CN106636105B - The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application - Google Patents
The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application Download PDFInfo
- Publication number
- CN106636105B CN106636105B CN201611170849.9A CN201611170849A CN106636105B CN 106636105 B CN106636105 B CN 106636105B CN 201611170849 A CN201611170849 A CN 201611170849A CN 106636105 B CN106636105 B CN 106636105B
- Authority
- CN
- China
- Prior art keywords
- staphylococcus aureus
- aptamer
- aureus enterotoxin
- enterotoxin
- magnetic bead
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/305—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
- C07K14/31—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56938—Staphylococcus
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/305—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Micrococcaceae (F)
- G01N2333/31—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Micrococcaceae (F) from Staphylococcus (G)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the aptamer C203 and its screening technique of a kind of staphylococcus aureus enterotoxin C 2 and application, the sequence of the aptamer C203 are as follows: AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGCACGGGCGGAAACGCCG CCGGCACAATTGTGC；Its screening technique are as follows: the external SELEX screening technique based on aptamer, using carboxyl magnetic bead as solid-phase media, using staphylococcus aureus enterotoxin C 2 as target, the aptamer for obtaining specifically binding with staphylococcus aureus enterotoxin C 2 is screened from the library ssDNA by staphylococcus aureus enterotoxin C 2 magnetic bead；Aptamer C203 of the invention can high-affinity, with high specificity in conjunction with staphylococcus aureus enterotoxin C 2.
Description
Technical field
The present invention relates to the aptamer C203 and its screening technique of a kind of staphylococcus aureus enterotoxin C 2 and answer
With.
Background technique
Staphylococcus aureus enterotoxin is the exotoxin with superantigen activity secreted by staphylococcus aureus.Gold
Staphylococcus aureus enterotoxin can be processed without antigen presenting cell, directly with the unrestricted combination of MHC class Ⅱmolecule, be formed
Compound in conjunction with the area β chain V of t lymphocyte antigen receptor, a large amount of activated T lymphocytes make its activation, proliferation, and release
The inflammatory cytokine of amplification quantity causes strong immune response, eventually leads to the damage of uncontrolled inflammation and multiple organ, causes poison
The diseases such as element shock.It is heat-resisting and only need very little dosage can further, since Staphylococcus aureus enterotoxin is relatively resistant to digest
Cause t cell response, Staphylococcus aureus enterotoxin is also by the super antigen drug as oncotherapy.
Staphylococcus aureus enterotoxin has multiple serotypes, is A type, Type B, C1 type, C2 type, C3 type, D type, E respectively
Type, G type, H-type, I type, M type, N-type, O-shaped and 1 type toxin of toxic shock syndrome, 2 type toxin of toxic shock syndrome etc.,
Middle staphylococcus aureus enterotoxin C 2 is not only related with staphylococcus aureus infections relating, while being also Staphylococcus aureus
Most super antigen drugs is applied in bacterium enterotoxin.
Detection staphylococcus aureus enterotoxin C 2 mainly uses immunological method, including precipitation reaction, agglutinating reaction,
ELISA, solid-phase RIA, biosensor etc., the knowledge that these methods use antibody to detect as staphylococcus aureus enterotoxin C 2
Other element, and the preparation of antibody is there are the period is long, complex steps, it is at high cost the deficiencies of place.In recent years, to detect golden yellow Portugal
Grape coccus Enteromycin C 2 gene is that the molecular biology method development of target is very fast, but the molecular biology methods such as PCR there are still
The technical problems such as false positive, false negative.Therefore, developing has more highly sensitive, economic, easy staphylococcus aureus intestines poison
Plain C2 new detecting technique, it is all significant for the diagnosis and treatment of Food Hygiene Surveillance, clinical infection of staphylococcus aureus etc..
Endotoxin Shock caused by staphylococcus aureus enterotoxin C 2 is treated, it is clinical to be propped up to the ill frequently with anti-inflammatory, fluid infusion etc.
