CN106701823A - Establishment and application of CHO cell line for producing fucose-free monoclonal antibody - Google Patents

Establishment and application of CHO cell line for producing fucose-free monoclonal antibody Download PDF

Info

Publication number
CN106701823A
CN106701823A CN201710037930.8A CN201710037930A CN106701823A CN 106701823 A CN106701823 A CN 106701823A CN 201710037930 A CN201710037930 A CN 201710037930A CN 106701823 A CN106701823 A CN 106701823A
Authority
CN
China
Prior art keywords
fut8
leu
fucose
monoclonal antibody
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710037930.8A
Other languages
Chinese (zh)
Inventor
朱建伟
宗会芳
张宝红
江华
谢跃庆
韩雷
丁凯
孙涛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jacki (tianjin) Biological Medicine Co Ltd
Jecho Laboratories Inc
Shanghai Jiaotong University
Original Assignee
Jacki (tianjin) Biological Medicine Co Ltd
Jecho Laboratories Inc
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jacki (tianjin) Biological Medicine Co Ltd, Jecho Laboratories Inc, Shanghai Jiaotong University filed Critical Jacki (tianjin) Biological Medicine Co Ltd
Priority to CN201710037930.8A priority Critical patent/CN106701823A/en
Publication of CN106701823A publication Critical patent/CN106701823A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/44—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere, e.g. haptens, metals, DNA, RNA, amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/51—Complete heavy chain or Fd fragment, i.e. VH + CH1
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/515—Complete light chain, i.e. VL + CL
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses establishment and application of a CHO cell line for producing a fucose-free monoclonal antibody. A CRISPR/Cas9 technology is utilized to encode an FUT8 gene of a CHO cell to obtain the FUT8 gene silenced CHO cell line for stabilizing FUT8 gene deletion (hereinafter referred to as FUT8-/-cell line). By adopting physicochemical property and bioactivity detection of an FUT8-/-cell expressed antibody, a glycoform detection result indicates that fucose of the FUT8-/-cell expressed monoclonal antibody is completely eliminated, a fucose-containing monoclonal antibody expressed by a wild CHO cell serves as a contrast, the affinity with a Fcgamma RIIIa antigen of the fucose-free monoclonal antibody is improved by 7 times, and the ADCC effect is improved by 25 times.

