CN106794246B

CN106794246B - Tumor antigen specific antibodies and TLR3 stimulation to enhance checkpoint interference performance of cancer therapy

Info

Publication number: CN106794246B
Application number: CN201580053422.8A
Authority: CN
Inventors: 赖果伯赛·马迪耶拉汗; 克里斯多夫·F·尼科迪默斯
Original assignee: Oncoquest Pharmaceuticals Inc
Current assignee: Canaria Biology
Priority date: 2014-08-08
Filing date: 2015-08-07
Publication date: 2021-10-15
Anticipated expiration: 2035-08-07
Also published as: EP3177321B1; US10392444B2; JP2017524033A; EP3177321A4; US20190322760A1; JP6698084B2; WO2016019472A1; EP3177321A1; CN106794246A; US20170226221A1

Abstract

The present disclosure relates to methods of inhibiting cancer tumor growth in a patient by administering to the patient a therapeutic monoclonal antibody specific for a tumor associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor. Uses, compositions and kits thereof are also disclosed.

Description

Tumor antigen specific antibodies and TLR3 stimulation to enhance checkpoint interference performance of cancer therapy

Cross Reference to Related Applications

This application claims priority to U.S. provisional patent application 62/034915, filed 8/2014, the specification of which is incorporated herein by reference.

Background

(a)FIELD

In general, the disclosed subject matter relates to methods of inhibiting the growth of a cancer tumor in a patient. More specifically, the methods relate to methods comprising administering to a patient a therapeutic monoclonal antibody specific for a tumor-associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor.

(b)Related prior art

Nyquist pharmaceutical technology (Quest PharmaTech) developed a series of monoclonal antibodies specific for tumor antigens such as CA125, MUC1, PSA, Her2/neu and other tumor-associated antigens. Nyquist pharmaceutical technology (Quest PharmaTech) is developing these monoclonal antibody therapies as cancer immunotherapies, which are capable of stimulating anti-tumor immunity, in particular, through altered antigen processing and presentation stimulated by these specific antibodies.

Demonstration studies have been completed in animals and in human clinical trials for several antibodies, namely AR20.5 and B43.13. In parallel to these efforts, immunologists investigating the molecular events of adaptive immunity have used T cell receptors that recognize peptide fragments of antigens in the context of MHC class I and class II to define pathways for antigen recognition by specific T cells. The kinetics of the acute response require activation of a second signal in addition to T cell receptor recognition to avoid induction of tolerance. The primary activating secondary signal is the interaction between B7.1 on Antigen Presenting Cells (APC) and CD28 on T cells. These second signals are induced in pro-inflammatory microenvironments. Additional activation pathways are also defined, as well as a redundant set of checkpoint pathways designed to limit antigen-specific activation. These steady state checkpoint signals include the interaction of CTLA4 on T cells with B7.1 on APC and PD-1 on T cells with B7H1 on APC.

Interference with checkpoint inhibition results in prolongation and enhancement of specific immunity. This has been applied to immunotherapy of multiple cancer types, and as reported at the us clinical oncology society's conference 2014, activation of immunity using the developing molecules, and in the case of an anti-CTLA-4 monoclonal antibody (ipilimumab), commercialized molecules can lead to predictable clinical responses in patients with advanced solid malignancies, as well as sustainable control of tumor growth, and sometimes shrinkage and disease elimination. The response to treatment has been linked to the presence of mutations on common tumor antigens, which are presumed to produce Neoantigens (Neoantigens) that are more susceptible to immune attack by endogenous T cells (Snyder et al, ASCO Proceedings 2014 abstract 3003). However, the performance of immune checkpoint blockade therapy remains limited, with responses seen in less than 50% of patents, and complete responses observed in only a few percent of treated patients.

Thus, there is a need for methods to improve the performance of immune checkpoint blockade therapies.

Disclosure of Invention

According to one embodiment, there is provided a method for inhibiting the growth of a cancer tumor in a patient comprising administering to the patient a therapeutic monoclonal antibody specific for a tumor associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor.

The tumor-associated target antigen may be expressed on the cell surface of the tumor.

The tumor-associated target antigen can be a soluble antigen.

The therapeutic monoclonal antibody specific for a tumor associated antigen can be an IgG antibody, an IgE antibody, or a combination thereof.

The therapeutic monoclonal antibody specific for a tumor associated antigen may be an antibody specific for MUC1.

An antibody specific for MUC1 binds to an epitope of MUC1 selected from SEQ ID NO 5.

The heavy chain variable region of an antibody specific for MUC1 may be encoded by a nucleic acid comprising SEQ ID No. 1, and wherein the light chain variable region of an antibody specific for MUC1 may be encoded by a nucleic acid comprising SEQ ID No. 2.

The heavy chain variable region of an antibody specific for MUC1 may be encoded by a nucleic acid comprising SEQ ID No. 3 and the light chain variable region of an antibody specific for MUC1 may be encoded by a nucleic acid comprising SEQ ID No. 4.

The antibody specific for MUC1 may be mAb-AR20.5, mAb 3c6.hige, mAb 4h5.hige, or a combination thereof.

The therapeutic monoclonal antibody specific for a tumor associated antigen may be an antibody specific for CA 125.

The antibody specific for CA125 may be mAb-B43.13.

The immunostimulatory compound may be a TLR3 agonist or a TLR4 agonist.

The TLR3 agonist may be poly IC, poly ICLC

The immune homeostatic checkpoint inhibitor is an anti-PD-1 antibody, an anti-PDL-1, an anti-CTLA-4 antibody or a molecular inhibitor of these receptors.

The anti-PD-1 antibody may be selected from the group consisting of: nivolumab (nivolumab) antibody, pembrolizumab (pembrolizumab) antibody, pidilizumab (pidilizumab) antibody, or a combination thereof.

The anti-PDL-1 antibody may be selected from the group consisting of: B7-H1 antibody, BMS-936559 antibody, MPDL3280A (atezolizumab), MEDI-4736 antibody, MSB0010718C antibody, or a combination thereof.

The anti-CTLA-4 antibody may be selected from the group consisting of: a pleaprimoma or tereimumab (tremelimumab), or a combination thereof.

The therapeutic tumor associated antigen specific antibody may be a murine monoclonal antibody (xenotypic), a chimeric monoclonal antibody, a humanized monoclonal antibody or a fully human monoclonal antibody.

A therapeutic monoclonal antibody specific for a tumor associated antigen can have constant regions that can be of human origin.

A therapeutic monoclonal antibody specific for a tumor associated antigen can have variable regions that can be of human origin, non-human origin, or any combination thereof.

The cancer may be selected from pancreatic cancer, breast cancer, colorectal cancer, ovarian cancer, renal cancer, prostate cancer, bladder cancer, gastrointestinal cancer, lung cancer and multiple myeloma.

The tumor associated antigen may be CA125, Folate Binding Protein (FBP), HER2/neu, MUC1 or PSA.

The method comprises the following steps:

a) administering a therapeutically effective amount of a therapeutic monoclonal antibody specific for a tumor associated antigen;

b) administering a therapeutically effective amount of an immunostimulatory compound after step a); and is

c) Administering a therapeutically effective amount of an immune homeostatic checkpoint inhibitor after step b).

Step b) may be performed after 1 or more days of step a).

Step c) may be performed after 1 or more days of step b).

According to another embodiment, there is provided the use of a therapeutic monoclonal antibody specific for a tumor-associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor for inhibiting cancer tumor growth in a patient in need thereof.

The tumor-associated target antigen can be a soluble antigen.

The antibody specific for CA125 may be mAb-B43.13.

The immunostimulatory compound may be a TLR3 agonist or a TLR4 agonist.

The TLR3 agonist may be poly IC, poly ICLC

The anti-CTLA-4 antibody may be selected from the group consisting of: -yipriomama (ipilimumab) or terlimumab (tremelimumab), or a combination thereof.

A therapeutic monoclonal antibody specific for a tumor associated antigen can have variable regions of human origin, non-human origin, or any combination thereof.

Therapeutic monoclonal antibodies specific for tumor associated antigens may be used prior to the immunostimulatory compound.

Immunostimulatory compounds may be used prior to immune homeostasis checkpoint inhibitors.

Monoclonal antibodies specific for tumor associated antigens may be used 1 or more days prior to the immunostimulatory compound.

The immunostimulatory compound may be administered 1 or more days prior to the immune homeostasis checkpoint inhibitor.

According to another embodiment, there is provided a composition for inhibiting cancer tumor growth in a patient in need thereof, the composition comprising a therapeutic monoclonal antibody specific for a tumor associated antigen, at least one immunostimulatory compound, and at least one immune homeostatic checkpoint inhibitor.

The tumor-associated target antigen may be expressed on the surface of a tumor cell.

The tumor-associated target antigen can be a soluble antigen.

The antibody specific for CA125 may be mAb-B43.13.

The immunostimulatory compound may be a TLR3 agonist or a TLR4 agonist.

The TLR3 agonist may be poly IC, poly ICLC

The anti-PD-1 antibody may be selected from the group consisting of: a nivolumab antibody, a pembrolizumab antibody, a pidilizumab (pidilizumab) antibody, or a combination thereof.

According to another embodiment, a kit for inhibiting cancer tumor growth in a patient in need thereof is provided, the kit comprising

A therapeutic monoclonal antibody specific for a tumor associated antigen,

at least one immunostimulatory compound, wherein the at least one immunostimulatory compound is selected from the group consisting of,

at least one immune homeostatic checkpoint inhibitor, and

instructions for how to use the kit.

The tumor-associated target antigen can be a soluble antigen.

The antibody specific for CA125 may be mAb-B43.13.

The immunostimulatory compound may be a TLR3 agonist or a TLR4 agonist.

The TLR3 agonist may be poly IC, poly ICLC

The anti-PDL-1 antibody may be selected from the group consisting of a B7-H1 antibody, BMS-936559 antibody, MPDL3280A (atezolizumab) antibody, MEDI-4736 antibody, MSB0010718C antibody, or a combination thereof.

The following terms are defined below.

As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. Such terms, in the context of pharmaceutical or other compositions, are generally intended to encompass a product comprising the active ingredient and the inert ingredient(s) that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. Thus, the pharmaceutical or other compositions of the invention generally encompass any composition prepared by admixing a compound of the invention and a pharmaceutically acceptable carrier. By "pharmaceutically acceptable" or "acceptable" is meant that the carrier, diluent or excipient must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.

In some embodiments, the term "pharmaceutically acceptable" refers to those approved by a regulatory agency of the federal or a state government or listed in the U.S. pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions may also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk, glycerol, propylene glycol, water, ethanol and the like. The compositions may also contain minor amounts of wetting or emulsifying agents or pH buffering agents, if desired. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The compositions may be formulated as suppositories using conventional binders and carriers such as triglycerides. Oral formulations may include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. Examples of suitable Pharmaceutical carriers are described in e.w. martin, works "Remington's Pharmaceutical Sciences". Such compositions will contain a therapeutically effective amount of the antibody or fragment thereof, preferably in purified form, together with a suitable amount of carrier to provide a form for proper administration to a patient. The formulation should be suitable for the mode of administration.

The term "inhibit" as used in the context of the present invention means to slow, hinder, inhibit, reduce or prevent. For example, "inhibiting tumor cell growth" as that term is used herein refers to slowing, hindering, inhibiting, reducing, or preventing tumor cell growth.

As used herein, the term "administering" refers to any act that results in exposure or contact, in the context of a predetermined cell or tissue, typically a mammal, with a composition according to the present invention comprising a therapeutic monoclonal antibody specific for a tumor-associated antigen in combination with at least one immunostimulatory compound, and at least one immune homeostatic checkpoint inhibitor. As used herein, administration can be in vivo, in vitro, or ex vivo. For example, the composition may be administered by injection or by endoscopy. Administration also includes applying a composition according to the invention directly to the cells. For example, during surgery, tumor cells may be exposed. According to one embodiment of the invention, these exposed cells (or tumors) may be directly exposed to the composition of the invention, for example by washing or rinsing the surgical site and/or cells, or by combining a therapeutic monoclonal antibody specific for a tumor-associated antigen with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor, alone or in admixture, directly injected intratumorally.

The term "epitope" means that portion of an antigen that is capable of being recognized and bound by an antibody on the binding region of one or more antibodies. Epitopes usually comprise chemically active surface aggregates (grouping) of molecules, such as amino acid or sugar side chains, and have specific three-dimensional structural characteristics as well as specific charge characteristics. In one embodiment, the epitope of the antigen is a repetitive epitope. In one embodiment, the epitope of the antigen is a non-repetitive epitope.

As used herein, the term "subject" is a human patient or other animal, such as another mammal having functional mast cells, basophils, neutrophils, eosinophils, monocytes, macrophages, dendritic cells, and langerhans cells. In humans, suitable cells express high affinity receptors for IgG for the administered IgG antibodies of the invention, as well as IgE (fcsri) for the administered IgE antibodies of the invention.

As used herein, reduction or complete elimination of growth kinetics of a cancer tumor or a metastatic cell or tumor as used herein is defined as referring to as understood in the art. For example, a decrease in growth kinetics refers to a decrease in the exponential growth, specific growth rate, or doubling time of a primary solid tumor, metastatic cell, or metastatic tumor relative to the exponential growth, specific growth rate, or doubling time typically observed in vivo or in vitro for a given tumor type. Complete elimination of a tumor is the absence of the presence of a tumor by symptom, physical examination, or radiographic imaging in the presence of a therapeutic monoclonal antibody specific for a tumor-associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor, wherein the presence of a tumor was previously seen by these detection methods.

As used herein, the term "tumor associated antigen" (TAA) can be any type of cancer antigen that can be associated with a tumor known in the art, and includes antigens found on cell surfaces, including tumor cells, as well as soluble cancer antigens. Several cell surface antigens on tumor and normal cells have soluble counterparts. Such antigens include, but are not limited to, antigens found on Cancer Associated Fibroblasts (CAF), Tumor Endothelial Cells (TEC), and Tumor Associated Macrophages (TAM). Examples of cancer-associated fibroblast (CAF) target antigens include, but are not limited to: carbonic anhydrase ix (caix); fibroblast activation protein alpha (FAP α); and Matrix Metalloproteinases (MMPs), including MMP-2 and MMP-9. Examples of Tumor Endothelial Cell (TEC) target antigens include, but are not limited to, Vascular Endothelial Growth Factor (VEGF), including VEGFR-1, 2, and 3; CD-105 (endoglin), Tumor Endothelial Markers (TEM), including TEM1 and TEM 8; MMP-2; survivin and prostate specific membrane antigen (PMSA). Examples of tumor-associated macrophage antigens include, but are not limited to: CD 105; MMP-9; VEGFR-1, 2, 3, and TEM 8. According to some embodiments, the tumor-associated antigen may be CA125, Folate Binding Protein (FBP), HER2/neu, MUC1, or PSA.

Before describing the present invention in detail, a number of terms will be defined. As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

It is noted that terms like "preferably," "commonly," and "typically" are not utilized herein to limit the scope of the claimed invention or to imply that certain features are critical, essential, or even important to the structure or function of the claimed invention. Rather, these terms are merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment of the present invention.

For the purposes of describing and defining the present invention it is noted that the term "substantially" is utilized herein to represent the inherent degree of uncertainty that may be attributed to any quantitative comparison, value, measurement, or other representation. The term "substantially" is also utilized herein to represent the degree by which a quantitative representation may vary from a stated reference without resulting in a change in the basic function of the subject matter at issue.

The features and advantages of the subject matter of the present invention will become more apparent in light of the following detailed description of selected embodiments thereof, as illustrated in the accompanying drawings. As will be realized, the disclosed and claimed subject matter is capable of modifications in various respects, all without departing from the scope of the appended claims. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive, and the full scope of the subject matter is set forth in the claims.

The references cited herein, including published or corresponding U.S. or foreign patent applications, issued U.S. or foreign patents, and any other references, are incorporated by reference herein in their entirety, including all data, tables, figures, and text presented in the cited references.

Drawings

Other features and advantages of the present disclosure will become apparent from the following detailed description taken in conjunction with the accompanying drawings, in which:

FIG. 1 shows the mucin polypeptide backbone with structural features of the Chou-Fasman predicted tandem repeat domains.

Figure 2 shows the experimental design using antigen specific IgG in combination with a TLR3 agonist and checkpoint inhibitor.

FIG. 3 shows the time to tumor appearance after the first challenge with MUC1-Panc02 tumor cells for the third group of animals. With a) AR20.5 alone, relative to control; B) AR20.5 and anti-PDL-1, relative to control; C) AR20.5, anti-PDL-1 and Poly (I: C) relative to control; D) AR20.5 and Poly (I: C), relative to control; E) anti-PDL-1 alone, relative to control; F) anti-PDL-1 and Poly (I: C), relative to control treatment. The solid line represents the control, while the dashed line represents the treatment conditions.

FIG. 4 shows tumor growth curves for different treatment groups after the first challenge with MUC1-Panc 02. Tumor volumes were plotted over time over a 55 day period.

FIG. 5 shows tumor growth curves of surviving mice from different treatment groups after re-challenge with MUC1-Panc 02. Tumor volumes from the MUC-1-Panco-2 challenged flank were plotted over a 46 day period.

FIG. 6 shows tumor growth curves from surviving mice treated differently after re-challenge with Neo-Panc02 in the opposite flank. Tumor volumes from neo-panc02 over a period of 46 days.

Figure 7 shows images of MUC1 and new control tumors from mice that have been resistant to re-challenge with the primary tumor challenge of the combined treatment. Control mice showed comparability of MUC1-panco2 and neo-panco-2 tumors grown in non-immunized animals. In treated mice, immune-tolerant tumors that do not express MUC1(Neo tumor) grew faster than tumor cells that express MUC1 (MUC1 tumor), confirming the antigen specificity of prior immunization with AR20.5 and Poly (I: C) or AR20.5, Poly (I: C) and anti-PDL-1.

FIG. 8 shows adoptive transfer of two MUC-1 transgenic mice by splenocytes from mice receiving AR20.5, anti-PDL-1, and Poly (I: C) combination treatment and rejecting primary tumor challenge. Mice were challenged with MUC1-Panc02 tumor followed by tumor emergence. Untreated mice served as controls for this challenge. This experiment demonstrates that splenocytes transmit tumor resistance.

Figure 9 shows the experimental design using antigen specific IgE in combination with a TLR3 agonist and checkpoint inhibitor.

FIG. 10 shows the time to tumor appearance following the first challenge with MUC1-Panc02 tumor cells. With a) anti-MUC 1IgE alone, relative to control; B) anti-MUC 1IgE and anti-PDL-1, relative to control; C) anti-MUC 1IgE, anti-PDL-1, and Poly (I: C) versus control; D) anti-MUC 1IgE and Poly (I: C), relative to control; E) anti-PDL-1 alone, relative to control; F) poly (I: C) alone, relative to control; and G) anti-PDL-1 and Poly (I: C), relative to control treatment. The solid line represents the control, while the dashed line represents the treatment conditions.

FIG. 11 shows the tumor growth curves of the different treatment groups after the first challenge with MUC1-Panc02 of the tumor over 46 days.

FIG. 12 shows the tumor growth curve of MUC1 tumors after re-challenge with MUC1-Panc02 in one flank of surviving mice. A) Percent tumor free of anti-MUC 1IgE, anti-PDL-1, and Poly (I: C) relative to control; and B) anti-MUC 1IgE, anti-PDL-1, and Poly (I: C) versus control tumor volume over a 57 day period.

FIG. 13 shows tumor growth curves of Neo tumors after re-challenge with MUC1-Panc02 in the opposite flank of surviving mice. A) Percent tumor free of anti-MUC 1IgE, anti-PDL-1, and Poly (I: C) relative to control; and B) anti-MUC 1IgE, anti-PDL-1, and Poly (I: C) versus control tumor volume over a 57 day period.

Figure 14 shows images of MUC1 and new control tumors from second combination treatment challenge immunized and non-immunized control mice demonstrating antigen specificity and showing that in mice previously immunized with anti-MUC 1IgE and Poly (I: C) and anti-PDL-1 that have been resistant to primary tumor challenge, tumors that do not express MUC1(Neo tumors) grew faster than tumor cells that express MUC1 (MUC1 tumors).

Detailed Description

In embodiments, methods are disclosed for treating cancer in a patient comprising administering to the patient a monoclonal antibody specific for a tumor associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor.

Unexpectedly, the present inventors have found that monoclonal antibodies specific for tumor associated antigens in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor can inhibit tumor growth. Without being bound by theory, the combination of a monoclonal antibody specific for a tumor associated antigen according to the invention with an immunostimulatory compound and an immune homeostatic checkpoint inhibitor appears to protect a subject from tumor growth. The present invention is unique and unexpected in that it provides a synergistic effect between these three immunomodulators to greatly reduce or even completely inhibit tumor growth. The end result is that the tumor will grow slowly or even be eliminated. This is in sharp contrast to the use of these immune effectors alone, which are less efficient in blocking tumor cell growth.

As used herein, reduction or complete elimination of growth kinetics of a cancer tumor or metastatic cell or tumor is defined as being as understood in the art. For example, a decrease in growth kinetics refers to a decrease in the exponential growth, specific growth rate, or doubling time of a primary solid tumor, metastatic cell, or metastatic tumor relative to the exponential growth, specific growth rate, or doubling time typically observed in vivo or in vitro for a given tumor type. Complete elimination of a tumor is the absence of the presence of a tumor by symptom, physical examination, or radiographic imaging in the presence of a therapeutic monoclonal antibody specific for a tumor-associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor, wherein the presence of a tumor was previously seen by these detection methods.

According to one embodiment, antigen-specific antibodies can be used to enhance the reactivity of T cells to self-antigens, particularly in patients that do not have mutations in the same human Tumor Associated Antigen (TAA) as themselves. By binding self-antigens with low doses of immunogenic antibodies, the pool of available tumor-specific T cells is enhanced, and checkpoint interference can lead to increased immunity and enhanced clinical activity of the therapy. In addition to selective chemotherapeutic agents and immune homeostasis checkpoint inhibitors that have been found to stimulate aspects of adaptive immunity, the use of adjuvants such as TLR3 or TLR4 agonists can further enhance this effect.

The combined effect of the immunomodulators results in, in whole or in part, inhibition of tumor growth and/or promotion of tumor destruction.

As used herein, a "therapeutic monoclonal antibody specific for a tumor-associated antigen" is a monoclonal antibody, which can be any suitable monoclonal antibody, such as an IgG and/or IgE (which comprises a human Fc epsilon constant region), and further comprises a variable region comprising at least one antigen binding region specific for a tumor-associated antigen (TAA), which is a cell surface antigen or a soluble cancer antigen located in the tumor microenvironment or otherwise in close proximity to the tumor being treated.

In one embodiment, a therapeutic monoclonal antibody specific for a tumor associated antigen can be specific for a cancer antigen located on a non-tumor cell, such as VEGFR-2, MMP, survivin, TEM8, and PMSA. The cancer antigen can be an epithelial cancer antigen (e.g., breast, gastrointestinal, lung), prostate specific cancer antigen (PSA), or Prostate Specific Membrane Antigen (PSMA), bladder cancer antigen, lung (e.g., small cell lung) cancer antigen, colon cancer antigen, ovarian cancer antigen, brain cancer antigen, gastric cancer antigen, renal cell cancer antigen, pancreatic cancer antigen, liver cancer antigen, esophageal cancer antigen, or head and neck cancer antigen. The cancer antigen can also be a lymphoma antigen (e.g., non-hodgkin's lymphoma or hodgkin's lymphoma), a B cell lymphoma cancer antigen, a leukemia antigen, a myeloma (i.e., multiple myeloma or plasma cell myeloma) antigen, an acute lymphocytic leukemia antigen, a chronic myeloid leukemia antigen, or an acute myelogenous leukemia antigen.

Other cancer antigens include, but are not limited to, mucin-1 protein or peptide (MUC-1) found on most human adenocarcinomas: pancreas, colon, breast, ovary, lung, prostate, head and neck, including multiple myeloma and some B cell lymphomas; human epidermal growth factor receptor-2 (HER-2/neu) antigen; epidermal Growth Factor Receptor (EGFR) antigen-associated lung, head and neck, colon, breast, prostate, stomach, ovarian, brain and bladder cancers; prostate Specific Antigen (PSA) and/or Prostate Specific Membrane Antigen (PSMA) that is predominantly expressed in androgen-independent prostate cancer; gp-100 (glycoprotein 100) associated with melanoma Carcinoembryonic (CEA) antigen; carbohydrate antigen associated with Lewis a blood group substances 19.9(CA 19.9) and associated with colorectal cancer; and melanoma cancer antigens, such as MART-1.

Other antigens include mesothelin, Folate Binding Protein (FBP), carbohydrate antigen 125(CA-125), and melanoma associated antigens such as NYESO 1.

In one embodiment, the cancer antigen is a released, soluble form of a cell surface cancer antigen. In a preferred embodiment, strictly, the tumor-associated target antigen is a cell surface antigen located on the surface of a tumor cell. In a preferred embodiment, the tumor-associated antigen is selected from the group consisting of: CA125, Folate Binding Protein (FBP), HER2/neu, MUC1, and PSA.

As used herein, the term "monoclonal antibody" refers to an antibody preparation of a single molecule composition. Monoclonal antibody compositions exhibit a single binding specificity and affinity for a particular epitope. The monoclonal antibodies of the invention are preferably chimeric, humanized or fully human so as to bind to human antibody receptors, such as human fce receptors, when the subject host is a human. Humanized and fully human antibodies can also be used to reduce immunogenicity against murine components of, for example, chimeric antibodies, when the host subject is a human. Monoclonal antibodies can be prepared by standard techniques, including but not limited to recombinant and synthetic means.

The term "chimeric monoclonal antibody" refers to an antibody that exhibits a single binding specificity, having one or more regions derived from one antibody and one or more regions derived from another antibody. In one embodiment of the invention, the constant regions are derived from human epsilon (epsilon) constant regions (heavy chains) and human kappa or lambda (light chains) constant regions. The variable regions of the chimeric IgE monoclonal antibodies of the invention are typically of non-human origin, such as from rodents, e.g., mice (rats), rabbits, rats or hamsters.

As used herein, a "humanized" monoclonal antibody comprises constant regions derived from a human epsilon constant region (heavy chain) and a human kappa or lambda (light chain) constant region. The variable region of the antibody preferably comprises a framework of human origin and antigen binding regions (CDRs) of non-human origin.

Fully human or human-like antibodies can be produced by vaccination of genetically engineered animals, such as mouse strains provided by the Amphen (Amgen) and the Baishimei Shinobo company (Bristol-Myers Squibb), which contain a genetic repertoire of human immunoglobulins and produce fully human antibodies in response to vaccination. In addition, phage display libraries incorporating coding regions for human variable regions are used, which can be identified and selected in antigen screening assays to generate human immunoglobulin variable regions that bind to a target antigen.

The term "antigen-binding region" refers to a portion of an antibody as used in the present invention that comprises amino acid residues that interact with an antigen and confer on the antibody its specificity and affinity for the antigen. The antibody region includes "framework" amino acid residues necessary to maintain the correct conformation of the antigen-binding residues.

An "antigen" is a molecule or portion of a molecule that is capable of being bound by an antibody, which is otherwise capable of inducing an animal to produce an antibody that is capable of binding to an epitope of the antigen. The antigen may have one or more epitopes which may be the same or different. In a preferred embodiment, the antibodies of the invention are specific for a single epitope. In one embodiment, the antigen is capable of being bound to form an immune complex capable of inhibiting cancer tumor growth by an antibody as used in the present invention in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor. In one embodiment, the antigen itself may not be able to stimulate an immune response for a number of reasons, for example, the antigen is a "self" antigen that is not normally recognized by the immune system as requiring a response, or the immune system becomes tolerant to the antigen and does not elicit an immune response. In another embodiment, the antigen is MUC1.

The term "epitope" means that portion of an antigen that is capable of being recognized and bound by an antibody in one or more binding regions of the antibody. Epitopes generally comprise chemically active surface aggregates of molecules, such as amino acid or sugar side chains, and have specific three-dimensional structural characteristics as well as specific charge characteristics. In one embodiment, the epitope of the antigen is a repetitive epitope. In one embodiment, the epitope of the antigen is a non-repetitive epitope.

Thus, in embodiments, a therapeutic monoclonal antibody specific for a tumor associated antigen can be any suitable antibody. According to another embodiment, the therapeutic monoclonal antibody specific for a tumor associated antigen may be any suitable IgG and/or IgE antibody. According to one embodiment, the tumor associated antigen may be CA125, Folate Binding Protein (FBP), HER2/neu, MUC1 or PSA. According to another embodiment, the monoclonal antibody specific for a tumor associated antigen can be, for example, mAb-AR20.5, mAb-B43.13, mAb 3C6.hIgE, mAb 4H5. hIgE. According to another embodiment, the therapeutic tumor associated antigen-specific antibody may be a chimeric monoclonal antibody, a humanized monoclonal antibody or a fully human monoclonal antibody.

Methods for making antibodies (e.g., murine antibodies to an antigen) and for determining whether a selected antibody binds a unique epitope are well known in the art.

Screening for the desired antibody can be accomplished by techniques known in the art, such as radioimmunoassays, ELISAs (enzyme linked immunosorbent assays), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (e.g., using colloidal gold, enzyme or radioisotope labels), Western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, and the like. Many means for detecting binding in an immunoassay are known in the art and are within the scope of the present invention.

For the preparation of monoclonal Antibodies, any technique that provides for the production of antibody molecules by continuous cell lines in culture can be used (see, e.g., Antibodies- -A Laboratory Manual, Harlow and Lane eds., Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, 1988). These include, but are not limited to, the hybridoma technology originally developed by Kohler and Milstein (1975, Nature 256: 495-. In another embodiment of the invention, monoclonal antibodies can be produced in sterile animals using the latest technology (PCT/US 90/02545). According to the present invention, human Antibodies can be used and can be obtained by using human hybridomas (Cote et al, 1983, Proc. Natl. Acad. Sci. U.S.A.,80: 2026-. Indeed, according to the invention, it is possible to use techniques developed for the production of "chimeric antibodies" (Morrison et al, 1984, J.Bacteriol.159: 870; Neuberger et al, 1984, Nature 312: 604-608; Takeda et al 1985, Nature 314:452-454) by splicing genes from mouse antibody molecules specific for the polypeptide and genes from human antibody molecules of appropriate biological activity; such antibodies are within the scope of the invention.

In one embodiment, the antibody used in the present invention is an IgE monoclonal antibody comprising a nucleic acid sequence selected from the group consisting of: a heavy chain variable region encoded by a nucleic acid sequence comprising SEQ ID NO 1; a light chain variable region encoded by a nucleic acid sequence comprising SEQ ID No. 2 and any combination thereof, and wherein said heavy and light chains are implanted into human epsilon heavy and kappa light chain genes, respectively.

In one embodiment, the antibody used in the present invention is an IgE monoclonal antibody comprising a nucleic acid sequence selected from the group consisting of: a heavy chain variable region encoded by the nucleic acid of SEQ ID NO. 3; 4 and any combination thereof, and wherein the heavy and light chains are implanted into human epsilon heavy and kappa light chain genes, respectively.

In one embodiment, the present invention provides the monoclonal antibody 3C6.hige comprising the variable regions of the light and heavy chains of IgG cloned from the VU-3C6 hybridoma and implanted into the human Ig kappa light chain and epsilon heavy chain genes, respectively. VU-3C6 targets human mucin 1(hMUC1), derived from a low-glycosylated form of mucin overexpressed on tumors of glandular epithelium. In one embodiment, the invention comprises the IgE antibody 4h5.hige which is specific for a different isoform of MUC1 than the MUC1 to which 3c6.hige is specific.

In one embodiment, the antibody of the invention is monoclonal antibody 3c6.hige comprising a heavy chain variable region encoded by a nucleic acid sequence comprising SEQ ID No. 1; a light chain variable region encoded by a nucleic acid sequence comprising SEQ ID NO 2.

In one embodiment, the antibody of the invention is monoclonal antibody 4h5. hige. Antibody 4H5.hIgE has the heavy chain variable region encoded by the nucleic acid of SEQ ID NO 3 and the light chain variable region encoded by the nucleic acid of SEQ ID NO 4 and is grafted into the human Ig kappa light and epsilon heavy chain genes.

In one embodiment, the therapeutic monoclonal antibody specific for a tumor associated antigen is an IgG monoclonal antibody specific for an epitope of MUC1. In one embodiment, the IgG monoclonal antibody is the antibody AR20.5, such as Qi, W, et al; hybrid hybrids.2001; 20(5-6): 313-24. MAb AR20.5 strongly reacts with soluble forms or cell surface epitopes of MUC1 on many human cancer cell lines. In one embodiment, the antibody of the invention is specific for an epitope of MUC1 comprising amino acid STAPPAHGVTSAPDTRPAPG [ SEQ ID NO:5] of MUC1. The exact epitope is located in one of the 20 amino acid repeats that characterize the outer domain of MUC1. In one embodiment, the antibody of the invention is capable of binding MUC1 at the epitope defined at STAPPAHGVTSAPDTRPAPG [ SEQ ID NO:5 ].

In one embodiment, the therapeutic monoclonal antibody specific for a tumor associated antigen is an IgE monoclonal antibody specific for an epitope of MUC1. In one embodiment, the antibody of the invention is specific for an epitope of MUC1 comprising amino acid STAPPAHGVTSAPDTRPAPG [ SEQ ID NO:5] of MUC1. The exact epitope is located in one of the 20 amino acid repeats that characterize the outer domain of MUC1. In one embodiment, the antibody of the invention is capable of binding MUC1 at the epitope defined by STAPPAHGVTSAPDTRPAPG [ SEQ ID NO:5 ].

In one embodiment, a therapeutic monoclonal antibody specific for a tumor associated antigen according to the invention is expressed by positive transfectomas identified by enzyme linked immunosorbent assay (ELISA) and Western blot. Positive transfectomas were cloned by limiting dilution to achieve the highest productivity and selected for antibody production. As used herein, "transfectomas" include recombinant eukaryotic host cells that express the antibody, such as Chinese Hamster Ovary (CHO) cells and NS/O myeloma cells. Such transfectoma methods are well known in the art (Morrison, S. (1985) Science,229: 1202). Previously published Methods for producing mouse/human chimeric or humanized antibodies have resulted in the successful production of various human chimeric antibodies or antibody fusion proteins (Helguera G, Penichet ML., Methods mol. Med. (2005)109: 347-74).

In general, chimeric mouse-human monoclonal antibodies (i.e., chimeric antibodies) can be produced by recombinant DNA techniques known in the art. For example, the gene encoding the Fc constant region of a murine (or other species) monoclonal antibody molecule is digested with restriction enzymes to remove the region encoding murine Fc and replace the equivalent portion of the gene encoding human Fc constant region. (see Robinson et al, International patent publication No. PCT/US 86/02269; Akira, et al, European patent application 184,187; Taniguchi, M., European patent application 171,496; Morrison et al, European patent application 173,494; Neuberger et al, International application WO 86/01533; Cabilly et al, U.S. Pat. No. 4,816,567; Cabilly et al, European patent application 125,023; Better et al (1988Science 240: 1041-.

Chimeric antibodies can be further humanized by replacing sequences of the Fv variable region that are not directly involved in antigen binding with equivalent sequences from the human Fv variable region. An overview of humanized chimeric antibodies is provided by Morrison, S.L.,1985, Science,229: 1202. ang. 1207 and Oi et al, 1986, BioTechniques, 4: 214. Those methods include isolating, manipulating and expressing nucleic acid sequences encoding all or part of an immunoglobulin Fv variable region from at least one of a heavy chain or a light chain. The source of such nucleic acids is well known to those skilled in the art, e.g., from 7E3, a method of generating anti-GPII_bIII_aHybridoma production of antibody. The recombinant DNA encoding the chimeric antibody or fragment thereof can then be cloned into a suitable expression vector. Suitable humanized antibodies may alternatively be generated by CDR substitution (U.S. Pat. No. 5,225,539; Jones et al 1986Nature,321: 552-525; Verhoeyan et al 1988Science,239: 1534; and Beidler et al 1988J. Immunol.,141: 4053-4060).

As used herein, an "effective amount" of a therapeutic monoclonal antibody specific for a tumor associated antigen of the present invention is an amount sufficient to recognize and bind to an epitope of TAA as a cell surface antigen and induce, elicit or enhance a reference immune response according to the present invention.

According to one embodiment, the invention includes an immunostimulatory compound. An immunostimulatory compound is a compound that has the ability to stimulate or elicit an immune response. As used herein, the term relates to exemplary immunostimulatory compounds, including toll-like receptor (TLR) agonists (e.g., TLR3, TLR4, TLR7, TLR9), N-acetylmuramyl-L-alanine-D-isoglutamine (MDP), lipopolysaccharide LPS, genetically modified and/or degraded LPS, alum, dextran, colony stimulating factors (e.g., EPO, GM-CSF, G-CSF, M-CSF, PEGylated G-CSF, SCF, IL-3, IL6, PIXY 321), interferons (e.g., gamma-interferon, alpha-interferon), interleukins (e.g., IL-2, IL-7, IL-12, IL-15, IL-18), MHC class II binding peptides, saponins (e.g., QS21), unmethylated CpG sequences, 1-methyltryptophan, tryptophan, cysteine, and the like, Arginase inhibitors, cyclophosphamide, antibodies that block immunosuppressive functions (e.g., anti-CTLA 4 antibodies, anti-TGF- β, etc.), and mixtures of two or more thereof.

In a preferred embodiment, the immunostimulatory compound is a TLR3 agonist. In a preferred embodiment, the TLR3 agonist for use according to the invention is a double stranded nucleic acid selected from the group consisting of: polyinosinic acid and polycytidylic acid, polyadenylic acid and polyuridylic acid, polyinosinic acid analogs and polycytidylic acid analogs, polyadenylic acid analogs and polyuridylic acid, polyadenylic acid and polyuridylic acid analogs, and polyadenylic acid analogs and polyuridylic acid analogs. Specific examples of double stranded RNA as TLR3 agonists also include polyadenur (ipsen) and ampligen (hemispherx). Polyadenur is a polyA/U RNA molecule, i.e., contains both a polyA strand and a polyU strand. Ampligen is disclosed in e.g. EP 281380 or EP 113162. In another preferred embodiment, the TLR3 agonist may be Poly (I: C) LC or polyIC

It is a synthetic complex of carboxymethylcellulose, polyinosinic-polycytidylic acid, and poly-L-lysine double-stranded RNA. Poly (I: C) LC stimulates the release of cytotoxic cytokines and increases the tumoricidal activity of various immune hematopoietic cells by inducing interferon- γ production.

In one embodiment, the immunostimulatory compound is a TLR4 agonist. Exemplary TLR4 agonists include taxanes such as paclitaxel (paclitaxel) and docetaxel (docetaxel), Lipopolysaccharide (LPS); escherichia coli LPS; and porphyromonas gingivalis (p. gingivalis) LPS.

As used herein, an "effective amount" of an immunostimulatory compound of the invention is an amount sufficient to induce, elicit or enhance a reference immune response according to the invention.

According to another embodiment, the invention includes an immune homeostatic checkpoint inhibitor. Immune homeostatic checkpoint inhibitors are monoclonal antibodies (mabs) directed against immune checkpoint molecules that are expressed on immune cells and mediate signals to attenuate excessive immune responses. According to one embodiment, immune homeostatic checkpoint inhibition may be performed with inhibitory monoclonal antibodies against the inhibitory immune receptors CTLA-4, PD-1 and PDL-1. According to some embodiments, such inhibitors have become a successful treatment for patients with advanced melanoma. According to one embodiment, the immune homeostatic checkpoint inhibitor may be one of an anti-CTLA-4, anti-PD-1 and/or anti-PDL-1 antibody. According to one embodiment, the anti-CTLA-4 antibody may be Yipimema or Teramelimumab (tremelimumab), or a combination thereof. According to another embodiment, the anti-PDL-1 antibody may be a B7-H1 antibody, BMS-936559 antibody, MPDL3280A (atezolizumab) antibody, MEDI-4736 antibody, MSB0010718C antibody, or a combination thereof. According to another embodiment, the anti-PD-1 antibody can be a nivolumab antibody, a pembrolizumab antibody, a pidilizumab (pidilizumab) antibody, or a combination thereof. In addition, PD-1 can also be targeted with AMP-224, AMP-224 is PD-L2-IgG recombinant fusion protein. Other antagonists of inhibitory pathways in the immune response have been advanced by clinical development. IMP321 is a soluble LAG-3Ig fusion protein and an MHC class II agonist, which is used to increase the immune response to tumors. LAG3 is an immune checkpoint molecule. Lirilumab is an antagonist against KIR receptors, and BMS 986016 is an antagonist of LAG 3. The third inhibitory checkpoint pathway is the TIM-3-galectin-9 pathway, which is also a promising target for checkpoint inhibition. RX518 targets and activates glucocorticoid-induced tumor necrosis factor receptor (GITR), a member of the TNF receptor superfamily that is expressed on the surface of a variety of types of immune cells, including regulatory T cells, effector T cells, B cells, Natural Killer (NK) cells, and activated dendritic cells.

As used herein, an "effective amount" of an immune homeostatic checkpoint inhibitor of the invention is an amount sufficient to induce, elicit or enhance a reference immune response according to the invention.

According to another embodiment, the method of the invention comprises the steps of:

In one embodiment, step b) may be performed 1 or more days after step a). In another embodiment, step c) may be performed 1 or more days after step b).

b) administering a therapeutically effective amount of an immune homeostatic checkpoint inhibitor after step a); and is

c) Administering a therapeutically effective amount of an immunostimulatory compound after step b).

a) administering a therapeutically effective amount of an immunostimulatory compound;

b) administering a therapeutically effective amount of a therapeutic monoclonal antibody specific for a tumor associated antigen after step a); and is

c) After step b), administering a therapeutically effective amount of a therapeutic monoclonal antibody specific for a tumor associated antigen.

a) administering a therapeutically effective amount of an immune homeostatic checkpoint inhibitor;

c) Administering a therapeutically effective amount of a therapeutic monoclonal antibody specific for a tumor associated antigen after step b).

According to another embodiment, the invention also includes the use of a therapeutic monoclonal antibody specific for a tumor-associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor for inhibiting cancer tumor growth in a patient in need thereof.

In embodiments, the use employs a therapeutic monoclonal antibody specific for a tumor associated antigen in combination with at least one immunostimulatory compound and at least one immune homeostatic checkpoint inhibitor, as described above, for inhibiting cancer tumor growth in a patient in need thereof.

According to another embodiment, the present invention also encompasses a composition for inhibiting cancer tumor growth in a patient in need thereof, the composition comprising a therapeutic monoclonal antibody specific for a tumor associated antigen, at least one immunostimulatory compound, and at least one immune homeostatic checkpoint inhibitor.

Such compositions comprise a therapeutically effective amount of a therapeutic monoclonal antibody specific for a tumor associated antigen, at least one immunostimulatory compound, and at least one immune homeostatic checkpoint inhibitor, and may further comprise a pharmaceutically acceptable carrier. In a preferred embodiment, the pharmaceutical composition comprises a therapeutic IgE monoclonal antibody that specifically binds to a single epitope of MUC1.

According to the methods or uses of the invention, the compositions of the invention comprising a therapeutic monoclonal antibody specific for a tumor associated antigen, an immunostimulatory compound, and an immune homeostatic checkpoint inhibitor may be administered to a patient by any immunologically suitable route. For example, they may be introduced into a patient by intravenous, subcutaneous, intraperitoneal, intrathecal, intravesical, intradermal, intramuscular, or intralymphatic routes, alone or as a combination. The composition may be in the form of a solution, tablet, aerosol or multi-phase formulation. Liposomes, long-circulating liposomes, immunoliposomes, biodegradable microspheres, micelles, etc. may also be used as carriers, vehicles or delivery systems. In addition, blood or serum from the patient may be removed from the patient using in vitro methods well known in the art; optionally, it may be desirable to purify the antigen in the patient's blood; the blood or serum may then be mixed with a composition comprising a binding agent according to the invention; and returning the treated blood or serum to the patient. The present invention should not be limited to any particular method of introducing a binding agent into a patient.

In a preferred embodiment, the composition is formulated according to conventional methods as a pharmaceutical composition suitable for intravenous administration to a human. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. When the composition is administered by infusion, it may be dispensed in an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, an ampoule of sterile water or saline for injection may be provided so that the ingredients may be mixed prior to administration.

The compositions of the present invention may be formulated in neutral or salt form. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, and the like, and those formed with cations such as those derived from sodium hydroxide, potassium, ammonium, calcium, iron, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

The amount of the composition of the invention that will be effective in treating, inhibiting and preventing the growth of tumors associated with the antigens to which the antibodies of the invention are specific can be determined by standard clinical techniques. The presence of antibodies in the extravascular space may be determined by standard skin wheal and fleir (flair) responses in response to intradermal administration of purified antigen (e.g., MUC 1). In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose employed in the formulation will also depend on the route of administration and the severity of the disease or condition, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

For the antibodies used in the present invention, the dose administered to the patient is generally from 0.001. mu.g/kg to 1mg/kg of patient body weight. Preferably, the dose administered to the patient is from 0.01 μ g/kg to 0.1mg/kg of patient body weight, more preferably from 0.02 μ g/kg to 20 μ g/kg of patient body weight. Lower doses and less frequent administration of the antibodies of the invention may also be possible.

For the immunostimulatory compounds used in the present invention, the dosage administered to the patient may be in accordance with a range or concentration that has been optimized by their respective manufacturers.

For immune homeostatic checkpoint inhibitors used in the present invention, the dose administered to a patient may be in a range or concentration that has been optimized by its respective manufacturer.

The pharmaceutical compositions of the invention have diagnostic and therapeutic utility in vitro and in vivo. For example, these molecules can be administered to cells in culture, e.g., in vitro or ex vivo, or in a subject, e.g., in vivo, to treat cancer. As used herein, the term "subject" is intended to include both human and non-human animals. Preferred subjects are human patients suffering from cancer. As used herein, the term "treating" cancer includes: preventing the occurrence of tumor metastasis in a patient, inhibiting the onset of cancer in a patient; eliminating or reducing pre-existing tumor burden in a patient having metastatic cancer or cancer localized to an organ of origin; extending survival in cancer patients; extending the remission stage in cancer patients following initial treatment with chemotherapy and/or surgery; and/or extending any period between cancer regression and cancer recurrence in the patient.

When used as a therapy for treating cancer, the antibodies for use in the present invention are administered to a patient in a therapeutically effective amount (i.e., the amount required to treat or prevent the appearance of a clinically significant tumor, either at the initial site or at a remote site, at some point in the future). The antibodies and pharmaceutical compositions containing them for use in the present invention will generally be administered parenterally, where possible, or at the site of the target cells or intravenously.

According to yet another embodiment, the invention also includes a kit for inhibiting cancer tumor growth in a patient in need thereof. The kit may comprise a therapeutic monoclonal antibody specific for a tumor associated antigen, at least one immunostimulatory compound, at least one immune homeostatic checkpoint inhibitor, and instructions on how to use the kit.

The invention will be more readily understood by reference to the following examples, which are intended to illustrate the invention without limiting its scope.

Example 1

In vivo tumor challenge study in mice immunized by antigen-specific IgG and combinations

In order to first establish the principle of this therapeutic approach, antibodies with appropriate specificity and tumor models expressing tumor antigens are required to be evaluated in animals resistant to the tumor antigens. A Panc02 tumor cell line transfected with the human MUC1 gene (panc02.muc1) was selected. panc02 tumor was isogenic to BL6 mouse, and panc02.MUC1 was completely isogenic to BL6Tg mouse transgenic for human MUC1. The antibody used to demonstrate the experiment was mAb-AR20.5 from nyquist pharmaceutical technology (Quest PharmaTech), a murine monoclonal antibody previously demonstrated to induce immunity to its ligand MUC1 in a number of experimental systems. AR20.5 is an IgG1 κ monoclonal antibody that binds to sequence DTRPAP in the core tandem repeat of MUC1 (see fig. 1).

Design of experiments

1) MUC1.tg animals (i.e. immune tolerance to MUC 1): by 1X 10⁶One panc02.muc1 cell challenged all animals subcutaneously.

2) mAb-AR20.5(100 μ g) was injected intravenously on day 7, day 17, day 27, and every 10 days thereafter until disease progression or day 47.

3) 50 μ g Poly (I: C) was given intravenously on day 7 after tumor challenge, then on days 12, 17, 22, and every 5 days until disease progression or day 47

4) On

days

8, 10, 13, 15, 18, 20, 23, 25 and the same period(s) (ii)

Day

1 and 3 thereafter) until disease progression or day 47 was administered intraperitoneally with 200 μ g of anti-PDL-1 (clone 10 f.9g2bioxl).

See figure 2 for an example of experimental design of this example and re-challenge of mice showing tumor resistance in example 2.

The results of the experiment were plotted as percentage tumor free over time (fig. 3) and tumor volume measured over time (fig. 4). Significant therapeutic effects were observed with combination therapy of AR20.5 and TLR3 stimulation in combination with anti-PDL-1. These results show a potent interaction between three immunomodulators [ anti-MUC1AR20.5, anti-PDL-1 and Poly (I: C) ] and demonstrate unexpectedly potent tumor growth inhibition and anti-tumor effects.

Example 2

Re-challenge tumor-tolerant animals to confirm immunological memory and specificity

Animals from the primary challenge experiment (example 1) that did not show disease progression on day 47 received no further treatment and were observed for an additional 30 days (to day 77). If no tumor growth still occurred, Panc02.MUC1 (1X 10) was applied to one side⁶) These surviving animals were rechallenged and on the other flank control Panc02 cells (1X 10) which did not express MUC1 were used⁶) And re-challenged to determine if there was a memory response to MUC1 and evidence of epitope spreading or general immunity to other tumor antigens on Panc02 cells. Animals that were re-challenged were also observed for up to 60 days to obtain evidence of tumor growth (137 days after primary challenge and 60 days after secondary tumor challenge). (see again FIG. 2 for protocol).

A notable proportion of these mice showed antigen-specific rejection of MUC1-Panc02 cells, but not antigen-negative new control tumor cells from the opposite side (fig. 5-6). Furthermore, in the case of mice that failed to completely reject the second round of MUC1-Panc02 cell challenge, they produced significantly smaller MUC-1 tumors (6.0mm × 3.8mm × 4.8mm) 50 days after tumor cell challenge, which did not progress (18.9mm × 21.3mm × 22.3mm) compared to the control tumors (see fig. 7).

Example 3

Lymphocyte metastasis from tumor-immunized mice

Splenocytes from tumor-immunized mice immunized with AR20.5+ Poly (I: C) + anti-PDL-1 combination were harvested and cultured for 5 days, then transferred by tail vein injection to two fresh muc1.tg transgenic mice. After transfer, use 2X 10⁶Mice were challenged with MUC1-Panc02 cells at a cell/ml and tumor growth was monitored for an additional few days. Control mice that had not received prior treatment or primary challenge also received the same challenge in both flanks. The results are shown in FIG. 8. One of the two mice receiving the metastatic splenocytes was completely resistant to tumor challenge, and in the second mouse, the appearance of tumors was delayed relative to untreated control mice.

Experiments demonstrated that tumor-specific resistance is present in the spleen compartment.

Example 4

Use of antigen specific IgE in combination with TLR3 agonist and checkpoint inhibitor

Total 10 of transfectomas (expressing human MUC1) with the syngeneic rat pancreatic tumor cell line humuc1-Panc02⁶Individual cells were inoculated subcutaneously into double human transgenic C57BL6/J mice carrying both human MUC1 and the human fcepsilonr alpha chain. In this model, subcutaneous nodules containing tumors appeared within 3 weeks of injection and growth was followed until animals were sacrificed according to institutional animal care requirements.

Combination therapy includes: anti-MUC 1IgE (20. mu.g/injection) on days 7, 17, 27 and 37, Poly (I: C) on

days

8, 13, 18, 23, 28, 33, 38, 43 (50. mu.g/infusion); and anti-PDL-1 (200 μ g per injection) on

days

9, 11, 14, 16, 19, 21, 24, 26, 29, 31, 34, 36, 39, 41, and 44. Groups 8 mice were treated with n-8/group. The grouping is as follows: 1 as control; 2 ═ anti-PDL-1; 3 ═ Poly (I: C); 4-anti-PDL-1 and Poly (I: C); 5 ═ anti-MUC 1IgE alone; 6-anti-MUC 1IgE and Poly (I: C); 7 ═ anti-MUC 1IgE and anti-PDL-1; and 8 ═ both anti-MUC 1IgE and Poly (I: C) and anti-PDL-1.

The experimental design is presented in fig. 9, the tumor-free survival curve is plotted in fig. 10, and the tumor growth curve of the treatment group is plotted in fig. 11.

The results show that in FIG. 10, combination treatment with anti-MUC 1IgE, anti-PDL-1 and Poly (I: C) resulted in a substantial reduction in tumor growth during the 70+ challenge period (FIG. 10C). None of the animals from the other treatment conditions had a similar tumor growth pattern during the same challenge period (FIGS. 10A-B and D-G), showing much steeper tumor growth during the same period.

FIG. 11 shows that combination treatment with anti-MUC 1IgE, anti-PDL-1, and Poly (I: C) resulted in much lower tumor volumes over a 46 day challenge period. Tumor volumes were greater in animals of other treatment conditions, with the closest treatment groups (anti-MUC 1 and anti-PDL-1) having approximately 6.7 times greater tumor volumes at the end of the challenge period than treatment with anti-MUC 1IgE, anti-PDL-1 antibody, and Poly (I: C).

Example 5

Specificity of tumor antigens

To examine the effect of therapy on T cell memory and specificity in the treated groups, 1X 10 was used⁶Control of individual cells/ml (Panc 02-Neo-Panc02 expressing neomycin) and Panc02 cells-MUC 1-Panc02 expressing antigen were subjected to a second round of tumor challenge in mice that previously rejected the Pan02.MUC1 tumor. For a summary of the experimental protocol, see again fig. 9. The results of these experiments are shown in FIGS. 12-14.

None of the animals rejected MUC1-Panc02 or antigen negative control tumor cells (FIGS. 12A and 13A). However, mice that failed to reject the second round of MUC1-Panc02 cell challenge showed significantly smaller tumors that did not progress 57 days after tumor cell challenge compared to control tumors (see fig. 12B and 13B and fig. 14).

The results of these experiments demonstrate important interactions between the three immunomodulators [ anti-MUC 1IgE, anti-PDL-1 and Poly (I: C) ] and demonstrate potent antitumor effects of the combination.

While preferred embodiments have been described above and shown in the accompanying drawings, it will be apparent to those skilled in the art that modifications may be made without departing from the disclosure. Such modifications are considered to be possible variations included within the scope of the present disclosure.

Sequence listing

SEQ ID NO:1

<120>3C6.hIgE heavy chain variable

<212>DNA

GCCGCCACCATGTACTTGGGACTGAACTGTGTATTCATAGTTTTTCTCTTAAATGGTGTCCAGAGTGAAGTGAAGCTTGAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCTTGTGCTGCCTCTGGATTCACTTTTAGTGACGCCTGGATGGACTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGAAGCAAAGCTAATAATCATGCAACATACTATGCTGAGTCTGTGAAAGGGAGGTTCACCATCTCAAGAGATGTTTCCAAAAGTAGTGTCTACCTGCAAATGAACAACTTAAGAGCTGAAGACACTGGCATTTATTACTGTACCAGGGGGGGGTACGGCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCAGGTAAGTG

SEQ ID NO:2

<120>3C6.hIgE light chain variable

<212>DNA

GCCGCCACCATGAAGTTGCCTGTTAGGCTGTTGGTGCTGATGTTCTGGATTCCTGCTTCCAGCAGTGATGTTTTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAGCATTGTACATAGTAATGGAAACACCTATTTAGAATGGTACCTGCAGAAACCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAACGTAAGT

SEQ ID NO:3

<120>4H5.hIgE monoclonal antibody heavy chain variable region

<212>DNA

GCCGCCACCATGGGATGGAGCTGTATCATGCTCTTTTTGGTAGCAACAGCAACAGGTGTCCACTCCCAGGTCCAACTGCAGCAGTCTGGGGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGTTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTATATGTACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGAGAGATTAATCCTAGCAATGGTGGTACTGACTTCAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCAGCACAGCATACATGCAACTCAGCAGCCTGACATCTGCGGACTCTGCGGTCTATTACTGTACAAGGGGGGGTGATTACCCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGGTAAGT

SEQ ID NO:4

<120>4H5.hIgE monoclonal antibody heavy chain variable region

<212>DNA

GCCGCCACCATGGATTCACAGGCCCAGGTTCTTATGTTACTGCTGCTATGGGTATCTGGTACCTGTGGGGACATTGTGATGTCACAGTCTCCATCCTCCCTAGCTGTGTCAGTTGGAGAGAAGGTTACTATGAGCTGCAAGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAAAGAACTACTTGGCCTGGTACCAGCAGAAACCAGGGCAGTCTCCTAAACTGCTGATTTACTGGGCATCCACTAGGGAATCTGGGGTCCCTGATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTGTGAAGGCTGAAGACCTGGCAGTTTATTACTGTCAGCAATATTATAGCTATCCTCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAACGTAAGT

SEQ ID NO:5

Amino acid sequence of <120> MUC1 epitope

<212> amino acid sequence

STAPPAHGVTSAPDTRPAPG

Sequence listing

<110> Onyquist Limited

<120> tumor antigen specific antibodies and TLR3 stimulation to enhance checkpoint interference with cancer therapy

<130> P2842PC00

<150> 61/034,915

<151> 2014-08-08

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 428

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic polynucleotide

<220>

<223> 3C6.hIgE heavy chain variable:

<400> 1

gccgccacca tgtacttggg actgaactgt gtattcatag tttttctctt aaatggtgtc 60

cagagtgaag tgaagcttga ggagtctgga ggaggcttgg tgcaacctgg aggatccatg 120

aaactctctt gtgctgcctc tggattcact tttagtgacg cctggatgga ctgggtccgc 180

cagtctccag agaaggggct tgagtgggtt gctgaaatta gaagcaaagc taataatcat 240

gcaacatact atgctgagtc tgtgaaaggg aggttcacca tctcaagaga tgtttccaaa 300

agtagtgtct acctgcaaat gaacaactta agagctgaag acactggcat ttattactgt 360

accagggggg ggtacggctt tgactactgg ggccaaggca ccactctcac agtctcctca 420

ggtaagtg 428

<210> 2

<211> 409

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic polynucleotide

<220>

<223> 3C6.hlgE light chain variable

<400> 2

gccgccacca tgaagttgcc tgttaggctg ttggtgctga tgttctggat tcctgcttcc 60

agcagtgatg ttttgatgac ccaaactcca ctctccctgc ctgtcagtct tggagatcaa 120

gcctccatct cttgcagatc tagtcagagc attgtacata gtaatggaaa cacctattta 180

gaatggtacc tgcagaaacc aggccagtct ccaaagctcc tgatctacaa agtttccaac 240

cgattttctg gggtcccaga caggttcagt ggcagtggat cagggacaga tttcacactc 300

aagatcagca gagtggaggc tgaggatctg ggagtttatt actgctttca aggttcacat 360

gttccgctca cgttcggtgc tgggaccaag ctggagctga aacgtaagt 409

<210> 3

<211> 427

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic polynucleotide

<220>

<223> 4H5.hIgE monoclonal antibody heavy chain variable region

<400> 3

gccgccacca tgggatggag ctgtatcatg ctctttttgg tagcaacagc aacaggtgtc 60

cactcccagg tccaactgca gcagtctggg gctgaactgg tgaagcctgg ggcttcagtg 120

aagttgtcct gcaaggcttc tggctacacc ttcaccagct actatatgta ctgggtgaag 180

cagaggcctg gacaaggcct tgagtggatt ggagagatta atcctagcaa tggtggtact 240

gacttcaatg agaagttcaa gagcaaggcc acactgactg tagacaaatc ctccagcaca 300

gcatacatgc aactcagcag cctgacatct gcggactctg cggtctatta ctgtacaagg 360

gggggtgatt acccctggtt tgcttactgg ggccaaggga ctctggtcac tgtctctgca 420

ggtaagt 427

<210> 4

<211> 415

<212> DNA

<213> Artificial Sequence

<220>

<223> Synthetic polynucleotide

<220>

<223> 4H5.hIgE monoclonal antibody heavy chain variable region

<400> 4

gccgccacca tggattcaca ggcccaggtt cttatgttac tgctgctatg ggtatctggt 60

acctgtgggg acattgtgat gtcacagtct ccatcctccc tagctgtgtc agttggagag 120

aaggttacta tgagctgcaa gtccagtcag agccttttat atagtagcaa tcaaaagaac 180

tacttggcct ggtaccagca gaaaccaggg cagtctccta aactgctgat ttactgggca 240

tccactaggg aatctggggt ccctgatcgc ttcacaggca gtggatctgg gacagatttc 300

actctcacca tcagcagtgt gaaggctgaa gacctggcag tttattactg tcagcaatat 360

tatagctatc ctctcacgtt cggtgctggg accaagctgg agctgaaacg taagt 415

<210> 5

<211> 20

<212> PRT

<213> Homo sapiens

<220>

<223> Amino Acid Sequence of MUC1 epitope

<400> 5

Ser Thr Ala Pro Pro Ala His Gly Val Thr Ser Ala Pro Asp Thr Arg

1 5 10 15

Pro Ala Pro Gly

20

Claims

1. Use of a therapeutic monoclonal antibody specific to MUC1, a TLR3 agonist and an anti-PD-L1 antibody in the manufacture of a medicament for inhibiting cancer tumor growth in a patient in need thereof, wherein:

the therapeutic monoclonal antibody specific to MUC1 is (1) monoclonal antibody AR 20.5; or (2) a monoclonal IgE antibody having the heavy chain variable region encoded by SEQ ID NO. 1 and the light chain variable region encoded by SEQ ID NO. 2; and

the TLR3 agonist is poly ic, poly iclc; and is

Wherein the MUC1 is expressed on the cell surface of the tumor.

2. The use of claim 1, wherein the anti-PD-L1 antibody is selected from the group consisting of: B7-H1 antibody, BMS-936559 antibody, MPDL3280A antibody, MEDI-4736 antibody, MSB0010718C antibody or a combination thereof.

3. The use of claim 1 or 2, wherein the MUC1 is a soluble antigen.

4. The use of claim 1 or 2, wherein the therapeutic monoclonal antibody specific to MUC1 is monoclonal antibody AR20.5, monoclonal antibody 3c6.hige or a combination thereof.

5. The use of claim 3, wherein said therapeutic monoclonal antibody specific to MUC1 is monoclonal antibody AR20.5, monoclonal antibody 3C6.hIgE, or a combination thereof.

6. The use of claim 1, wherein the antibody specific to MUC1 is monoclonal antibody AR20.5 or monoclonal antibody 3c6.hige and the anti-PD-L1 antibody is monoclonal antibody 10 f.9g2.

7. The use of claim 1, wherein the anti-PD-L1 antibody is monoclonal antibody 10 f.9g2.

8. The use of claim 1 wherein said therapeutic monoclonal antibody specific to MUC1 has a constant region of human origin.

9. The use of any one of claims 1, 2, 5, 6, 7, or 8, wherein the cancer is selected from the group consisting of: pancreatic cancer, breast cancer, colorectal cancer, ovarian cancer, renal cancer, prostate cancer, bladder cancer, gastrointestinal cancer, lung cancer, and multiple myeloma.

10. The use of claim 3, wherein the cancer is selected from the group consisting of: pancreatic cancer, breast cancer, colorectal cancer, ovarian cancer, renal cancer, prostate cancer, bladder cancer, gastrointestinal cancer, lung cancer, and multiple myeloma.

11. The use of claim 4, wherein the cancer is selected from the group consisting of: pancreatic cancer, breast cancer, colorectal cancer, ovarian cancer, renal cancer, prostate cancer, bladder cancer, gastrointestinal cancer, lung cancer, and multiple myeloma.

12. The use of claim 1, wherein the therapeutic monoclonal antibody specific to MUC1 is formulated for administration prior to the TLR3 agonist.

13. The use of claim 1, wherein the TLR3 agonist is formulated for administration prior to the anti-PDL-1 antibody.

14. The use of claim 12, wherein the TLR3 agonist is formulated for administration prior to the anti-PDL-1 antibody.

15. The use of any one of claims 12 to 14, wherein the monoclonal antibody specific to MUC1 is formulated for administration 1 or more days prior to the TLR3 agonist.

16. The use of any one of claims 12-14, wherein the TLR3 agonist is formulated for administration 1 or more days prior to the anti-PDL-1 antibody.

17. The use of claim 1, wherein said therapeutic monoclonal antibody specific to MUC1 is a humanized monoclonal antibody.