Hold therapy.Current research discovery, inhibits the superantigen activity of staphylococcus aureus enterotoxin C 2, blocks inflammation in the initial stage
The generation of cascade reaction is the available strategy for treating staphylococcus aureus enterotoxin C 2 related disease.Based on this strategy, develop
Various polypeptide drugs, antibody drug, vaccine etc., it has also become staphylococcus aureus enterotoxin C 2 biotechnology new drug research
Hot spot.
The acquisition of staphylococcus aureus enterotoxin C 2 super antigen drug will be golden yellow frequently with the method for gene cloning
Aureus enterotoxin C 2 gene fragment clone in expression in escherichia coli and is purified into prokaryotic expression carrier.But this side
For purification step frequently with ion-exchange process or the affinity purification method of tape label, the former adsorbs selection poor specificity in method, after
Person's reagent cost is higher.
Aptamers are otherwise known as " synthetic antibody ", " chemical antibody ", and chemical nature is a single-stranded oligonucleotide molecule
(ssDNA or RNA) is folded into specific three dimensional structure in conjunction with target substance high-affinity and high specific.Aptamers are passed through
Phyletic evolution technology (the Systematic evolution of ligands by of index concentration ligand
Exponentialenrichment, SELEX) in-vitro screening process.Aptamer have high-affinity, high specific, can
External synthesis, can be changed by modification its function and pharmacokinetic properties, non-immunogenicity, it is economical the features such as.Based on above-mentioned
The aptamer drug of advantage exploitation can specific inhibition target function；Using aptamer as recognition component, can also open
Hair simplicity, accurately new detecting technique and efficient, economic affinity purification system.Therefore, high specific, high affine is filtered out
The aptamer of power combination staphylococcus aureus enterotoxin C 2 has important scientific research, clinic and market value.
Summary of the invention
The purpose of the present invention is to provide a kind of Staphylococcus aureus enterotoxins with high specific and high-affinity
The aptamer C203 and its screening technique of C2 and application.
The purpose of the present invention is achieved through the following technical solutions: a kind of nucleic acid adaptation of staphylococcus aureus enterotoxin C 2
Body C203, its sequence are as follows:
AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGC 40
ACGGGCGGAAACGCCGCCGGCACAATTGTGC 71
The screening technique of the aptamer C203 of the staphylococcus aureus enterotoxin C 2 is based on aptamer
External SELEX screening technique, using carboxyl magnetic bead as solid-phase media, using staphylococcus aureus enterotoxin C 2 as target,
It is screened and is obtained and staphylococcus aureus enterotoxin C 2 spy from the library ssDNA by staphylococcus aureus enterotoxin C 2 magnetic bead
The aptamer that the opposite sex combines.
The application of the aptamer C203 of the staphylococcus aureus enterotoxin C 2, it is golden yellow in separation, purifying
Application in aureus enterotoxin C 2.
The application of the aptamer C203 of the staphylococcus aureus enterotoxin C 2, in analysis detection golden yellow Portugal
Non-disease diagnostic and therapeutic method application in grape coccus Enteromycin C 2.
The application of the aptamer C203 of the staphylococcus aureus enterotoxin C 2, in staphylococcus aureus intestines
Toxin C2 is the application in the targeted therapy of effector molecule.
The application of the aptamer C203 of the staphylococcus aureus enterotoxin C 2, in treatment Staphylococcus aureus
Cause the application in related syndrome in bacterium infection and in treatment staphylococcus aureus enterotoxin C 2.
For the prior art, the present invention has the advantages that
1. aptamer C203 is non-toxic, molecular weight is small, good penetrability, is readily synthesized and marks.
2. the synthesis cost of aptamer C203 is low compared with the cost of Antibody preparation, and the period is short, favorable reproducibility.
3. aptamer C203 can high-affinity, with high specificity in conjunction with staphylococcus aureus enterotoxin C 2,
Dissociation constant is 3.05 ± 0.89nM, and it does not have identification function to other homologous proteins.
4. separation, purifying of the aptamer C203 in staphylococcus aureus enterotoxin C 2, staphylococcus aureus
The relevant food safety detection of Enteromycin C 2, the diagnosing and treating of staphylococcus aureus enterotoxin C 2 related disease are golden yellow
The diagnosing and treating of staphy lococcus infection, targeted therapy that staphylococcus aureus enterotoxin C 2 mediates etc. have extensively in terms of fields
Wealthy application prospect and important science, society, economic value.
Detailed description of the invention
Fig. 1 is the biological information simulation drawing of aptamer C203 secondary structure.
The specificity figure that Fig. 2 is fluorescence Percentage bound experimental analysis aptamer C203.In Fig. 2, abscissa is analysis
Albumen, ordinate be fluorescence Percentage bound.
Fig. 3 is the dissociation of fluorescence Percentage bound experimental analysis aptamer C203 combination staphylococcus aureus enterotoxin C 2
Constant draws curve.Dissociation constant (Kd) is 3.05 ± 0.89nM.In Fig. 3, abscissa is DNA concentration (pM), and ordinate is
Fluorescence Percentage bound.
Fig. 4 is the PBMC proliferation that CCK-8 method measures that aptamer C203 induces staphylococcus aureus enterotoxin C 2
Active effect.
Specific embodiment
The content of present invention is described in detail with embodiment with reference to the accompanying drawings of the specification:
A kind of aptamer C203 of staphylococcus aureus enterotoxin C 2, its sequence are as follows:
AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGC 40
ACGGGCGGAAACGCCGCCGGCACAATTGTGC 71
The aptamer C203 of the staphylococcus aureus enterotoxin C 2, at 25 DEG C, 100mM Na+, 1mM Mg2+
Under conditions of, space structure is as follows:
The aptamer C203 of the staphylococcus aureus enterotoxin C 2, to the 5 ' of the aptamer C203
End or 3 ' ends carry out FITC, amino, biotin, digoxin chemical modification.
The aptamer C203 of the staphylococcus aureus enterotoxin C 2 cuts the aptamer C203
The obtained product of structure of modification of short or extension or number of base replacement carries out FITC, amino, biotin, digoxin chemistry and repairs
Decorations.
The screening technique of the aptamer C203 of the staphylococcus aureus enterotoxin C 2 is based on aptamer
External SELEX screening technique, using carboxyl magnetic bead as solid-phase media, using staphylococcus aureus enterotoxin C 2 as target,
It is screened and is obtained and staphylococcus aureus enterotoxin C 2 spy from the library ssDNA by staphylococcus aureus enterotoxin C 2 magnetic bead
The aptamer that the opposite sex combines.
The screening technique of the aptamer C203 of the staphylococcus aureus enterotoxin C 2, it includes following step
It is rapid:
(1) it screens the preparation in library: preparing ssDNA pool shown in following sequence:
5’-AGGGCCGAGCTCACTTGT-N35-CCGCCGGCACAATTGTGC-3'；
(2) staphylococcus aureus enterotoxin C 2 and the coupling of carboxyl magnetic bead are prepared into staphylococcus aureus enterotoxin C 2 magnetic
Pearl；
(3) library ssDNA is subjected to hot activation processing；
(4) will through after step (3) the library ssDNA and step (2) resulting staphylococcus aureus enterotoxin C 2 magnetic bead
It is incubated for；
(5) staphylococcus aureus enterotoxin C 2 magnetic bead of the Magnetic Isolation after step (4), washes away staphylococcus aureus
Enteromycin C 2 magnetic bead surfaces are unbonded, weak binding and non-specific binding ssDNA；Heat staphylococcus aureus enterotoxin C 2
Magnetic bead collects the ssDNA with the specific binding of staphylococcus aureus enterotoxin C 2 magnetic bead, i.e. ssDNA enriched library；
(6) PCR amplification: the resulting ssDNA enriched library of step (5) is subjected to PCR amplification, wherein used in PCR amplification
Primer are as follows:
Primer P1:5 '-FAM-AGGGCCGAGCTCACTTGT-3 '
Primer P2:5 '-Biotin-GCACAATTGTGCCGGCGG-3 '；
(7) purifying of PCR product: PCR product is purified using small fragment purification kit；It will after purification
DsDNA is incubated for Streptavidin MagneSphere, in conjunction with dsDNA Streptavidin MagneSphere is washed, after dsDNA unwinding, use
Magnetic frame separation, collects supernatant；Supernatant obtains the secondary library ssDNA for the next round of screening after ethanol precipitation；
(8) Cycle Screening: time by the secondary library ssDNA of the resulting FAM label of step (7), as next round screening
Grade library, and repeat the screening process of step (3)~(7).
Embodiment one: the screening of aptamer C203
The screening technique of the aptamer C203 of the staphylococcus aureus enterotoxin C 2, it includes following step
It is rapid:
(1) screen the preparation in library: design both ends fixed area is 18 nucleotide, intermediate random areas is 35 nucleosides
SsDNA pool (the 5 '-AGGGCCGAGCTCACTTGT-N of acid35- CCGCCGGCACAATTGTGC-3 '), and student on commission's work
The synthesis of bioengineering limited liability company.
(2) staphylococcus aureus enterotoxin C 2 and carboxyl magnetic bead are coupled: the staphylococcus aureus enterotoxin C 2 egg
White to be purchased from U.S. Toxin Technology company, the carboxyl magnetic bead and its coupling reagent are purchased from U.S. Bangs
Laboratories company, the specification that operation is provided referring to manufacturer；It is golden yellow that front and back is coupled by BCA method determination of protein concentration
The variation of protein concentration in color aureus enterotoxin C 2 solution, the efficiency that couples for being computed magnetic bead is 85%；By golden yellow Portugal
Grape coccus Enteromycin C 2 magnetic bead is scattered in PBS buffer solution, 4 DEG C of preservations.
(3) take 2nmol ssDNA pool be dissolved in 500 μ L selection buffer (50mM Tris-HCl, 100mM NaCl,
1mM MgCl2, 5mM KCl, pH7.4), then handled through hot activation.Wherein, the method for hot activation processing are as follows: 95 DEG C of denaturation
After 5min, it is immediately placed on ice bath 10min in ice-water bath, is subsequently placed at room temperature 10min.
(4) will through after step (3) the library ssDNA and step (2) resulting staphylococcus aureus enterotoxin C 2 magnetic bead
(staphylococcus aureus enterotoxin C 2 carrying capacity is 100ng) and yeast tRNA (mole be the library ssDNA 5 times) mixing are simultaneously
In incubation at room temperature 1h.
(5) staphylococcus aureus enterotoxin C 2 magnetic bead of the Magnetic Isolation after step (4), with the selection containing 0.2%BSA
Buffer washes away that staphylococcus aureus enterotoxin C 2 magnetic bead surfaces are unbonded, ssDNA of weak binding and non-specific binding；So
Afterwards by staphylococcus aureus enterotoxin C 2 magnetic bead with 200 μ L ddH2O is resuspended, and after 100 DEG C of hot bath 5min, is placed in magnetic frame
1-2min collects supernatant, obtains the ssDNA with the specific binding of staphylococcus aureus enterotoxin C 2 magnetic bead, i.e. ssDNA enrichment
Library.
(6) PCR amplification: the resulting ssDNA enriched library of step (5) is added in 1mL PCRmix；Vortex oscillation is mixed
After even, dispensed by every 50 μ L of pipe and carry out PCR amplification, amplification condition are as follows: after 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 30S, 58 DEG C are moved back
Fiery 30S, 72 DEG C of extension 30S, 15-25 circulation.
Wherein contain in 1mL PCRmix: 10 × PCR buffer, 100 μ L；3 μ L of pfu enzyme；dNTP 20μL；Primer P1:5 '-
Each 3 μ L of FAM-AGGGCCGAGCTCACTTGT-3 ' and primer P2:5 '-Biotin-GCACAATTGTGCCGGCGG-3 '；It is described to draw
The equal student on commission's work bioengineering limited liability company synthesis of object P1 and primer P2.
(7) purifying of PCR product: both ends indicate the PCR product of biotin and fluorophor FAM respectively, use small fragment
Purification Kit (the small fragment purification kit be purchased from Sheng Gong bioengineering limited liability company), will after purification
DsDNA and Streptavidin MagneSphere (being purchased from Invitrogen-Dynal company) use washing buffer in 37 DEG C of incubation 20min
(5mM Tris-HCl, pH7.5,1M NaCl, 500 μM of EDTA) washing in conjunction with dsDNA Streptavidin MagneSphere three times after, use
50 μ L NaOH solutions (0.1M) make dsDNA unwinding in 37 DEG C of incubation 30min；It is separated with magnetic frame, collects supernatant, supernatant is through second
Alcohol precipitating obtains the secondary library ssDNA of FAM label, and is dissolved in selection buffer, the secondary text as next round screening
Library.
(8) screening process carries out 9 wheels altogether.Since the second wheel, the dosage of secondary library is 50pmol.
Embodiment two: the analysis of aptamer C203 sequence:
(1) after 9 wheel screenings, the library ssDNA of enrichment is collected, and entrusts the upper gloomy promise biotechnology share of the Shanghai's style limited
Company analyzes library sequence using high throughput sequencing technologies, analytic process are as follows: PCR amplification enriched library, and plus survey
Sequence connector and the part Index；Purified library is selected by gel electrophoresis；Passed through using Agilent 2100Bioanalyzer
Agilent High Sensitivity DNA Kit is to library Quality Control；Utilize Quant-iT PicogGreen dsDNA
Assay Kit quantifies library；Using 500 platform of IlluminateNextSeq, bridge is carried out by template of single-stranded library
Formula PCR amplification, sequencing primer annealing are sequenced in synthesis；And analysis is compared and is enriched with to sequencing result.
(2) using the analysis of the UNAFold network platform at 25 DEG C, 100mM Na+, 1mM Mg2+Under conditions of, aptamer
The secondary structure of C203 sequence.The secondary structure schematic diagram for analyzing aptamer C203 sequence is as shown in Figure 1.
Embodiment three: the specificity analysis of aptamer C203:
(1) the aptamer C203 of iii vitro chemical synthesis FAM label, and it is dissolved in selection buffer.
(2) referring to step (2) in embodiment one, by BSA, staphylococcus aureus toxin A, staphylococcus aureus intestines
Toxin B and Staphylococcal enterotoxin C1 couple preparation BSA magnetic bead, staphylococcus aureus intestines with carboxyl magnetic bead respectively
Toxin A magnetic bead, Staphylococcal enterotoxin B magnetic bead, Staphylococcal enterotoxin C1 magnetic bead and golden yellow grape
Coccus Enteromycin C 2 magnetic bead.Wherein, the BSA is purchased from Sigma company, the staphylococcus aureus toxin A, golden yellow Portugal
Grape coccus enterotoxin B and Staphylococcal enterotoxin C1 are purchased from Toxin Technology company of the U.S..
(3) take the 200 resulting aptamer C203 solution of μ L step (1) respectively with BSA magnetic bead made from step (2),
Staphylococcus aureus toxin A magnetic bead, Staphylococcal enterotoxin B magnetic bead, Staphylococcal enterotoxin C1 magnetic
Pearl and the mixing of staphylococcus aureus enterotoxin C 2 magnetic bead, are incubated at room temperature 1h in magazine, if blank magnetic bead is control.
(4) above-mentioned magnetic bead 3 times through step (3) are washed with 0.1%PBST, the aptamer in conjunction with above-mentioned magnetic bead,
100 DEG C of buffer are selected to boil 5min elution with 200 μ L.
(5) measure the fluorescence intensity of initial soln and eluent respectively using fluorescent quantitation instrument, calculate fluorescence Percentage bound=
(initial fluorescent intensity-elution fluorescence intensity)/initial fluorescent intensity × 100%, tentatively represents aptamer with calculated value
The Percentage bound of C203 and target molecule.
As shown in Fig. 2, the Percentage bound of aptamer C203 and staphylococcus aureus enterotoxin C 2 is all remarkably higher than it
With BSA, staphylococcus aureus toxin A, Staphylococcal enterotoxin B, Staphylococcal enterotoxin C1 knot
Conjunction rate shows that the combination of aptamer C203 and staphylococcus aureus enterotoxin C 2 has preferable specificity.
Example IV: the affinity analysis of aptamer C203
(1) take the FAM labeling nucleic acid aptamers C203 solution of various concentration respectively with staphylococcus aureus enterotoxin C 2
Magnetic bead mixing, is incubated at room temperature 1h in magazine.
(2) referring to the step (4) and step (5) in embodiment three, experiment obtains and calculates various concentration aptamer
The fluorescence Percentage bound of C203 solution and staphylococcus aureus enterotoxin C 2 magnetic bead.
(3) calculated value for utilizing fluorescence Percentage bound, draws aptamer C203 combination Staphylococcus aureus enterotoxin
The saturation binding curve of C2 calculates aptamer C203 combination Staphylococcus aureus enterotoxin by nonlinear regression analysis
The dissociation constant of C2.
As shown in figure 3, being computed aptamer C203 we obtain the saturation binding curve of aptamer C203
Dissociation constant be 3.05 ± 0.89nM, show the combination in conjunction with aptamer C203 and staphylococcus aureus enterotoxin C 2
Ability is strong, and dissociation constant is in nanomole rank.
Embodiment five: the superantigen activity of aptamer C203 inhibition staphylococcus aureus enterotoxin C 2
(1) aseptic aspiration healthy adult volunteer peripheral blood is diluted after anticoagulant heparin with equivalent RPMI1640 culture solution, is set
In on lymphocyte separation medium, it is single that acquisition human peripheral is separated using Conventional density gradients centrifugal process (2000rmp, 20min)
Nucleus (PBMCs).
(2) cell concentration is adjusted with the RPMI1640 culture solution containing 5% newborn bovine serum (NBS) and 5% Human autologous serum
It is 1~2 × 106/ mL spreads 96 orifice plates, every 100 μ L of hole.
(3) concentration that aptamer C203 is added in each group is followed successively by 0 μM, 10 μM respectively, and every hole is added final concentration of
The staphylococcus aureus enterotoxin C 2 of 250ng/mL, setting are not added staphylococcus aureus enterotoxin C 2, nucleic acid are also not added
The blank control group of aptamers C203.
(4) cell is placed in 37 DEG C, 5%CO2CO2It is cultivated in incubator, after culture for 24 hours, the CCK- of 10 μ L is added in every hole
8, continue to cultivate 4h.
(5) spectrophotometer detects every hole in the absorbance (OD) of 450nm.
As shown in figure 4, abscissa is the concentration of aptamer C203, ordinate is the OD value at 450nm.When nucleic acid is suitable
When ligand C203 is 10 μM, the proliferation water of staphylococcus aureus enterotoxin C 2 stimulation PBMCs is flat to be substantially reduced (P < 0.05),
The above results show that aptamer C203 in vitro experiment has the superantigen activity of staphylococcus aureus enterotoxin C 2
There is significantly inhibiting effect, is a kind of potential staphylococcus aureus enterotoxin C 2 inhibitor.
SEQUENCE LISTING
<110>Fuzhou General Hospital, Nanjing Military Area, PLA
<120>the aptamer C203 of staphylococcus aureus enterotoxin C 2 and its screening technique and application
<160> 3
<210> 1
<211> 71
<212> DNA
<213>artificial sequence
<400> 1
agggccgagc tcacttgtca ggtcgcctct tgcgcggcgc 40
acgggcggaa acgccgccgg cacaattgtg c 71
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<400> 2
agggccgagc tcacttgt 18
<210> 3
<211> 18
<212> DNA
<213>artificial sequence
<400> 3
gcacaattgt gccggcgg 18
Claims (3)
1. a kind of aptamer C203 of staphylococcus aureus enterotoxin C 2, it is characterised in that: its sequence such as SEQ ID
Shown in NO.1；And it is at 25 DEG C, 100mM Na+, 1mM Mg2+Under conditions of, space structure is as follows:
2. the aptamer C203 of staphylococcus aureus enterotoxin C 2 according to claim 1, it is characterised in that: right
5 ' the ends or 3 ' ends of the aptamer C203 carry out FITC, amino, biotin, digoxin chemical modification.
3. the aptamer C203 of staphylococcus aureus enterotoxin C 2 according to claim 1 or 2 is in separation, purifying
Application in staphylococcus aureus enterotoxin C 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611170849.9A CN106636105B (en) | 2016-12-16 | 2016-12-16 | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611170849.9A CN106636105B (en) | 2016-12-16 | 2016-12-16 | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636105A CN106636105A (en) | 2017-05-10 |
| CN106636105B true CN106636105B (en) | 2019-01-22 |
Family
ID=58823295
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611170849.9A Active CN106636105B (en) | 2016-12-16 | 2016-12-16 | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636105B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114634934B (en) * | 2020-12-16 | 2024-04-26 | 中国人民解放军军事科学院军事医学研究院 | Sequence of aptamer 3-2 and 2-27 for specifically recognizing staphylococcus aureus enterotoxin B and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102633867A (en) * | 2011-02-15 | 2012-08-15 | 中国科学院沈阳应用生态研究所 | Antigenically-changed enterotoxin C2 mutant, coding gene thereof, preparation thereof and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7259256B2 (en) * | 2002-10-02 | 2007-08-21 | National Chunghsing University | Primers useful in polymerase chain reaction for the identification of subtypes C1, C2 and C3 of staphylococcal enterotoxin type C |
-
2016
- 2016-12-16 CN CN201611170849.9A patent/CN106636105B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102633867A (en) * | 2011-02-15 | 2012-08-15 | 中国科学院沈阳应用生态研究所 | Antigenically-changed enterotoxin C2 mutant, coding gene thereof, preparation thereof and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Transcytosis, Antitumor Activity and Toxicity of Staphylococcal Enterotoxin C2 as an Oral Administration Protein Drug;Zhao WB等;《TOXINS》;20160630;第8卷(第6期);第1-12页 |
| 用SELEX技术筛选葡萄球菌肠毒素B特异性适配体;江丽等;《临床检验杂志》;20090630;第27卷(第6期);第420-421页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636105A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3143477B2 (en) | Method based on the use of bacteriophage for the detection of biological molecules in biological samples | |
| Peng et al. | Rapid fluorescent detection of Escherichia coli K88 based on DNA aptamer library as direct and specific reporter combined with immuno-magnetic separation | |
| CN113481204B (en) | Aptamer of protein, derivative and application thereof | |
| CN106591315B (en) | The aptamer C202 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
| KR20170078456A (en) | A method and test kit for detecting microorganisms using lamp product | |
| CN106701768B (en) | The aptamer C201 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
| CN102735669A (en) | Nucleic acid aptamer molecular beacon probe for detection of platelet-derived growth factor | |
| CN106636105B (en) | The aptamer C203 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
| KR101891406B1 (en) | DNA Aptamer Specifically Binding to Surface of Living Cell of Salmonella typhimurium and Uses Thereof | |
| CN106801059B (en) | The aptamer C205 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
| CN106854649B (en) | The aptamer C204 and its screening technique of staphylococcus aureus enterotoxin C 2 and application | |
| CN105349544A (en) | Nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A and application thereof | |
| CN110819632B (en) | Aptamer for binding to trastuzumab | |
| CN111793629B (en) | Aptamer ETA01 of pseudomonas aeruginosa exotoxin A and application thereof | |
| CA2353920A1 (en) | Test system for detecting different markers, and production and use thereof | |
| CN102766632B (en) | Golgi apparatus membrane protein GP73 nucleic acid aptamer, as well as preparation method and application thereof | |
| CN110885829B (en) | Diphtheria toxin aptamer DT05 and application thereof | |
| CN105483133A (en) | Staphylococcus aureus toxic shock syndrome toxin-1(TSST-1) aptamer T-7 and preparation method and application thereof | |
| CN110904112B (en) | Diphtheria toxin aptamer DT03 and application thereof | |
| CN110885828B (en) | Diphtheria toxin aptamer DT01 and application thereof | |
| CN110938631B (en) | Diphtheria toxin aptamer DT02 and application thereof | |
| CN110923239B (en) | Diphtheria toxin aptamer DT04 and application thereof | |
| CN110951744B (en) | Aptamer specifically binding tumor necrosis factor-alpha and application thereof | |
| CN114381460B (en) | Aptamer for detecting mumps virus, kit and application | |
| CN106480042A (en) | A kind of quick identification insulin aptamer INS2 and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |