatures are 57-58 DEG C.
7. the preparation method according to any one of claim 4-6, it is characterised in that step (2) described immunization laying hen
Method be by 1 by pirA after purification and the recombinant antigen of pirB with adjuvant:1 mixing and emulsifying 3-5h, carries out 4 muscle notes
Penetrate immune egg-laying bird；
Preferably, the injecting immune is carried out five times, and the second week after third time is immune starts to collect egg, and determines antibody effect
Valency.
8. the preparation method according to any one of claim 4-7, it is characterised in that the described method comprises the following steps：
(1) pirA the and pirB proteantigens are prepared, is comprised the following steps that：
A () obtains the gene order of the pirA and pirB by PCR amplification techniques, and by the gene order weight of pirA and pirB
Group builds recombinant vector in expression vector；
Wherein, the pcr amplification primer thing of the pirA gene orders is：As shown in SEQ ID NO.3, anti-sense primer is such as sense primer
Shown in SEQ ID NO.4；
Wherein, the pcr amplification primer thing of the pirB gene orders is：As shown in SEQ ID NO.5, anti-sense primer is such as sense primer
Shown in SEQ ID NO.6；
B recombinant vector is transformed into clone's strain, positive transformants bacterium of the screening containing pirA the and pirB gene orders by ()；
C () extracts the recombinant vector from the positive transformants bacterium, and be transformed into expression bacterium, obtain containing the pirA with
The positive expression bacterium of pirB gene orders, to the positive expression bacterium Amplification Culture, induces pirA the and pirB protein expressions；
D () isolates and purifies pirA the and pirB albumen；
(2) pirA the and pirB proteantigens and adjuvant are used, injecting immune is carried out to egg-laying bird, search Immunizing Birds institute
The immune egg for producing, comprises the following steps that：
The method of the immunization laying hen is by 1 by pirA after purification and the recombinant antigen of pirB with adjuvant:1 mixing and emulsifying 3-
5h, carries out the immune egg-laying bird of 4 intramuscular injection；
Wherein, the injecting immune is carried out five times, and the second week after third time is immune starts to collect egg, and determines antibody effect
Valency；
(3) yolk of the immune egg is taken, IgY Yolk antibodies are isolated and purified.
9. a kind of anti-acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody as any one of claim 1-3 exists
Prepare the application in the medicine and/or reagent that resist acute Hepatopancreatic necrosis syndrome；
Preferably, the syndrome is the acute Hepatopancreatic necrosis syndrome of prawn.
10. a kind of detection kit, it is characterised in that the kit includes resisting as any one of claim 1-3
Acute Hepatopancreatic necrosis Syndrome Toxin proteineus yolk antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710256369.2A CN106866818A (en) | 2017-04-19 | 2017-04-19 | The proteineus yolk antibody of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis and its preparation technology and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710256369.2A CN106866818A (en) | 2017-04-19 | 2017-04-19 | The proteineus yolk antibody of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis and its preparation technology and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106866818A true CN106866818A (en) | 2017-06-20 |
Family
ID=59163792
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710256369.2A Pending CN106866818A (en) | 2017-04-19 | 2017-04-19 | The proteineus yolk antibody of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis and its preparation technology and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106866818A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108948190A (en) * | 2018-06-07 | 2018-12-07 | 天津市水产技术推广站 | The monoclonal antibody E of prawn hepatopancrease cause of disease toxin protein PirA and application |
| CN109182364A (en) * | 2018-08-30 | 2019-01-11 | 武汉百意欣生物技术有限公司 | A kind of polyclonal antibody and its preparation method and application of specific recognition albumin A |
| CN109369804A (en) * | 2018-06-07 | 2019-02-22 | 天津市水产技术推广站 | The monoclonal antibody B of prawn hepatopancrease cause of disease toxin protein PirA and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101343320A (en) * | 2008-07-01 | 2009-01-14 | 华南农业大学 | Anti-vibrio parahaemolyticus chicken yolk antibody, preparation method and application thereof |
| CN102770452A (en) * | 2011-07-07 | 2012-11-07 | 深圳市宝舜泰生物医药股份有限公司 | An IgY for a PA-MSHA bacterial strain, and preparation method and application thereof |
| CN103360491A (en) * | 2013-07-10 | 2013-10-23 | 深圳市宝舜泰生物医药股份有限公司 | Anti-helicobacter pylori FlaA protein antibody IgY, preparation method and application thereof |
-
2017
- 2017-04-19 CN CN201710256369.2A patent/CN106866818A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101343320A (en) * | 2008-07-01 | 2009-01-14 | 华南农业大学 | Anti-vibrio parahaemolyticus chicken yolk antibody, preparation method and application thereof |
| CN102770452A (en) * | 2011-07-07 | 2012-11-07 | 深圳市宝舜泰生物医药股份有限公司 | An IgY for a PA-MSHA bacterial strain, and preparation method and application thereof |
| CN103360491A (en) * | 2013-07-10 | 2013-10-23 | 深圳市宝舜泰生物医药股份有限公司 | Anti-helicobacter pylori FlaA protein antibody IgY, preparation method and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| HUNG-CHIAO LAI等: "Pathogenesis of acute hepatopancreatic necrosis disease (AHPND) in shrimp", 《FISH & SHELLFISH IMMUNOLOGY》 * |
| LEE C等: "The opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin", 《PROC NATL ACAD SCI USA》 * |
| LEE,C.T.等: ""Chain A, Uncharacterized Protein"", 《GENBANK》 * |
| LEE,C.T.等: "Chain A,Uncharacterized Protein", 《GENBANK》 * |
| 李元龙等: "卵黄抗体的特点及在兽医学中的应用", 《吉林畜牧兽医》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108948190A (en) * | 2018-06-07 | 2018-12-07 | 天津市水产技术推广站 | The monoclonal antibody E of prawn hepatopancrease cause of disease toxin protein PirA and application |
| CN109369804A (en) * | 2018-06-07 | 2019-02-22 | 天津市水产技术推广站 | The monoclonal antibody B of prawn hepatopancrease cause of disease toxin protein PirA and application |
| CN109369804B (en) * | 2018-06-07 | 2021-10-01 | 天津市水产技术推广站 | Monoclonal antibody B of prawn hepatopancreatic pathogenic toxin protein PirA and application |
| CN109182364A (en) * | 2018-08-30 | 2019-01-11 | 武汉百意欣生物技术有限公司 | A kind of polyclonal antibody and its preparation method and application of specific recognition albumin A |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104497137B (en) | The general monoclonal antibody of African swine fever virus strain and preparation method and application | |
| US8173773B2 (en) | Mycobacterium tuberculosis fusion protein and uses thereof | |
| CN107033250B (en) | Bovine coronavirus recombinant multi-epitope antigen and application thereof | |
| Safley et al. | Role of listeriolysin-O (LLO) in the T lymphocyte response to infection with Listeria monocytogenes. Identification of T cell epitopes of LLO. | |
| CN102276730B (en) | Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof | |
| CN106866818A (en) | The proteineus yolk antibody of the acute Hepatopancreatic necrosis syndrome of immunodiagnosis and its preparation technology and application | |
| CN110218250A (en) | A kind of preparation method of grass carp component 5 polyclonal antibody | |
| CN114874995B (en) | Swine fever virus 2E rns Monoclonal antibody hybridoma cell strain of protein and application | |
| CN101652385A (en) | REPLIKIN peptide and uses thereof | |
| CN114524862B (en) | Construction and application of avian influenza (H5 + H7) trivalent DNA vaccine | |
| CN106841607A (en) | Acute Hepatopancreatic necrosis syndrome dedicated test kit and preparation method thereof | |
| CN113354722B (en) | Application of echinococcus granulosus Severin protein in kit for detecting cystic echinococcosis and echinococcus granulosus infection | |
| CN108578686A (en) | A method of preparing clostridiosis of sheep genetic engineering subunit vaccine | |
| CN110746496B (en) | PAL recombinant protein of Acinetobacter baumannii, encoding gene thereof and application of PAL recombinant protein and encoding gene | |
| CN111487418A (en) | NDM-1 drug-resistant protein double-antibody sandwich E L ISA detection kit and detection method | |
| CN108503696A (en) | A kind of zika virus subunit vaccine of yeast cell to express | |
| CN107349423B (en) | Meningococcal antigen combination and application thereof | |
| CN112843225B (en) | Riemerella anatipestifer DNA vaccine based on RA OmpA gene, and preparation method and identification method thereof | |
| CN113150086B (en) | Helicobacter pylori HefC recombinant protein and application thereof | |
| CN104725492B (en) | A kind of Acinetobacter bauamnnii surface antigen S urA1 with immune protective | |
| CN110981969B (en) | ALV-K ELISA kit and detection method thereof | |
| CN113881617A (en) | Recombinant lactic acid bacteria with targeted dendritic cells expressing H7N9 avian influenza HA1 antigen and application thereof | |
| CN110343715A (en) | The preparation method of pET-28a-SUMO- prothrombin proteantigen and its polyclonal antibody | |
| CN112159480A (en) | Chicken infectious bursal disease virus multi-antigen epitope protein and application thereof | |
| CN111840529A (en) | Preparation method of Eimeria tenella recombinant polypeptide vaccine VKVQ and application method thereof in chicken coccidiosis resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180510 Address after: 518108 4 building, 4 Yuntai science and Technology Industrial Park, Tong Tou Road 1, Shiyan Road, Baoan District, Shenzhen, Guangdong Applicant after: Shenzhen Guangxi biological science and Technology Co., Ltd. Address before: 518000 6 building, Yuntai science and Technology Industrial Park, No. 1, Tong Tou, Baoan District, Shiyan street, Baoan District, Shenzhen, Guangdong Applicant before: Shenzhen Bao Shun Thai science and technology industry Limited by Share Ltd |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170620 |