Description

The Chinese hamster ovary celI system without fucose monoclonal antibody is produced to set up and its apply
Technical field
The invention belongs to technical field of bioengineering, and in particular to a kind of to produce the CHO without fucose monoclonal antibody thin Born of the same parents system sets up and its applies.
Background technology
Antibody is used primarily for before disease treatment can trace back to a century, but it is developed rapidly mainly at nearly 30 years Time.Koehler and Milstein have founded external hybridoma technology within 1975, and the monoclonal for having obtained mouse resists Body, has started New Times (Wang Zhiming, Jiang Gao and Li Geng, therapeutic monoclonal antibodies that polyclonal antibody moves towards monoclonal antibody The present situation and development trend Chinese biological engineering magazines of medicine, 2013 (06)：p.117-124).Monoclonal antibody has special Property it is high, potency is high, and purity is high, and repeatability is strong, and the advantages of low cost simultaneously can be produced largely, but mouse monoclonal antibody is applied to the mankind and has There is stronger immunogenicity, therefore limit its clinical practice.With developing rapidly for modern biotechnology, and antagonist molecule Structure and gene structure are understood in depth, and the development of antibody drug enters the genetic engineering antibody stage.By murine antibody, The development of chimeric antibody, humanized antibody and human antibody, monoclonal antibody is really possibly realized as curative drug.Closely Nian Lai, the successful preparation and application of various genetic engineering antibodies, and significantly improving for antibody producing level makes antibody drug Research and development enter a new stage for fast development.In the market have more than 30 kinds of therapeutic antibodies, be mainly used in tumour, from Treatment (Elvin, J.G., R.G.Couston, the and of body immunological disease, chronic inflammatory reaction, virus infection and organ-graft refection C.F.van der Walle, Therapeutic antibodies：Market considerations, disease Targets and bioprocessing.International Journal of Pharmaceutics, 2013.440 (1)： p.83-98.).In global medicine sales TOP10 ranking lists in 2015, biological medicament occupies 6 kinds, and its global marketing total value has surpassed Cross 45,000,000,000 dollars.Therapeutic antibodies have turned into current pharmaceutical industry and have increased most fast, one of maximum product of getting a profit.
The yield for industrially improving antibody at present mainly passes through two aspects：One is to improve anti-by modified technique parameter The expression quantity of body；Two is antagonist structure optimization, improves antibody titer.It is glycoprotein that therapeutic antibodies are most, and table is studied recently The bright different sugar chains sticked on protein not only participate in various life such as formation, aging, infection, cancerization, the metastasis of cancer of organ Phenomenon, and (Jefferis, R., Recombinant antibody can be produced a very large impact with the efficiency of antagonist therapeutics：the impact of glycosylation on mechanisms of action.Trends in Pharmacological Sciences, 2009.30 (7)：p.356-362.).
The mode that therapeutic antibodies play a role has several, most importantly by Antibody -dependent cell cytotoxicity Property effect (ADCC) and Complement Dependent cytotoxic effect (CDC) (Iannello, A.and A.Ahmad, Role of antibody-dependent cell-mediated cytotoxicity in the efficacy of therapeutic Anti-cancer monoclonal antibodies.Cancer and Metastasis Reviews, 2005.24 (4)： p.487-499.).ADCC effect be express antibody Fc acceptor (Fc γ RIIIa) NK (NK cells) by with Combined with reference to the Fc fragments of the IgG antibody on target cell (virus infected cell, cancer cell) surface, target cell is killed so as to reach Effect.There are some researches show the sugar chain structure at the Fc fragment CH2 domain Asn297 positions of IgG antibody removes fucose When, the adhesion between the Fc γ RIIIa of NK cells and the Fc fragments of IgG antibody can be strengthened, so as to strengthen the ADCC of antibody Effect (Shinkawa, T., et al., The absence of fucose but not the presence of galactose or bisecting N-acetylglucosamine of human IgG1 complex-type oligosaccharides shows the critical role of enhancing antibody-dependent Cellular cytotoxicity.J BiolChem, 2003.278 (5)：p.3466-73.).
α -1,6 fucosyl transferases (FUT8) are that catalysis fucosyl residues are turned by guanosine diphosphate (GDP)-fucose (GDP-Fuc) The last position of N- sugar chains core most inner side acetylglucosamine (GlcNAc) is moved to, the glycosyl transferase of core fucose is formed. Genetic engineering transformation can be carried out by the strain of antagonist expression cell, make the FUT8 gene silencings in cell line, so as to produce Fucosylated antibody (Malphettes, L., et al., Highly efficient deletion of FUT8 in are removed entirely CHO cell lines using zinc-finger nucleases yields cells that produce Completely nonfucosylated antibodies.BiotechnolBioeng, 2010.106 (5)：p.774-83.).
CRISPR/Cas9 systems are after Zinc finger nuclease (ZFNs), activating transcription factor sample effector nuclease Etc. (TALENs) can be used for the new gene editing technology of pointed decoration gene after.Refer to crRNA by base pairing with TracrRNA combines to form tracrRNA/crRNA compounds, and this compound guiding nuclease Cas9 albumen is matched with crRNA Target sequence shearing double-stranded DNA.Compared with ZFNs/TALENs, CRISPR/Cas9 is physically easier to perform, it is only necessary to which design is with target sequence The sgRNA of pairing is arranged, design principle is that a PAM site is closelyed follow after target sequence.It is in hgher efficiency, and can be in difference Site introduce multiple mutation (Gupta, R.M.and K.Musunuru, Expanding the genetic editing simultaneously tool kit：ZFNs, TALENs, and CRISPR-Cas9.J Clin Invest, 2014.124 (10)：p.4154-61.).
CHO-S cells are industrially in eukaryotic expression system with most host cells to express antibody.At this In invention, we enter edlin by CRISPR/Cas9 gene editings technology to the FUT8 genes in CHO-S cells, with this Function to make α -1 in cell, 6 fucosyl transferases is lost, and fucosylated antibody is removed in generation completely.
In terms of antibody fucose expression is reduced or eliminated, some researchs.(United States Patent (USP) discloses No. 20040093621) expressed by the synthesis relevant enzyme (GMD) for suppressing to synthesize substrate GDP- fucoses as fucose, so that The fucose content in antibody sugar chain is reduced, the ADCC effects of antibody are improved.(United States Patent (USP) registers No. 6602684) also has to be made 2-Acetamido-2-deoxy-D-glucose transferase is over-expressed, so as to influence the sugar chain of antibody to synthesize, is suppressed fucose and is attached to antibody Sugar-type center, reduces the content of fucose.Or the partial amino-acid residue selective mutation for passing through antagonist Fc fragments, it is allowed to Strengthen with the Fc γ RIIIa receptor binding capacities of NK cells, improve antibody ADCC effects (Moore, G.L., et al., Engineered Fc variant antibodies with enhanced ability to recruit complement And mediate effector functions.Mabs, 2010.2 (2)：P.181-189.Michaeli, Y.and Y.Reiter, Optimised Fc variants with enhanced effector function.Expert Opinion On Therapeutic Patents, 2006.16 (10)：p.1449-1452.).
(United States Patent (USP) discloses numbering the 20040110704th) is by making α -1, the knockout cell of 6 fucosyl transferases Strain reduces FUT8 expression quantity, so as to reduce fucose content.This technology mainly targets FUT8 genes by the method for RNA interference Exon2 sites；However, the gene editing technical step of RNA interference is cumbersome, complex operation need to expend substantial amounts of manpower and materials Be possible to screen the cell line for obtaining FUT8 gene functions missing.
Up to the present, it has been disclosed that patent FUT8 expression quantity is reduced by cumbersome gene code technology, reduce expression The content of the fucose of antibody.The present invention is first applied in Chinese hamster ovary celI strain transformation side CRISPR/Cas9 gene code technologies Face, method is easy, the cell line of the FUT8 gene functions inactivation of acquisition, antibody of the expression entirely without fucose.
The content of the invention
Cumbersome it is an object of the invention to overcome above-mentioned prior art to exist, time-consuming, and cost is high to wait not enough, carries Set up and its apply for a kind of Chinese hamster ovary celI system produced without fucose monoclonal antibody.
The purpose of the present invention is achieved through the following technical solutions：
In a first aspect, the present invention relates to a kind of method for building up for producing the Chinese hamster ovary celI system without fucose monoclonal antibody, institute The method of stating includes：
S1, using CRISPR/Cas9 technologies, two couples of sgRNA are designed in the exon9 regions for CHO-S cell FUT8 genes； Build FUT8 knockout carrier pX330-sgRNA1 plasmids and pX330-sgRNA2 plasmids；
S2, pX330-sgRNA1 plasmids and pX330-sgRNA2 plasmids are entered into CHO-S using lipofection cotransfection Cell, knocks out the FUT8 genes in CHO-S cells, obtains the stable FUT8 of FUT8 gene silencings-/-Cell line.
Preferably, the FUT8-/-Two allele of cell line all there occurs gene mutation.
Preferably, in described two allele one be gene frameshit, one be gene delection.
Preferably, the FUT8-/-Cell line has lentil lectin element resistance.
Preferably, in two couples of sgRNA, the base sequence of sgRNA1 as shown in SEQ ID NO.4, SEQ ID NO.5, The base sequence of sgRNA2 is as shown in SEQ ID NO.6, SEQ ID NO.7.
Preferably, in step S2, before the cotransfection, the medium culture CHO-S with CD-CHO+8mM glutamine is thin Born of the same parents, and the 12h before transfection, by CHO-S cells DMEM+10%FBS+MEMNEAA culture medium adhere-wall cultures.
Preferably, step S2 also includes the step of LCA pressurizations filter out FUT8 Knockout cells.
Second aspect, the CHO-S cell lines of the FUT8 gene silencings the invention further relates to obtain are tamed through serum free suspension Cultivate the FUT8 for obtaining-/-Cell line.
The third aspect, the method without fucose monoclonal antibody is produced the invention further relates to a kind of, and structure can express anti- The pcDNA3.1-HC heavy chain of antibody plasmid and pcDNA3.1-LC antibody light chain plasmids of body, use PEI cotransfections such as claim 1 The FUT8 that methods described is obtained-/-Cell, expression is produced entirely without fucose monoclonal antibody.
Preferably, cotransfection heavy chain of antibody and light chain, assemble after heavy chain light chain expression.
Compared with prior art, the present invention has the advantages that：
1st, relative to the gene editing technology applied before, the present invention utilizes CRISPR/Cas9 gene editing technologies, can be with Significantly more efficient to enter edlin to gene, operation is easier, and time cost is lower.
2nd, carry out after gene knockout, two allele for obtaining knock out situation and are respectively, one there occurs that frameshit is dashed forward Become, one has lacked 39 amino acid, a series of confirmatory experiments afterwards show that this cell line can stablize generation entirely without rock The antibody of algae saccharification；Illustrate the either frameshift mutation of this site be also missing from α during one section of amino acid sequence can make cell- The function of 1,6 fucosyl transferase is lost.
3rd, by detecting IgG-WT, IgG-FUT8-/-With the power of the affinity of Fc γ RIIIa parts, can obtain completely The fucosylated antibody antibody more fucosylated than wild type is gone to increased 7 times to the affinity of Fc γ RIIIa parts.
4th, IgG-WT, IgG-FUT8 are detected-/-To the ADCC effects of SK-BR-3, HepG2 cell, it can be seen that remove rock completely The antibody that the antibody of algae saccharification is more fucosylated than wild type strengthens respectively 25 times with 9 times to the ADCC effects of target cell.
Brief description of the drawings
The detailed description made to non-limiting example with reference to the following drawings by reading, further feature of the invention, Objects and advantages will become more apparent upon：
Fig. 1 is that Chinese hamster ovary celI system of the production without fucose monoclonal antibody builds schematic flow sheet；
Fig. 2 is the physicochemical property and its analysis of biological activity schematic flow sheet of antibody therein；
Fig. 3 is plasmid pX330 structural representations and insertion point sequence diagram；
Fig. 4 is FUT8 gene knockouts site schematic diagram；
Fig. 5 is the inverted microscope observation result schematic diagram after LCA dosings 6 days, wherein, A represents control group；B represents real Test group；
Fig. 6 is FUT8 purpose fragment PCR primer DNA gel electrophoretograms；
Fig. 7 is CHO-S cells and FUT8-/-It is cloned in the Cell viability contrast curve grown in shaking flask；
Fig. 8 is CHO-S cells and FUT8-/-It is cloned in the cell number contrast curve grown in shaking flask；
Fig. 9 is flow cytomery FITC-LCA and FUT8-/-(negative control is to be not added with FITC- to the affinity of clone LCA is incubated) contrast curve；
Figure 10 is that (negative control is to be not added with FITC- for the affinity of flow cytomery FITC-LCA and CHO-S cells LCA is incubated) contrast curve；
Figure 11 is Western reduction detection sugar chain digestion result schematic diagrams, wherein, 0：Marker, 1：IgG-WT digestions it Before, 2：After IgG-WT digestions, 3：IgG-FUT8-/-Before digestion, 4：IgG-FUT8-/-After digestion；
Figure 12 is that HPLC detects IgG-WT, IgG-FUT8-/-Sugar-type schematic diagram；
Figure 13 is that BIAcore detects IgG-FUT8-/-To the affinity schematic diagram of Fc γ RIIIa parts；
Figure 14 is that BIAcore detects affinity schematic diagrames of the IgG-WT to Fc γ RIIIa parts；
Figure 15 is IgG-WT, IgG-FUT8-/-ADCC effect schematic diagrames with SK-BR-3 as target cell；
Figure 16 is IgG-WT, IgG-FUT8-/-ADCC effect schematic diagrames with HepG2 as target cell；
Figure 17 is different effect targets than lower IgG-WT, IgG-FUT8-/-ADCC effect schematic diagrames with SK-BR-3 as target cell.
Specific embodiment
The present invention utilizes CRISPR/Cas9 technologies, and two are have selected in one section of gene order of CHO-S cell FUT8 genes Individual target sequence, devises two pairs of base sequences of pX330-sgRNAs, so that the section of DNA sequence on gene has been knocked out, favorably In the identification of positive monoclonal.Two couples of pX330-sgRNAs are entered into CHO-S cells using lipofection cotransfection, is knocked out FUT8 genes in CHO-S cells, have obtained the stable FUT8 of FUT8 gene silencings-/-Cell line.Sequencing result shows, obtains Two allele of stable cell line of gene knockout there occurs gene delection, obtained by primer5 software analysis Amino acid sequence shows that a sequence there occurs frameshift mutation, and another sequence has lacked 39 amino acid.With the CHO- of wild type S cell lines are compared, FUT8-/-There was no significant difference for cell strain growth property, and antagonist expression yield does not influence.
Structure can express pcDNA3.1-HC the and pcDNA3.1-LC plasmids of antibody, using PEI cotransfections wild type and FUT8-/-Cell, expression produces normal fucosylated antibody and removes fucosylated antibody completely.By to expression antibody Physicochemical property and bioactivity are detected, found to remove fucosylated antibody compared with wild type, stable in physicochemical property, sugar-type Testing result shows IgG-FUT8-/-Fucose be completely eliminated.
Using flow cytomery cell and the affinity of FITC-LCA fucose bonding agents, after gene knockout Cell overlaps with negative control, illustrates that fucose is completely eliminated from another point of view.The Fc of BIAcore methods detection antibody and NK cells The binding ability of γ RIIIa acceptors, from result it is also seen that removing the affinity of fucosylated antibody completely relative to rock algae 7 times are improve for glycosylated antibody.LDH methods detect cytotoxicity, so that detection antibody is acted on the ADCC of cancer cell.We adopt With the HER2 expression SK-BR-3 cell models high of relatively more classical checking antibody herein, as a result show go completely it is fucosylated The ADCC effects of antibody enhance about 25 times.Meanwhile, slightly lower HepG2 cells are expressed as target cell by the use of HER2, it is equally, complete Go the ADCC of fucosylated antibody to act on entirely and enhance about 9 times.
With reference to embodiment, the present invention is described in detail.Following examples will be helpful to those skilled in the art The present invention is further understood, but the invention is not limited in any way.It should be pointed out that to one of ordinary skill in the art For, without departing from the inventive concept of the premise, can also make certain adjustments and improvements.These belong to guarantor of the invention Shield scope.
Embodiment
The present embodiment is related to a kind of Chinese hamster ovary celI system produced without fucose monoclonal antibody to set up and its apply；It builds Flow and analysis process as shown in Figure 1, 2, are comprised the following steps that：
1：Build FUT8 knockout carrier PX330-sgRNA plasmids
From FUT8 genes (its mRNA sequence (CHO-WT) is as shown in SEQ ID NO.1) corresponding protein sequence (NCBI： XP_003501783.1, SEQ ID NO.12) as can be seen that being GDP- in the function that the corresponding amino acid positions of exon9 possess The binding site of fucose, GDP- fucoses can be transferred to the N- acetylamino glucan cores position of expressing protein.If This gene order is undergone mutation, then enable to α -1, the afunction of 6 fucosyl transferases.
Contain the streptococcus hspCas9 endonuclease coding sequences and U6RNA polymerases of people's codon optimization in pX330 plasmids Promoter sequence.Plasmid fraction structural representation is as shown in Figure 3.
Our the exon9 regions (sequences of FUT8 extrons 9 for FUT8 genes：SEQ ID NO.2；FUT8 extrons 9 and Its front and rear similar sequences：SEQ ID NO.3) two couples of sgRNA are devised, as shown in Figure 4.The sgRNA insertion points warp of pX330 After BbsI digestion with restriction enzyme, linear plasmid is connected with the sgRNA after two single-stranded Gradient annealings, the plasmid for connecting PX330-sgRNA (1-2) is sequenced.PX330-sgRNA base sequences are as shown in table 1 below.
The sgRNA base sequences of table 1
sgRNAs oligos DNA(5’-3’)
sgRNA1-F CACCGAGCAGCCTTCCATCCCATTG SEQ ID NO.4
sgRNA1-R AAACCAATGGGATGGAAGGCTGCT SEQ ID NO.5
sgRNA2-F CACCGTGATGACCCTTCTTTGTTAA SEQ ID NO.6
sgRNA2-R AAACTTAACAAAGAAGGGTCATCAC SEQ ID NO.7
2：Cell culture and transfection
With the medium culture CHO-S cells of CD-CHO+8mM glutamine, 12h before transfection, by CHO-S cells DMEM + 10%FBS+MEMNEAA culture medium adhere-wall cultures, with 1.2 × 105It is individual to be laid on 12 orifice plates per hole so that thin during transfection in second day Born of the same parents' degrees of fusion reaches 70%~90%.12 orifice plates transfect the μ L+400ng plasmids of liposome 2,000 1 per hole, and liquid is changed after transfection 4h, turn By passage after dye 72h, take a semicell Axygen genome extraction agents box and extract cell genomic dna, purpose piece Section PCR primer amplification.With CHO-S cell genomic dnas as template, FUT8 purpose fragments are expanded.Two inspections that PCR amplifications are used Survey primer sequence and be respectively FUT8-F：GCATATACGATACAAGGCTG(SEQ ID NO.8)；FUT8-R： CGGGCCATTTACCGTAAGTT(SEQ ID NO.9)。
3：LCA pressurizations filter out the cell of FUT8 genetic modifications
It is 100 μ g/mL, 6 days action time that preliminary experiment gropes lentil lectin element (LCA) to the lethasl concentration of CHO-S cells. In 6 orifice plates, post-processing in 2 days makees concentration for 1mg/mL to CHO-S cell cotransfection pX330-sgRNA1+pX330-sgRNA2 plasmids LCA to LCA final concentration of 100 μ g/mL, culture medium cumulative volume 2mL.What 6 orifice plate bottoms occurred after experimental group dosing 6 days is normal Morphological cellular swells, and is observed under inverted microscope, as shown in Figure 5.It can be seen that there is fucose not in the cell after transfection The cell of expression, resistance is generated to LCA.
4：Monoclonal is screened using limiting dilution assay, monoclonal is verified
Limiting dilution is laid on 96 orifice plates with the density in 0.3/hole, and bed board is given birth on the 2nd day in the slender hilum of microscopy under microscope The cell mass of the visible protuberance of naked eyes occurs after long 10 days.Continue to cultivate in transfer one semicell to multiple holes per hole, to be achieved 70% During~80% degrees of fusion, genomic DNA is extracted, purpose fragment pcr amplification product carries out DNA gel electrophoresis, as a result such as Fig. 6.Base Because of the clone after knockout, the fragment of FUT8 genes substantially lacks more than 100 bp.Positive hole cell expansion culture, PCR primer warp Sequencing is sent after TA clones, to obtain the decoration information of whole allele.PCR primer sequencing uses Takara TA cloning kits Box, converts e.colistraindh5α and send sequencing after insertion carrier T, and each sample well PCR primer send 6 escherichia coli clonings to survey Sequence.Whether sequencing result compares to determine gene knockout with NCBI-BLAST instruments and wild-type CHO cells FUT8 genes Cause frameshift mutation, as a result such as table 2.Sequence is translated using software Primer5, the amino acid sequence that will be obtained is compared It is right, as shown in table 3.It can be seen that two allele of FUT8 genes all there occurs gene mutation, one is moved for gene Code (FUT8-/-Δ122：SEQ ID NO.10)：Reduce by 122 the one of bp article of equipotentials in the 316th bit base of SEQ ID NO.10 The DNA sequence dna of gene；One is gene delection (FUT8-/-Δ117：SEQ ID NO.11)：The 309th of SEQ ID NO.11 the Bit base reduces by 117 DNA sequence dnas of bp a allele.Gene delection sequence (FUT8-/-Δ117：SEQ ID NO.11) corresponding amino acid sequence starts to lack 39 amino acid (FUT8 in the 373rd amino acids-/-Δ39：SEQ ID NO.13)；Gene frameshift sequence (FUT8-/-Δ122：SEQ ID NO.10) corresponding amino acid sequence is in the 376th amino acids Generation frameshift mutation, terminates expressing (FUT8 after 8 amino acid of mutation because running into terminator codon-/-ΔS：SEQ ID NO.14)。
The DNA sequencing comparison result of table 2
The amino acid alignment of table 3
5：FUT8-/-The identification of clone
To CHO-S cells and FUT8-/-Clone's medium culture of CD-CHO+8mM glutamine, with 2 × 105Individual/mL Cell density be inoculated in 125mL shaking flasks, working volume is 25mL, incubation time 8 days, using trypan blue counting method to cell Vigor detected, draws cell growth curve.Such as Fig. 7, shown in 8, compared with wild type CHO-S cells, FUT8-/-Clone's life In order, culture density can reach 8 × 10 to length in shaking flask6Individual/more than mL.
By CHO-S cells and FUT8-/-Clone's adhere-wall culture, adds 20 μ g/mL FITC-LCA to be incubated, and 37 DEG C are incubated 45 points Zhong Hou, cell is washed twice with PBS, and PBS is resuspended after trypsin digestion cell, carries out flow cytometry analysis, as a result such as Fig. 9,10 It is shown.Result shows FUT8-/-Clone can not be combined with FITC-LCA, and FUT8 glycosyltransferase proteins features are knocked out successfully.
6：Build the plasmid (pcDNA3.1-herceptin) of Herceptin (Trastuzumab) expression
The pcDNA3.1/myc- of the Invitrogen companies that the expression vector of recombinant antibodies is commonly used from mammalian cell His (-) expression vector, pcDNA3.1 expands resistance for amicillin resistance (Amp) in Escherichia coli, and plasmid is dynamic in lactation Resistance is neomycin resistance (Neomycin, G418) in thing cell, and heavy chain of antibody and light chain are inserted respectively into pcDNA3.1 plasmids On MCS (MCS), NheI and EcoRI is used as restriction endonuclease sites for selection.
It is 37 DEG C of incubation 1h, gel electricity by pcDNA3.1 plasmids and antibody light chain, heavy chain difference digestion, endonuclease reaction condition Gel extraction after swimming.Using the T4 ligases of Takara companies respectively by the heavy chain and light chain of antibody after linear plasmid and double digestion DNA fragmentation is connected.After the plasmid conversion bacillus coli DH 5 alpha for connecting, choosing colony PCR positive colonies are sent to Shanghai Invitrogen companies are sequenced, and heavy chain and light chain plasmids are respectively designated as pcDNA3.1-HC and pcDNA3.1-LC.
7：PEI transiently transfects condition optimizing
Be selection PEI transiently transfect CHO-S cells optimal transfection conditions, with the ratio of cell density, DNA and PEI, The concentration of DNA is factor of influence contrived experiment.Cell transfecting density is 1 × 106, 2 × 106, 3 × 106Individual/mL；DNA and PEI's Ratio is 1: 1,1: 2,1: 3；DNA concentration is 2.5,3,3.5,4 μ g/mL.Transfected by template plasmid of pEGFP plasmids.Most Good transfection conditions are：Cell transfecting density 3 × 106Individual/mL；The ratio of DNA and PEI is 1: 2；DNA concentration is 4 μ g/mL.
By CHO-S cells and FUT8-/The cell density of-clone is adjusted to 3 × 106Individual/mL, 200mL volume.With 10mL's DMEM culture mediums as dilute solution, with pcDNA3.1-HC：PcDNA3.1-LC is 1: 1 ratio, and each 400 μ g are added to DMEM In culture medium, mix.The PEI reagents of the 1mg/mL of 1600 μ g are added in above solution afterwards, is mixed, be incubated at room temperature 20min. It is added in the cell suspending liquid of 200mL, 130rpm, 37 DEG C, 5%CO2Shaking table culture case in cultivate.Treat that cell viability declines To after 50%, cell conditioned medium is collected.
8：Expression and purification
Purified using Protein A affinity columns.Purification condition is：Level pad is 20mM phosphate-buffereds Liquid (PH7.0 is prepared by disodium phosphate soln and sodium dihydrogen phosphate), elution buffer is 100mM buffered sodium citrates Liquid (PH3.0 is prepared by citric acid solution and sodium citrate solution), 50 μ L 100mM tri- are added after antibody elution per 1mL collection liquids Hydroxymethyl aminomethane-hydrochloric acid (Tris-HCl) (PH9.0) neutralizes eluent.Antibody collection liquid is carried out using 10KD super filter tubes Concentration, 8mL antibody elutions collection liquid is washed 3 times, finally by antibody with the PB of 5mM afterwards in the sub- 4000rpm of flat turn, 10min centrifugations 200 μ L are concentrated into, for analyzing.
9：To IgG-WT, IgG-FUT8-/-Sugar-type detected
Freezed after taking the albumen pre-freeze of 250 μ g, afterwards with PNGaseF glycosidase digestion system overnight digestions, passed through Whether digestion is complete for Western blot detections sugar chain, and as shown in figure 11, the post-fragment position of digestion reduces, and can speculate sugar chain It has been cut.Deproteinized is removed using cold ethanol precipitation method, centrifugal concentrating is dried.2- Para Amino Benzamides (2-AB) are utilized afterwards It is marked, 65 DEG C, 3h is purified after the completion of mark using chromatographic column with hydrophilic function.Sample is dissolved in loading in acetonitrile, point Do not washed with the acetonitrile of 100% and 96%, finally used H2O is eluted.Sample filtering, centrifugal concentrating is dried, finally with 50 μ L 60% acetonitrile sample dissolution, -20 DEG C preservation.
Sugar chain is separated using high performance liquid chromatography (HPLC) method, the ZIC-HILIC posts using Waters are prompt in peace The condition of gradient elution such as table 4 of fluoroscopic examination, analysis condition and pillar is carried out on the instrument of human relations 2000, shown in 5.Fluorescence detector Detected at 330nm and 420nm, as a result as shown in Figure 12 and table 6.It can be seen that in IgG-FUT8-/-To remove fucose completely The antibody of change.
The HPLC of table 4 detects sugar-type analysis condition
The HPLC chromatogram post condition of gradient elution of table 5
Time (min) Mobile phase A (%) Mobile phase B (%)
0 80 20
10 65 35
35 40 60
36 O 100
42 0 100
43 80 20
60 80 20
Table 6 IgG-WT, IgG-FUT8-/-In glycan structure and distribution
GlcNAc：Man：Fuc：Gal：
10：BIAcore detects IgG-WT, IgG-FUT8-/-To the affinity of Fc γ RIIIa parts
IgG-WT, IgG-FUT8 are detected using BIAcore T200-/-To the affinity of Fc γ RIIIa parts.BIAcore Induction chip CM5 carries out surface esterification with EDC/NHS, and with sodium acetate that pH is 5.5,10mM for conjugate solution, concentration is 3.33 μ Amino on the part Fc γ RIIIa of g/ml is coupled with chip, is closed with monoethanolamine afterwards.Sample is with the perseverance of 60 μ L/min Fast room temperature sample introduction, the concentration gradient of antibody is respectively IgG-FUT8-/-(29.3-333.3nM) and IgG-WT (105-1200nM). Finally regenerated with the glycine-HCI solution of 10mM.Result such as Figure 13,14 and table 7 shown in.Fucosylated resisting is gone completely Body increased 7 times than the antibody of wild type fucose to the affinity of Fc γ RIIIa parts.
The BIAcore of table 7 detects IgG-WT, IgG-FUT8-/-To the affinity of Fc γ RIIIa parts
11：Detection IgG-WT, IgG-FUT8-/-To SK-BR-3, the ADCC of HepG2 is acted on
By SK-BR-3, HepG2 is as target cell with 1 × 104Individual/hole is laid on 96 orifice plates, is cultivated in cell culture incubator Night.By the IgG-WT of various concentrations gradient, IgG-FUT8-/-Antibody is added in corresponding cell hole, 37 DEG C of incubation 20min.From will Isolated human peripheral blood mononuclear cell (PBMCs), as effector cell, is 10: 1 to imitate target ratio (E: T) in the blood of hope person Ratio is added in corresponding cell hole, orifice plate is placed in 37 DEG C of incubators and cultivates 20h, by detecting dead cell releases LDH activity detects cytotoxicity.All of experimental group all sets 3 multiple holes.The computing formula of cytotoxicity is as follows.Experiment knot Fruit such as Figure 15,16 and table 8 shown in.It is complete relative to the fucosylated antibody of wild type to the SK-BR-3 cells of HER2 expression high The medium effective concentration gone entirely in fucosylated cell its ADCC effect enhances about 25 times.And lethality during minimum killing It is larger.For expressing slightly lower HepG2 cells to HER2, the EC50 of fucosylated cell its ADCC effect is gone to enhance completely About 9 times, and highest is killed and minimum killing potency is stronger.
According to experimental result above, we then have detected in different effect targets than lower antibody to SK-BR-3 cells ADCC effects.Using SK-BR-3 as target cell with 1 × 104Individual/hole is laid on 96 orifice plates, overnight incubation in cell culture incubator.Will be dense Spend the IgG-WT for 1ng/mL, IgG-FUT8-/-Antibody is added in corresponding cell hole, 37 DEG C of incubation 20min.From volunteer's Isolated human peripheral blood mononuclear cell (PBMCs) is used as effector cell in blood, and 1: 1,2.5 are respectively to imitate target ratio (E: T): 1,5: 1,10: 1,25: 1,50: 1 ratio is added in corresponding cell hole, orifice plate is placed in 37 DEG C of incubators and cultivates 20h, Cytotoxicity is detected by the LDH activity for detecting dead cell releases.All of experimental group all sets 3 multiple holes.Experimental result is as schemed Shown in 17.Illustrate in the case where different effect targets is than level, go fucosylated antibody to be respectively provided with stronger ADCC effects completely.Facing Bed application is upper, and the patient with different immunocompetences can act as the effect of drug effect.
Table 8 IgG-WT, IgG-FUT8-/-To SK-BR-3, the ADCC of HepG2 is acted on
Specific embodiment of the invention is described above.It is to be appreciated that the invention is not limited in above-mentioned Particular implementation, those skilled in the art can within the scope of the claims make various deformations or amendments, this not shadow Sound substance of the invention.
SEQUENCE LISTING
<110>I Shanghai Communications Universitys
<120>The Chinese hamster ovary celI system without fucose monoclonal antibody is produced to set up and its apply
<130> DAG28251
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 2748
<212> DNA
<213>Chinese Hamster cell Cricetulus griseus（CHO-WT）
<400> 1
gaccatcaga aaaatacagc tagtaatttt agagaccgag gttcaagcaa taacacctat 60
ctctgcaata ccgtgtggct ttcttcaatg tcttacatcc taaggaaagg aagcatgtag 120
agcccaggaa gcacaggaca agaaagctgc ctccttgtat caccaggaag atctttttgt 180
aagagtcatc acagtatacc agagagacta attttgtctg aagcatcatg tgttgaaaca 240
acagaaactt attttcctgt gtggctaact agaaccagag tacaatgttt ccaattcttt 300
gagctccgag aagacagaag ggagttgaaa ctctgaaaat gcgggcatgg actggttcct 360
ggcgttggat tatgctcatt ctttttgcct gggggacctt attgttttat ataggtggtc 420
atttggttcg agataatgac caccctgacc attctagcag agaactctcc aagattcttg 480
caaagctgga gcgcttaaaa caacaaaatg aagacttgag gagaatggct gagtctctcc 540
gaataccaga aggccctatt gatcagggga cagctacagg aagagtccgt gttttagaag 600
aacagcttgt taaggccaaa gaacagattg aaaattacaa gaaacaagct aggaatgatc 660
tgggaaagga tcatgaaatc ttaaggagga ggattgaaaa tggagctaaa gagctctggt 720
tttttctaca aagtgaattg aagaaattaa agaaattaga aggaaacgaa ctccaaagac 780
atgcagatga aattcttttg gatttaggac atcatgaaag gtctatcatg acagatctat 840
actacctcag tcaaacagat ggagcaggtg agtggcggga aaaagaagcc aaagatctga 900
cagagctggt ccagcggaga ataacatatc tgcagaatcc caaggactgc agcaaagcca 960
gaaagctggt atgtaatatc aacaaaggct gtggctatgg atgtcaactc catcatgtgg 1020
tttactgctt catgattgct tatggcaccc agcgaacact catcttggaa tctcagaatt 1080
ggcgctatgc tactggagga tgggagactg tgtttagacc tgtaagtgag acatgcacag 1140
acaggtctgg cctctccact ggacactggt caggtgaagt gaaggacaaa aatgttcaag 1200
tggtcgagct ccccattgta gacagcctcc atcctcgtcc tccttactta cccttggctg 1260
taccagaaga ccttgcagat cgactcctga gagtccatgg tgatcctgca gtgtggtggg 1320
tatcccagtt tgtcaaatac ttgatccgtc cacaaccttg gctggaaagg gaaatagaag 1380
aaaccaccaa gaagcttggc ttcaaacatc cagttattgg agtccatgtc agacgcactg 1440
acaaagtggg aacagaagca gccttccatc ccattgagga atacatggta cacgttgaag 1500
aacattttca gcttctcgaa cgcagaatga aagtggataa aaaaagagtg tatctggcca 1560
ctgatgaccc ttctttgtta aaggaggcaa agacaaagta ctccaattat gaatttatta 1620
gtgataactc tatttcttgg tcagctggac tacacaaccg atacacagaa aattcacttc 1680
ggggcgtgat cctggatata cactttctct cccaggctga cttccttgtg tgtacttttt 1740
catcccaggt ctgtagggtt gcttatgaaa tcatgcaaac actgcatcct gatgcctctg 1800
caaacttcca ttctttagat gacatctact attttggagg ccaaaatgcc cacaaccaga 1860
ttgcagttta tcctcaccaa cctcgaacta aagaggaaat ccccatggaa cctggagata 1920
tcattggtgt ggctggaaac cattggaatg gttactctaa aggtgtcaac agaaaactag 1980
gaaaaacagg cctgtaccct tcctacaaag tccgagagaa gatagaaaca gtcaaatacc 2040
ctacatatcc tgaagctgaa aaatagagat ggagtgtaag agattaacaa cagaatttag 2100
ttcagaccat ctcagccaag cagaagaccc agactaacat atggttcatt gacagacatg 2160
ctccgcacca agagcaagtg ggaaccctca gatgctgcac tggtggaacg cctctttgtg 2220
aagggctgct gtgccctcaa gcccatgcac agtaaaataa tgtactcaca cataacatac 2280
aaatggatta ttttctactt tgccctttaa atattctgtc cccatgaaac aaacactgcc 2340
acattatgta atttaagtga cacagacgtt ttgtgtgaga cttcaaacat ggtgcctata 2400
tctgagagac ctctgtgatt tactgagaag atgagaacag ctcccttctg tggggaagtt 2460
ggttcttagt cagtggtgga ctggccactg aattcactgc aatcaacaga ttcagaatga 2520
gaatggatgt ttttccttta tatggttgtc tggatttttt ttaaagtaat ttcatcagtt 2580
cagttcatcc acctcattaa taaatgaagg aatataccaa taaaatcaaa tgaaatattc 2640
actgtccatt aggaagtttt ataaaacaat gccatgaaca aaaaattctt tagtactcaa 2700
tgtttctgga cattctcttt gataacaaaa ataaatttta aaaaggaa 2748
<210> 2
<211> 176
<212> DNA
<213>Chinese Hamster cell Cricetulus griseus
<400> 2
atgtcagacg cactgacaaa gtgggaacag aagcagcctt ccatcccatt gaggaataca 60
tggtacacgt tgaagaacat tttcagcttc tcgaacgcag aatgaaagtg gataaaaaaa 120
gagtgtatct ggccactgat gacccttctt tgttaaagga ggcaaagaca aagtaa 176
<210> 3
<211> 685
<212> DNA
<213>Chinese Hamster cell Cricetulus griseus
<400> 3
ctgttgattc caggttccca tatattcttg gatatgccaa ttactttttc tgtaagcaag 60
tgtttcataa aacttttact taactttcat attgacctgt actattcaac attcagctat 120
gttaaagtat ttgtgaagtg ttttgaaatg attttatatt ttctaaggtg agaataaatg 180
agaaaatgtt ttaatatgtc tccagtgccc ccatgactag ggatactaat tgagtaccag 240
tacattatca gtgtgctctc cacttctccc cagagtccat gtcagacgca ctgacaaagt 300
gggaacagaa gcagccttcc atcccattga ggaatacatg gtacacgttg aagaacattt 360
tcagcttctc gaacgcagaa tgaaagtgga taaaaaaaga gtgtatctgg ccactgatga 420
cccttctttg ttaaaggagg caaagacaaa gtaagttaga ccaacaagtg gttctgtatg 480
ggattatctc ttagttgaag aaaatcctta attctgggaa cttgtggttc ttgttgctaa 540
ctaataggtt ccaaaatcaa agactacatg tgcaaatatt aatctaatca agtcatacct 600
tactagctgt atctgatgca aattaagaag tctaaaatga attagactgc tgatttgtgt 660
agcatcacta gcagtcatca ttcaa 685
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> sgRNA1-F
<400> 4
caccgagcag ccttccatcc cattg 25
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> sgRNA1-R
<400> 5
aaaccaatgg gatggaaggc tgct 24
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> sgRNA2-F
<400> 6
caccgtgatg acccttcttt gttaa 25
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> sgRNA2-R
<400> 7
aaacttaaca aagaagggtc atcac 25
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> FUT8-F
<400> 8
gcatatacga tacaaggctg 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> FUT8-R
<400> 9
cgggccattt accgtaagtt 20
<210> 10
<211> 563
<212> DNA
<213>Chinese Hamster cell Cricetulus griseus（FUT8-/-Δ122）
<400> 10
ctgttgattc caggttccca tatattcttg gatatgccaa ttactttttc tgtaagcaag 60
tgtttcataa aacttttact taactttcat attgacctgt actattcaac attcagctat 120
gttaaagtat ttgtgaagtg ttttgaaatg attttatatt ttctaaggtg agaataaatg 180
agaaaatgtt ttaatatgtc tccagtgccc ccatgactag ggatactaat tgagtaccag 240
tacattatca gtgtgctctc cacttctccc cagagtccat gtcagacgca ctgacaaagt 300
gggaacagaa gcagcaggca aagacaaagt aagttagacc aacaagtggt tctgtatggg 360
attatctctt agttgaagaa aatccttaat tctgggaact tgtggttctt gttgctaact 420
aataggttcc aaaatcaaag actacatgtg caaatattaa tctaatcaag tcatacctta 480
ctagctgtat ctgatgcaaa ttaagaagtc taaaatgaat tagactgctg atttgtgtag 540
catcactagc agtcatcatt caa 563
<210> 11
<211> 568
<212> DNA
<213>Chinese Hamster cell Cricetulus griseus（FUT8-/-Δ117）
<400> 11
ctgttgattc caggttccca tatattcttg gatatgccaa ttactttttc tgtaagcaag 60
tgtttcataa aacttttact taactttcat attgacctgt actattcaac attcagctat 120
gttaaagtat ttgtgaagtg ttttgaaatg attttatatt ttctaaggtg agaataaatg 180
agaaaatgtt ttaatatgtc tccagtgccc ccatgactag ggatactaat tgagtaccag 240
tacattatca gtgtgctctc cacttctccc cagagtccat gtcagacgca ctgacaaagt 300
gggaacagat ttgttaaagg aggcaaagac aaagtaagtt agaccaacaa gtggttctgt 360
atgggattat ctcttagttg aagaaaatcc ttaattctgg gaacttgtgg ttcttgttgc 420
taactaatag gttccaaaat caaagactac atgtgcaaat attaatctaa tcaagtcata 480
ccttactagc tgtatctgat gcaaattaag aagtctaaaa tgaattagac tgctgatttg 540
tgtagcatca ctagcagtca tcattcaa 568
<210> 12
<211> 575
<212> PRT
<213>Chinese Hamster cell Cricetulus griseus（CHO-WT）
<400> 12
Met Arg Ala Trp Thr Gly Ser Trp Arg Trp Ile Met Leu Ile Leu Phe
1 5 10 15
Ala Trp Gly Thr Leu Leu Phe Tyr Ile Gly Gly His Leu Val Arg Asp
20 25 30
Asn Asp His Pro Asp His Ser Ser Arg Glu Leu Ser Lys Ile Leu Ala
35 40 45
Lys Leu Glu Arg Leu Lys Gln Gln Asn Glu Asp Leu Arg Arg Met Ala
50 55 60
Glu Ser Leu Arg Ile Pro Glu Gly Pro Ile Asp Gln Gly Thr Ala Thr
65 70 75 80
Gly Arg Val Arg Val Leu Glu Glu Gln Leu Val Lys Ala Lys Glu Gln
85 90 95
Ile Glu Asn Tyr Lys Lys Gln Ala Arg Asn Asp Leu Gly Lys Asp His
100 105 110
Glu Ile Leu Arg Arg Arg Ile Glu Asn Gly Ala Lys Glu Leu Trp Phe
115 120 125
Phe Leu Gln Ser Glu Leu Lys Lys Leu Lys Lys Leu Glu Gly Asn Glu
130 135 140
Leu Gln Arg His Ala Asp Glu Ile Leu Leu Asp Leu Gly His His Glu
145 150 155 160
Arg Ser Ile Met Thr Asp Leu Tyr Tyr Leu Ser Gln Thr Asp Gly Ala
165 170 175
Gly Glu Trp Arg Glu Lys Glu Ala Lys Asp Leu Thr Glu Leu Val Gln
180 185 190
Arg Arg Ile Thr Tyr Leu Gln Asn Pro Lys Asp Cys Ser Lys Ala Arg
195 200 205
Lys Leu Val Cys Asn Ile Asn Lys Gly Cys Gly Tyr Gly Cys Gln Leu
210 215 220
His His Val Val Tyr Cys Phe Met Ile Ala Tyr Gly Thr Gln Arg Thr
225 230 235 240
Leu Ile Leu Glu Ser Gln Asn Trp Arg Tyr Ala Thr Gly Gly Trp Glu
245 250 255
Thr Val Phe Arg Pro Val Ser Glu Thr Cys Thr Asp Arg Ser Gly Leu
260 265 270
Ser Thr Gly His Trp Ser Gly Glu Val Lys Asp Lys Asn Val Gln Val
275 280 285
Val Glu Leu Pro Ile Val Asp Ser Leu His Pro Arg Pro Pro Tyr Leu
290 295 300
Pro Leu Ala Val Pro Glu Asp Leu Ala Asp Arg Leu Leu Arg Val His
305 310 315 320
Gly Asp Pro Ala Val Trp Trp Val Ser Gln Phe Val Lys Tyr Leu Ile
325 330 335
Arg Pro Gln Pro Trp Leu Glu Arg Glu Ile Glu Glu Thr Thr Lys Lys
340 345 350
Leu Gly Phe Lys His Pro Val Ile Gly Val His Val Arg Arg Thr Asp
355 360 365
Lys Val Gly Thr Glu Ala Ala Phe His Pro Ile Glu Glu Tyr Met Val
370 375 380
His Val Glu Glu His Phe Gln Leu Leu Glu Arg Arg Met Lys Val Asp
385 390 395 400
Lys Lys Arg Val Tyr Leu Ala Thr Asp Asp Pro Ser Leu Leu Lys Glu
405 410 415
Ala Lys Thr Lys Tyr Ser Asn Tyr Glu Phe Ile Ser Asp Asn Ser Ile
420 425 430
Ser Trp Ser Ala Gly Leu His Asn Arg Tyr Thr Glu Asn Ser Leu Arg
435 440 445
Gly Val Ile Leu Asp Ile His Phe Leu Ser Gln Ala Asp Phe Leu Val
450 455 460
Cys Thr Phe Ser Ser Gln Val Cys Arg Val Ala Tyr Glu Ile Met Gln
465 470 475 480
Thr Leu His Pro Asp Ala Ser Ala Asn Phe His Ser Leu Asp Asp Ile
485 490 495
Tyr Tyr Phe Gly Gly Gln Asn Ala His Asn Gln Ile Ala Val Tyr Pro
500 505 510
His Gln Pro Arg Thr Lys Glu Glu Ile Pro Met Glu Pro Gly Asp Ile
515 520 525
Ile Gly Val Ala Gly Asn His Trp Asn Gly Tyr Ser Lys Gly Val Asn
530 535 540
Arg Lys Leu Gly Lys Thr Gly Leu Tyr Pro Ser Tyr Lys Val Arg Glu
545 550 555 560
Lys Ile Glu Thr Val Lys Tyr Pro Thr Tyr Pro Glu Ala Glu Lys
565 570 575
<210> 13
<211> 536
<212> PRT
<213>Chinese Hamster cell Cricetulus griseus（FUT8-/-Δ39）
<400> 13
Met Arg Ala Trp Thr Gly Ser Trp Arg Trp Ile Met Leu Ile Leu Phe
1 5 10 15
Ala Trp Gly Thr Leu Leu Phe Tyr Ile Gly Gly His Leu Val Arg Asp
20 25 30
Asn Asp His Pro Asp His Ser Ser Arg Glu Leu Ser Lys Ile Leu Ala
35 40 45
Lys Leu Glu Arg Leu Lys Gln Gln Asn Glu Asp Leu Arg Arg Met Ala
50 55 60
Glu Ser Leu Arg Ile Pro Glu Gly Pro Ile Asp Gln Gly Thr Ala Thr
65 70 75 80
Gly Arg Val Arg Val Leu Glu Glu Gln Leu Val Lys Ala Lys Glu Gln
85 90 95
Ile Glu Asn Tyr Lys Lys Gln Ala Arg Asn Asp Leu Gly Lys Asp His
100 105 110
Glu Ile Leu Arg Arg Arg Ile Glu Asn Gly Ala Lys Glu Leu Trp Phe
115 120 125
Phe Leu Gln Ser Glu Leu Lys Lys Leu Lys Lys Leu Glu Gly Asn Glu
130 135 140
Leu Gln Arg His Ala Asp Glu Ile Leu Leu Asp Leu Gly His His Glu
145 150 155 160
Arg Ser Ile Met Thr Asp Leu Tyr Tyr Leu Ser Gln Thr Asp Gly Ala
165 170 175
Gly Glu Trp Arg Glu Lys Glu Ala Lys Asp Leu Thr Glu Leu Val Gln
180 185 190
Arg Arg Ile Thr Tyr Leu Gln Asn Pro Lys Asp Cys Ser Lys Ala Arg
195 200 205
Lys Leu Val Cys Asn Ile Asn Lys Gly Cys Gly Tyr Gly Cys Gln Leu
210 215 220
His His Val Val Tyr Cys Phe Met Ile Ala Tyr Gly Thr Gln Arg Thr
225 230 235 240
Leu Ile Leu Glu Ser Gln Asn Trp Arg Tyr Ala Thr Gly Gly Trp Glu
245 250 255
Thr Val Phe Arg Pro Val Ser Glu Thr Cys Thr Asp Arg Ser Gly Leu
260 265 270
Ser Thr Gly His Trp Ser Gly Glu Val Lys Asp Lys Asn Val Gln Val
275 280 285
Val Glu Leu Pro Ile Val Asp Ser Leu His Pro Arg Pro Pro Tyr Leu
290 295 300
Pro Leu Ala Val Pro Glu Asp Leu Ala Asp Arg Leu Leu Arg Val His
305 310 315 320
Gly Asp Pro Ala Val Trp Trp Val Ser Gln Phe Val Lys Tyr Leu Ile
325 330 335
Arg Pro Gln Pro Trp Leu Glu Arg Glu Ile Glu Glu Thr Thr Lys Lys
340 345 350
Leu Gly Phe Lys His Pro Val Ile Gly Val His Val Arg Arg Thr Asp
355 360 365
Lys Val Gly Thr Asp Leu Leu Lys Glu Ala Lys Thr Lys Tyr Ser Asn
370 375 380
Tyr Glu Phe Ile Ser Asp Asn Ser Ile Ser Trp Ser Ala Gly Leu His
385 390 395 400
Asn Arg Tyr Thr Glu Asn Ser Leu Arg Gly Val Ile Leu Asp Ile His
405 410 415
Phe Leu Ser Gln Ala Asp Phe Leu Val Cys Thr Phe Ser Ser Gln Val
420 425 430
Cys Arg Val Ala Tyr Glu Ile Met Gln Thr Leu His Pro Asp Ala Ser
435 440 445
Ala Asn Phe His Ser Leu Asp Asp Ile Tyr Tyr Phe Gly Gly Gln Asn
450 455 460
Ala His Asn Gln Ile Ala Val Tyr Pro His Gln Pro Arg Thr Lys Glu
465 470 475 480
Glu Ile Pro Met Glu Pro Gly Asp Ile Ile Gly Val Ala Gly Asn His
485 490 495
Trp Asn Gly Tyr Ser Lys Gly Val Asn Arg Lys Leu Gly Lys Thr Gly
500 505 510
Leu Tyr Pro Ser Tyr Lys Val Arg Glu Lys Ile Glu Thr Val Lys Tyr
515 520 525
Pro Thr Tyr Pro Glu Ala Glu Lys
530 535
<210> 14
<211> 383
<212> PRT
<213>Chinese Hamster cell Cricetulus griseus（FUT8-/-ΔS）
<400> 14
Met Arg Ala Trp Thr Gly Ser Trp Arg Trp Ile Met Leu Ile Leu Phe
1 5 10 15
Ala Trp Gly Thr Leu Leu Phe Tyr Ile Gly Gly His Leu Val Arg Asp
20 25 30
Asn Asp His Pro Asp His Ser Ser Arg Glu Leu Ser Lys Ile Leu Ala
35 40 45
Lys Leu Glu Arg Leu Lys Gln Gln Asn Glu Asp Leu Arg Arg Met Ala
50 55 60
Glu Ser Leu Arg Ile Pro Glu Gly Pro Ile Asp Gln Gly Thr Ala Thr
65 70 75 80
Gly Arg Val Arg Val Leu Glu Glu Gln Leu Val Lys Ala Lys Glu Gln
85 90 95
Ile Glu Asn Tyr Lys Lys Gln Ala Arg Asn Asp Leu Gly Lys Asp His
100 105 110
Glu Ile Leu Arg Arg Arg Ile Glu Asn Gly Ala Lys Glu Leu Trp Phe
115 120 125
Phe Leu Gln Ser Glu Leu Lys Lys Leu Lys Lys Leu Glu Gly Asn Glu
130 135 140
Leu Gln Arg His Ala Asp Glu Ile Leu Leu Asp Leu Gly His His Glu
145 150 155 160
Arg Ser Ile Met Thr Asp Leu Tyr Tyr Leu Ser Gln Thr Asp Gly Ala
165 170 175
Gly Glu Trp Arg Glu Lys Glu Ala Lys Asp Leu Thr Glu Leu Val Gln
180 185 190
Arg Arg Ile Thr Tyr Leu Gln Asn Pro Lys Asp Cys Ser Lys Ala Arg
195 200 205
Lys Leu Val Cys Asn Ile Asn Lys Gly Cys Gly Tyr Gly Cys Gln Leu
210 215 220
His His Val Val Tyr Cys Phe Met Ile Ala Tyr Gly Thr Gln Arg Thr
225 230 235 240
Leu Ile Leu Glu Ser Gln Asn Trp Arg Tyr Ala Thr Gly Gly Trp Glu
245 250 255
Thr Val Phe Arg Pro Val Ser Glu Thr Cys Thr Asp Arg Ser Gly Leu
260 265 270
Ser Thr Gly His Trp Ser Gly Glu Val Lys Asp Lys Asn Val Gln Val
275 280 285
Val Glu Leu Pro Ile Val Asp Ser Leu His Pro Arg Pro Pro Tyr Leu
290 295 300
Pro Leu Ala Val Pro Glu Asp Leu Ala Asp Arg Leu Leu Arg Val His
305 310 315 320
Gly Asp Pro Ala Val Trp Trp Val Ser Gln Phe Val Lys Tyr Leu Ile
325 330 335
Arg Pro Gln Pro Trp Leu Glu Arg Glu Ile Glu Glu Thr Thr Lys Lys
340 345 350
Leu Gly Phe Lys His Pro Val Ile Gly Val His Val Arg Arg Thr Asp
355 360 365
Lys Val Gly Thr Glu Ala Ala Gly Lys Asp Lys Val Leu Gln Leu
370 375 380

Claims (10)

1. a kind of method for building up for producing the Chinese hamster ovary celI system without fucose monoclonal antibody, it is characterised in that methods described bag Include：
S1, using CRISPR/Cas9 technologies, two couples of sgRNA are designed in the exon9 regions for CHO-S cell FUT8 genes；Build FUT8 knockout carrier pX330-sgRNA1 plasmids and pX330-sgRNA2 plasmids；
S2, pX330-sgRNA1 plasmids and pX330-sgRNA2 plasmids are entered into CHO-S cells using lipofection cotransfection, The FUT8 genes in CHO-S cells are knocked out, the stable FUT8 of FUT8 gene silencings is obtained-/-Cell line.
2. the method for building up of Chinese hamster ovary celI system of the production without fucose monoclonal antibody according to claim 1, its feature exists In the FUT8-/-Two allele of cell line all there occurs gene mutation.
3. the method for building up of Chinese hamster ovary celI system of the production without fucose monoclonal antibody according to claim 2, its feature exists In one is gene frameshit in two allele, and one is gene delection.
4. the method for building up of Chinese hamster ovary celI system of the production without fucose monoclonal antibody according to claim 1, its feature exists In the FUT8-/-Cell line has lentil lectin element resistance.
5. the method for building up of Chinese hamster ovary celI system of the production without fucose monoclonal antibody according to claim 1, its feature exists In, in two couples of sgRNA, the base sequence of sgRNA1 as shown in SEQ ID NO.4, SEQ ID NO.5, the base of sgRNA2 Sequence is as shown in SEQ ID NO.6, SEQ ID NO.7.
6. the method for building up of Chinese hamster ovary celI system of the production without fucose monoclonal antibody according to claim 1, its feature exists In in step S2, before the cotransfection, with the medium culture CHO-S cells of CD-CHO+8mM glutamine, and before transfection 12h, by CHO-S cells DMEM+10%FBS+MEMNEAA culture medium adhere-wall cultures.
7. the method for building up of Chinese hamster ovary celI system of the production without fucose monoclonal antibody according to claim 1, its feature exists In step S2 also includes the step of LCA pressurizations filter out FUT8 Knockout cells.
8. a kind of FUT8-/-Cell line, it is characterised in that method obtains the CHO- of FUT8 gene silencings according to claim 1 S cell lines, FUT8 is obtained through serum free suspension domestication culture-/-Cell line.
9. it is a kind of to produce the method without fucose monoclonal antibody, it is characterised in that to build the pcDNA3.1- that can express antibody HC heavy chain of antibody plasmid and pcDNA3.1-LC antibody light chain plasmids, are obtained using PEI cotransfections method as claimed in claim 1 FUT8-/-Cell, expression is produced entirely without fucose monoclonal antibody.
10. it is according to claim 9 to produce the method without fucose monoclonal antibody, it is characterised in that cotransfection antibody Heavy chain and light chain, assemble after heavy chain light chain expression.
CN201710037930.8A 2017-01-18 2017-01-18 Establishment and application of CHO cell line for producing fucose-free monoclonal antibody Pending CN106701823A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710037930.8A CN106701823A (en) 2017-01-18 2017-01-18 Establishment and application of CHO cell line for producing fucose-free monoclonal antibody

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710037930.8A CN106701823A (en) 2017-01-18 2017-01-18 Establishment and application of CHO cell line for producing fucose-free monoclonal antibody

Publications (1)

Publication Number Publication Date
CN106701823A true CN106701823A (en) 2017-05-24

Family

ID=58907028

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710037930.8A Pending CN106701823A (en) 2017-01-18 2017-01-18 Establishment and application of CHO cell line for producing fucose-free monoclonal antibody

Country Status (1)

Country Link
CN (1) CN106701823A (en)

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107217042A (en) * 2017-07-31 2017-09-29 江苏东抗生物医药科技有限公司 A kind of genetically engineered cell system for producing no fucosylation albumen and its method for building up
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
CN109321570A (en) * 2017-07-31 2019-02-12 中国科学院上海生命科学研究院 Method and kit for the conversion of external Antibody types
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
CN110241134A (en) * 2018-03-08 2019-09-17 中国科学院上海高等研究院 A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain
CN110241133A (en) * 2018-03-08 2019-09-17 中国科学院上海高等研究院 A method of transformation CHO-K1 cell improves galactose content in antibody sugar chain
CN110320352A (en) * 2019-07-25 2019-10-11 上海轩锋生物科技有限公司 The antibody titer detection method of cell-mediated cyotoxicity based on antibody-dependant
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
CN111471655A (en) * 2020-03-19 2020-07-31 浙江正熙生物医药有限公司 Anti-human I L12/23 stable transgenic cell strain and construction method and application thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
CN113061605A (en) * 2020-07-13 2021-07-02 中山大学 Construction method and application of fucose transferase 8(FUT8) function-deficient cell strain
CN113166728A (en) * 2018-08-29 2021-07-23 联合生物制药股份有限公司 Defucosylated antibodies and their production
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
CN114457110A (en) * 2020-11-10 2022-05-10 盛禾(中国)生物制药有限公司 Method for knocking out FUT8 gene
CN114934053A (en) * 2022-06-30 2022-08-23 澳斯康生物(南通)股份有限公司 Fucosyltransferase 8-deficient CHO cell line and preparation method and application thereof
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016016842A1 (en) * 2014-07-30 2016-02-04 Zumutor Biologics, Inc. Non-fucosylated protein and methods thereof
CN105821003A (en) * 2014-12-31 2016-08-03 三生国健药业（上海）股份有限公司 Genetically engineered cell and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016016842A1 (en) * 2014-07-30 2016-02-04 Zumutor Biologics, Inc. Non-fucosylated protein and methods thereof
CN105821003A (en) * 2014-12-31 2016-08-03 三生国健药业（上海）股份有限公司 Genetically engineered cell and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
RONDA CARLOTTA等: "Accelerating genome editing in CHO cells using CRISPR Cas9 and CRISPy，a web-based target finding tool", 《BIOTECHNOLOGY AND BIOENGINEERING》 *
孙涛: "利用Crispr技术敲除CHO细胞FUT8基因生产完全无岩藻糖抗体", 《万方数据知识服务平台》 *
董润安: "《光敏化氧化反应的化学生物学》", 30 June 2016 *

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
CN109321570A (en) * 2017-07-31 2019-02-12 中国科学院上海生命科学研究院 Method and kit for the conversion of external Antibody types
CN107217042B (en) * 2017-07-31 2020-03-06 江苏东抗生物医药科技有限公司 Genetic engineering cell line for producing afucosylated protein and establishing method thereof
CN107217042A (en) * 2017-07-31 2017-09-29 江苏东抗生物医药科技有限公司 A kind of genetically engineered cell system for producing no fucosylation albumen and its method for building up
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
CN110241134A (en) * 2018-03-08 2019-09-17 中国科学院上海高等研究院 A method of transformation CHO-lec2 cell improves galactose content in antibody sugar chain
CN110241133A (en) * 2018-03-08 2019-09-17 中国科学院上海高等研究院 A method of transformation CHO-K1 cell improves galactose content in antibody sugar chain
CN113166728A (en) * 2018-08-29 2021-07-23 联合生物制药股份有限公司 Defucosylated antibodies and their production
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
CN110320352A (en) * 2019-07-25 2019-10-11 上海轩锋生物科技有限公司 The antibody titer detection method of cell-mediated cyotoxicity based on antibody-dependant
CN111471655A (en) * 2020-03-19 2020-07-31 浙江正熙生物医药有限公司 Anti-human I L12/23 stable transgenic cell strain and construction method and application thereof
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
CN113061605A (en) * 2020-07-13 2021-07-02 中山大学 Construction method and application of fucose transferase 8(FUT8) function-deficient cell strain
CN114457110A (en) * 2020-11-10 2022-05-10 盛禾(中国)生物制药有限公司 Method for knocking out FUT8 gene
CN114934053A (en) * 2022-06-30 2022-08-23 澳斯康生物(南通)股份有限公司 Fucosyltransferase 8-deficient CHO cell line and preparation method and application thereof
CN114934053B (en) * 2022-06-30 2024-02-06 澳斯康生物(南通)股份有限公司 Fucosyltransferase 8-defective CHO cell line and preparation method and application thereof

Similar Documents

Publication Publication Date Title
CN106701823A (en) Establishment and application of CHO cell line for producing fucose-free monoclonal antibody
JP3131322B2 (en) Novel α2 → 3 sialyltransferase
WO2016188449A1 (en) Single-domain antibody targeting cd47
JP2511962B2 (en) Method for producing recombinant DNA molecule
KR102338008B1 (en) A group of UDP-glycosyltransferases and their applications to catalyze sugar chain extension
JPH08505041A (en) Methods and products for use in the synthesis of oligosaccharide structures on glycoproteins or glycolipids or as free molecules, and for isolating the cloned gene sequences that determine these structures
CN107217042A (en) A kind of genetically engineered cell system for producing no fucosylation albumen and its method for building up
CN105980401A (en) Polynucleotides encoding low density lipoprotein receptor
CN105420263B (en) The production method of recombinant human fibroblast growth factor -17
CN108064266A (en) The preparation of the glycoprotein with mammal sample N- glycan in filamentous fungi
ES2893536T3 (en) Method for preparing antibody by regulating the sugar content of the antibody
CN104245932A (en) Production of recombinant proteins with simple glycoforms
JP2014012024A (en) Method for producing glycoprotein having characteristic sugar chain structure by using silkworm
JPH05504480A (en) Methods and products for the synthesis of oligosaccharide structures on glycoproteins, glycolipids or as free molecules and for the isolation of cloned genetic sequences determining these structures
CN107987153A (en) The soluble PD-1 molecules of high-affinity
US20170009266A1 (en) Process for the attachment of a galnac moiety comprising a (hetero)aryl group to a glcnac moiety, and product obtained thereby
JP6796773B2 (en) Non-fucosylated proteins and methods
Hara et al. Elucidation of the phenotypic change on the surface of Had-1 cell, a mutant cell line of mouse FM3A carcinoma cells selected by resistance to Newcastle disease virus infection
CN108018267B (en) A kind of targeting apparent gene regulation anti-hepatitis B virus molecule HBx1C and its application
WO2022095853A1 (en) Preparation for and application of lysosome-targeting nucleic acid chimera
CN106636444A (en) Application of FAM78A gene
WO2009150858A1 (en) Method for production of glycoprotein characterized by its sugar chain structure by utilizing silkworm
CN109963946B (en) Complexes and methods for inactivation of the FUT8 gene
JP4912657B2 (en) Colorectal cancer marker gene
CN116121299A (en) Method and model for marking expression of TNF-alpha in animal body

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination