Milk fat globule epidermal somatomedin 8 cardiac remodeling and heart failure diagnosis and control
Application in treatment
Technical field
The invention belongs to the function and application of gene, and in particular to 8 (milk fat of milk fat globule epidermal somatomedin
Globule-epidermal growth factor-factor 8, MFG-E8) cardiac remodeling and heart failure diagnosis and
Application in treatment.
Background technology
Chronic heart failure is that ventricular filling and (or) Ejection function are impaired, and heart blood discharge amount can not meet body tissue generation
Thank to the clinical syndrome of needs, be clinically mainly shown as dyspnea, tired and fluid retention, the lighter's mobility declines,
Severe one then completely loses mobility, with higher incidence and mortality rate, be most of cardiovascular disease and part other be
End stage [1] eventually of system organ disease.
With Chinese society's expanding economy, the change of resident living mode, the acceleration of aged tendency of population process and height
The prevalence of the various risk factors such as blood pressure, diabetes, cardiovascular disease and heart failure incidence continue to increase.Chinese cardiovascular
Disease report (2014) shows that there are cardiovascular patient 2.9 hundred million, wherein hyperpietic 2.7 hundred million, heart failure patient 450 in the whole nation
Ten thousand, annual direct medical cost is more than 50,000,000,000 RMB [2].Heart failure brings huge financial burden to family and society,
And become the serious great public health problem for threatening China's residents ' health and social development.
Chronic heart failure is a process for carrying out sexual development, and the appearance of its symptom be also likely to be disease accumulate for many years
Result afterwards.Once there is heart failure in patient, just stepped into the process that a progressive deteriorates, and U.S. Framingham is continuous
Research in 40 years shows that 5 years survival rates of heart failure are that 25%, women is 38% in male;10 years survival rate male are 11%, female
Property is 21%.The male patient's mean survival time (MST) for suffering from heart failure is 1.66, and women is 3.17, with malignant tumor phase
When.Although the interventional therapy and angiotensin converting enzyme inhibitor of cardiovascular disease, angiotensin receptor are short of money in recent years
The application of anti-agent and beta-blocker can improve the prognosis of part heart failure patient, but the overall survival of heart failure is still
Very low [3,4].Therefore the early diagnosis index of heart failure and active and effective intervening measure are found, it is even inverse so as to contain
The progress for turning heart failure is extremely urgent, has great scientific meaning and social meaning.
Research confirms that cardiac remodeling is the basic pathology process that heart failure occurs development.When heart is led in machinery
, under the pathological stimuli such as pressure load and various Neurohormonal factors, myocardial cell can occur to include gene expression, generation
Thank, structure and a series of mode reconstruction [5] functionally.Cardiac remodeling mainly includes myocardial hypertrophy and myocardial fibrosiies.
In general form level, cardiac remodeling, showing as local or most of or even whole ventricle wall and/or atrium wall thickening, matter more
Amount increases or thinning.Then include the hypertrophy of myocardial cell compensatory on a cellular level, such as fibroblast increases interstitial components
Grow, extracellular matrix protein degeneration, degraded, collagen protein net are interrupted and ruptured, myocardial cell is dropped with the bonding strength of matrix membrane
Low, extracellular vasoganglion is reduced, with apoptosis of cardiac muscle, myocardial structural arrangement disorder etc..On a molecular scale, myocardial cell
In core, gene phenotype pattern changes, and Embryonic genes such as β-MHC are activated, and adult form gene such as α-MHC expression declines, cell egg
White synthesis increases, and contractility is reduced, the lost of life;Meanwhile, promote the gene expression of myocardial fibrosiies to increase, such as connective tissue life
The long factor (CTGF), transforming growth factor β (TGF-β), I type and III Collagen Type VI etc., increase the stiffness index of ventricle wall, and cardiac muscle is suitable
Answering property declines [6].In recent years, many scholars are ground in a large number to the pathogenesis basis and clinical prevention of cardiac remodeling both at home and abroad
Study carefully, and find that transcription factor take part in the outer part of various kinds of cell and cell-membrane receptor and intracellular signal transduction path and core
A series of this change, including mitogen activated protein kinase (MAPKs), calcineurin (Calcineurin)/NFAT,
Janus kinases/signal transduction and transcription activator (JAK/STAT), Protein kinase C (PKC), phosphatidylinositol-3-kinase/egg
White kinase b (PI3K/AKT), Wnt/ beta-catenins (β-catenin) and transforming growth factor β (TGF-β)/Smad etc. are various
Classical signals Signal Transduction Pathways and signal path effector molecule all may be relevant with myocardial remodelling [7].
MFG-E8 is milk fat globule epidermal somatomedin 8, is found in mouse mammary epithelial cell earliest, is a kind of secretion
Type glycoprotein, increasing research find its wide expression [8] in Various Tissues, cell.People MFG-E8 gene mapping in
15q25, is made up of 8 exons, in macrophage, breast epithelial cell, epidermis cell, normal and atherosis dynamic
The expression of MFG-E8 is detected in arteries and veins, heart, liver, lungs, intestinal tissue, and proves that its expression is associated with various diseases
[9].The N- ends of initial MFG-E8 have a signal peptide sequence to guide which to enter endochylema.MFG-E8 is protected by the height that its N- end includes
The integrin alpha on arginine-glycine-aspartic acid acid (RGD) the motif discovery phagocyte surface keptVβ3/αVβ5, by C-
Labile factor/VIII spline structure the domain at end is bound to the Phosphatidylserine on apoptotic cell surface, the phagocytosis of mediated apoptosis cell.
As can be seen here, the two domains remove the function most important [10,11] of apoptotic cell to MFG-E8.Additionally, in people and Mus
The apoptosis of chrotoplast can trigger MFG-E8 and be discharged with the dependent forms of caspase-3 and made by the phosphorylation of STAT3
Macrophage is reprogrammed into anti-inflammatory cells.The macrophage of recombiant protein MFG-E8 pretreatment can pass through under LPS stimulations
STAT3 approach causes the work for suppressing cytokine signaling 3 (Suppressor of cytokine signaling 3, SOCS3)
Change [12,13].Additionally, increasing research lays particular emphasis on effects of the MFG-E8 in terms of tumor.Research finds MFG-E8 expression
In kinds of tumor cells, such as thyroid carcinoma, carcinoma of prostate, melanoma, breast carcinoma, colon cancer and lymphatic cancer etc..It is reported that
MFG-E8 can induce phagocytosis hemangioendothelioma [14].Carry out one of Jinushi et al. has been determined essentially from CSC
The MFG-E8 of associated macrophages, plays a major role on the drug resistance of triggering oncogenicity and tumor stem cell cancer therapy drug
[15].Another research shows that MFG-E8 is probably the mark of melanoma tumor progress, and MFG-E8 expression is to melanoma
It is independent and significant prognosis malas factor.Additionally, they demonstrate MFG-E8 and can strengthen the anti-apoptotic of melanoma cell, lure
Lead epithelium mesenchyme conversion (Epithelial-mesenchymal transition, EMT), stimulate invasion and attack and angiogenesis, and
The mouse melanin tumor cell of MFG-E8 silences shows the EMT phenotypes for weakening, and basement membrane experiment shows impaired invasive
[16].MFG-E8 is by causing FoxP3+Regulatory T cells infiltrate and suppress NK cells and CD8+The cytotoxicity of T cell promotees
Enter the immunosuppressant [17] of local.
List of references:
1.von Lueder TG,Krum H.New medical therapies for heart failure.Nature
reviews Cardiology.2015Dec;12(12):730-40.
2. Chen Wei is big, Gao Runlin, Liu Lisheng, Zhu Manlu, Wang Wen, Wang Yongjun, Wu Zhaosu, Li Huijun, Zheng Zhe, Jiang Lixin,
Hu Shengshou.《Chinese cardiovascular diseasess' report 2014》Summary. China circulation magazine .2015;30(7):617-22.
3.Krum H.Decade in review--heart failure:10Years of progress in HF
research--what have we learnedNature reviews Cardiology.2014 Nov;11(11):631-
3.
4.Roger VL,Weston SA,Redfield MM,Hellermann-Homan JP,Killian J,Yawn
BP,Jacobsen SJ.Trends in heart failure incidence and survival in a community-
based population.Jama.2004 Jul 21;292(3):344-50.
5.Frey N,Olson EN.Cardiac hypertrophy:the good,the bad,and the
ugly.Annual review of physiology.2003;65:45-79.
6.Hill JA,Olson EN.Cardiac plasticity.The New England journal of
medicine.2008Mar 27;358(13):1370-80.
7.Heineke,J.and J.D.Molkentin,Regulation of cardiac hypertrophy by
intracellular signalling pathways.Nat Rev Mol Cell Biol,2006.7(8):p.589-600.
8.Aziz M,Jacob A,Matsuda A,Wang P.Review:milk fat globule-EGF factor
8expression,function and plausible signal transduction in resolving
inflammation.Apoptosis.2011,16(11):1077-86
9.Qiang X,Li J,Wu R,Ji Y,Chaung W,Dong W,Wang P.Expression and
characterization of recombinant human milk fat globule-EGF factor VIII.Int J
Mol Med.2011,28(6):1071-6.
10.Aziz M,Yang WL,Corbo LM,Chaung WW,Matsuo S,Wang P.MFG-E8inhibits
neutrophil migration throughαvβ3-integrin-dependent MAP kinase activation.Int
J Mol Med.2015,36(1):18-28.
11.Hanayama R,Miyasaka K,Nakaya M,Nagata S.MFG-E8-dependent clearance
of apoptotic cells,and autoimmunity caused by its failure.Curr Dir
Autoimmun.2006;9:162-72.
12.Aziz M,Jacob A,Matsuda A,Wu R,Zhou M,et al.Pre-treatment of
recombinant mouse MFG-E8downregulates LPS-induced TNF-αproduction in
macrophages via STAT3-mediated SOCS3activation.PLoS One.2011;6(11):e27685.
13.Soki FN,Koh AJ,Jones JD,Kim YW,Dai J,et al.Polarization of
prostate cancer-associated macrophages is induced by milk fat globule-EGF
factor 8(MFG-E8)-mediated efferocytosis.J Biol Chem.2014,29;289(35):24560-72.
14.Aziz MM,Ishihara S,Mishima Y,et al.MFG-E8attenuates intestinal
inflammation in murine experimental colitis by modulating osteopontin-
dependent alphavbeta3integrin signaling.J Immunol.2009,182(11):7222-32.
15.Jinushi M,Chiba S,Yoshiyama H,Masutomi K,Kinoshita I,et al.Tumor-
associated macrophages regulate tumorigenicity and anticancer drug responses
of cancer stem/initiating cells.Proc Natl Acad Sci USA.2011,26;108(30):12425-
30.
16.Jinushi M,Nakazaki Y,Carrasco DR,Draganov D,Souders N,et al.Milk
fat globule EGF-8promotes melanoma progression through coordinated Akt and
twist signaling in the tumor microenvironment.Cancer Res.2008 Nov 1;68(21):
8889-98.
17.Jinushi M,Sato M,Kanamoto A,Itoh A,Nagai S,et al.Milk fat globule
epidermal growth factor-8 blockade triggers tumor destruction through
coordinated cell-autonomous and immune-mediated mechanisms.J Exp Med.2009 Jun
8;206(6):1317-26.
The content of the invention
To improve the defect and deficiency of clinical prevention cardiac remodeling and heart failure prior art, it is an object of the invention to
Determine the mutual relation between the expression of MFG-E8 and cardiac remodeling and heart failure, and MFG-E8 is in its pathological process
Function with effect, there is provided one be used for diagnose and treat cardiac remodeling and heart failure target gene MFG-E8 new application,
And then be applied to prepare diagnosis and the medicine of cardiac remodeling and heart failure by MFG-E8 genes.
The purpose of the present invention is achieved through the following technical solutions:
1st, serum MFG-E8 protein levels and cardiac remodeling and heart failure severity are closely related
The present invention chooses the patients with heart failure 162 for being diagnosed as dilated cardiomyopathy (DCM), hypertrophic cardiomyopathy (HCM)
Patients with heart failure 43, and 100 physical examination of healthy population are healthy control group (Control), and collection determination of serum MFG-E8 contains
Amount, and evaluated by measuring Left Ventricular Ejection Fraction (LVEF), LVED (Left Ventricular End Systolic Dimension) (LVEDd), interventricular septal thickness (IVsd)
Cardiac function.As a result show, serum MFG-E8 protein levels are significantly reduced in the Patients with Cardiac Failure such as DCM and HCM.More importantly
Pearson Simple correlation analysis show that MFG-E8 levels and Left Ventricular Ejection Fraction (LVEF) are in positive in DCM patients serums
Close (r=0.5975, p<0.0001), and with LVED (Left Ventricular End Systolic Dimension) (LVEDd) in negative correlation (r=-0.3551, p<
0.0001);In HCM patients serums, MFG-E8 levels and interventricular septal thickness (IVSd) are in negative correlation (r=-03987, p=
0.0081).In addition, by patient according to USA New York cardiology meeting (NYHA) cardiac functional grading, it is found that NYHA is classified higher blood
Clear MFG-E8 levels are lower.Result above shows, serum MFG-E8 protein levels and cardiac remodeling and heart failure severity
It is closely related.
2nd, MFG-E8 gene knockouts significantly promote the generation development and the deterioration of cardiac function of cardiac remodeling
The present invention is tested from wild-type mice, MFG-E8 knock out mice, and every kind of mice is divided into does evil through another person
Art group and operation group, every group of 12-15 mice.Operation group gives aorta arch constriction operation, and sham operated rats refuse aortic arch
Constriction, then carries out the survey of plump cardiac myocytes, fibrosiss and cardiac function by each group mice to sham operated rats and operation group
It is fixed, study the impact of the cardiac remodeling that MFG-E8 gene knockouts are induced to aorta arch constriction.As a result caused by showing to knock out gene
MFG-E8 defects significantly promote cardiac remodeling generation development and cardiac function deterioration.
3rd, MFG-E8 gene overexpressions significantly suppress the generation development and the deterioration of cardiac function of cardiac remodeling
The present invention selects heartspecific MFG-E8 transgenic mices and nontransgenic mice to be tested, and will be every kind of little
Mus are divided into sham operated rats and operation group, every group of 12-15 mice.Operation group gives aorta arch constriction operation, and sham operated rats are not
Give aorta arch constriction, then by each group mice to sham operated rats and operation group carry out cardiac myocytes plump, fibrosiss and
The measure of cardiac function, studies the impact of the cardiac remodeling that MFG-E8 gene overexpressions are induced to aorta arch constriction.As a result show
Overexpression MFG-E8 genes significantly suppress the generation development and the deterioration of cardiac function of cardiac remodeling.
4th, the cardiac muscle that MFG-E8 interference (AdshMFG-E8) and overexpression (AdMFG-E8) adenoviruss are induced to Jing Ang II
The impact of cellular mast model
The present invention infects SD neonatal rat primary cardiomyocytes by building recombinant adenoviruss AdshMFG-E8 and AdMFG-E8, gives
Stimulated with Ang II and build cardiac myocyte hypertrophy model, matched group then gives PBS, the monitoring of Jing immunofluorescences and myocardial cell surface
Product statistics shows that MFG-E8 viral interferences are obviously promoted cardiac myocyte hypertrophy in the case where Ang II stimulate, and myocardial cell surface product increases
Greatly;MFG-E8 overexpression viruses significantly inhibit cardiac myocyte hypertrophy, and myocardial cell surface product reduces.
From the above results in patients with heart failure, expression and cardiac remodeling and the serious journey of heart failure of MFG-E8
Degree is closely related.In addition, in coarctation of aorta art causes cardiac remodeling model, suppressing MFG-E8 expression to significantly promote cardiac muscle
The deterioration of plump, myocardial fibrosiies and cardiac function, and promote MFG-E8 expression then to suppress myocardial hypertrophy, myocardial fibrosiies, change
Mercy function.The research of the present invention is demonstrated:The expression of MFG-E8 has close phase with the generation development of heart failure
Guan Xing, and MFG-E8 has suppression cardiac remodeling, improves the effect of cardiac function.
A kind of functions of MFG-E8 in the diagnosis and treatment of cardiac remodeling and heart failure and effect, are mainly reflected in
The level height of MFG-E8 is closely related with the order of severity of cardiac remodeling and heart failure, can be used as diagnosis of heart failure
Biological indicator.In addition, MFG-E8 has cardiac function protecting, suppresses the effect of myocardial hypertrophy and cardiac fibrosis.
For the above-mentioned functions of MFG-E8, the present invention provides MFG-E8 and examines preparing cardiac remodeling as a kind of detection target
Application in disconnected reagent or heart failure early diagnosiss reagent.Described diagnostic reagent includes specific amplification MFG-E8 genes
Antibody or part of primer, the probe of specific recognition MFG-E8 gene or specific binding MFG-E8 etc..It is described by adopting
In diagnostic reagent detection measuring samples, the expression or protein level of MFG-E8 genes is located with which level in standard sample
Difference, the diagnosis or the diagnosis of heart failure early stage of cardiac remodeling are carried out according to testing result.
For the above-mentioned functions of MFG-E8, the present invention also provides MFG-E8 and is screening or preparing cardioprotection function, the anti-heart
Application in myofibrosises and/or prevention, the medicine alleviated and/or treat cardiac remodeling and heart failure, described heart weight
Structure mainly includes myocardial hypertrophy, myocardial fibrosiies.The application includes:MFG-E8 is directly as cardioprotection function, anti-cardiac muscle
Fibrosiss and/or prevention, the effective ingredient of the medicine or medicine alleviated and/or treat cardiac remodeling and heart failure;Screening bag
Include and can promote MFG-E8 expression or strengthen the chemical substance of MFG-E8 effects indirectly as cardioprotection function, anti-cardiac muscle fiber
The effective ingredient of the medicine or medicine change and/or prevent, alleviating and/or treat cardiac remodeling and heart failure.Above-mentioned application is
The purpose of non-diagnostic and non-treatment.
The present invention has advantages below and effect relative to prior art:
(1) present invention discover that the MFG-E8 levels in Patients with Cardiac Failure serum are substantially reduced, and with cardiac remodeling and mental and physical efforts
The exhaustion order of severity is significantly correlated.
(2) present invention discover that the New function of MFG-E8 genes, i.e. MFG-E8 genes have suppresses myocardial hypertrophy and its fiber
Change, improve the effect of cardiac function.
(3) dependency developed with heart failure generation based on MFG-E8, which can be used for preparing cardiac remodeling and mental and physical efforts
The diagnostic reagent of exhaustion.
(4) myocardial hypertrophy and its Fibrotic effect are suppressed based on MFG-E8, which can apply to prepare prevention, alleviates
And/or the medicine for the treatment of myocardial hypertrophy and its fibrotic disease.
Description of the drawings
During Fig. 1 is Normal group (Ctrl), expansion cardiopathia patient's group (DCM) and fertile cardiopathia patient (HCM) group serum
MFG-E8 horizontal comparing result block diagram (* * *:P < 0.001;n.s.:It is not significantly different from).
Fig. 2 is MFG-E8 levels and Left Ventricular Ejection Fraction (LVEF), LVED (Left Ventricular End Systolic Dimension) in DCM patients serums
(LVEDd) correlation analysiss result figure.
Fig. 3 is the correlation analysiss result figure of MFG-E8 levels and interventricular septal thickness (IVSd) in HCM patients serums.
Fig. 4 is the MFG-E8 levels contrast of the DCM patients serums of different New York Heart disease association (NYHA) cardiac functional gradings
As a result block diagram (* * *:P < 0.001;n.s.:It is not significantly different from).
Fig. 5 is the construction strategy of heartspecific MFG-E8 transgenic mices and MFG-E8 protein expression result figures.Wherein,
A is construction strategy figure;B is expressing quantity result figure, and in figure, TG1-TG4 is the MFG-E8 transgenic mices of Different Individual.
Fig. 6 is wild type (WT) and MFG-E8 gene knockouts (KO) mice AB arts HW/BW, HW/TL statistical results chart after 4 weeks
(*:P < 0.05;#:P < are 0.05).
Fig. 7 is the H&E dyeing after heart tissue sections after 4 weeks of wild type (WT) and MFG-E8 gene knockouts (KO) mice AB arts
And cardiomyocytes cross-sectional area statistics block diagram (*:P < 0.05vs WT Sham groups;#:P < 0.05vs WT AB groups).
Fig. 8 is the PSR dyeing after heart tissue sections after 4 weeks of wild type (WT) and MFG-E8 gene knockouts (KO) mice AB arts
And Myocardial Interstitial Fibrosis area statistics block diagram (*:P < 0.05vs WT Sham groups;#:P < 0.05vs WT AB groups).
Fig. 9 is wild type (WT) and MFG-E8 gene knockouts (KO) the mice AB arts plump mark of heart tissue Myocardial after 4 weeks
Will thing Anp, Bnp, Myh7 and myocardial fibrosiies mark CTGF, Collagen I (Col1) and Collagen III (Col3)
MRNA level in-site statistics block diagram (*:P < 0.05vs WT Sham groups;#:P < 0.05vs WT AB groups).
Figure 10 be wild type (WT) and MFG-E8 gene knockouts (KO) mice AB arts after 4 weeks ultrasound detection cardiac function result system
Meter block diagram, in figure, LVEDD is LVED (Left Ventricular End Systolic Dimension), LVESD is left room end systolic diameter, FS is that left room short axle contracts
Short rate (*:P < 0.05;#:P < are 0.05).
Figure 11 is non-transgenic (NTG) and heartspecific MFG-E8 transgenic mices (TG) mice AB arts HW/ after 4 weeks
BW, HW/TL statistical results chart (*:P < 0.05;#:P < are 0.05).
Figure 12 is non-transgenic (NTG) and heartspecific MFG-E8 transgenic mices (TG) mice AB arts heart after 4 weeks
H&E dyeing and cardiomyocytes cross-sectional area statistics block diagram (* after tissue slice:P < 0.05vs WT Sham groups;#:P <
0.05vs WT AB groups).
Figure 13 is non-transgenic (NTG) and heartspecific MFG-E8 transgenic mices (TG) mice AB arts heart after 4 weeks
PSR dyeing and Myocardial Interstitial Fibrosis area statistics block diagram (* after tissue slice:P < 0.05vs WT Sham groups;#:P <
0.05vs WT AB groups).
Figure 14 is non-transgenic (NTG) and heartspecific MFG-E8 transgenic mices (TG) mice AB arts heart after 4 weeks
Organization center flesh plumpness mark Anp, Bnp, Myh7 and myocardial fibrosiies mark CTGF, Collagen I and Collagen
The mRNA level in-site statistics block diagram (* of III:P < 0.05WT Sham groups;#:P < 0.05vs WT AB groups).
Figure 15 is that non-transgenic (NTG) and heartspecific MFG-E8 transgenic mices (TG) mice AB arts are ultrasonic after 4 weeks
Detection cardiac function result statistics block diagram, in figure, LVEDD is LVED (Left Ventricular End Systolic Dimension), LVESD in left room end-systole
Footpath, FS are left LVSF (*:P < 0.05;#:P < are 0.05).
Figure 16 be after SD neonatal rat primary cardiomyocytes In vitro culture with adenoviruss AdshRNA, AdshMFG-E8, AdGFP,
AdMFG-E8 infects, and the post-stimulatory immunofluorescences of Jing Ang II and cell surface product count block diagram (*:P < 0.05vs
AdshRNA/AdGFP PBS groups;#:II group of p < 0.05vs AdshRNA/AdGFP Ang).
Specific embodiment
The detailed description of one step is carried out to the present invention with reference to embodiment and accompanying drawing, but embodiments of the present invention are not
It is limited to this.
1 serum MFG-E8 protein levels of embodiment and cardiac remodeling and the serious correlation research of heart failure
1. object of study:Selection is diagnosed as the patients with heart failure of dilated cardiomyopathy (DCM) and hypertrophic cardiomyopathy (HCM),
DCM patients with heart failure 162, HCM patients with heart failure 43 are included wherein.In-patient is according to USA New York cardiology meeting (NYHA)
Standard carries out cardiac functional grading.Healthy control group (Control) is 100 physical examination of healthy population.The Baseline Data of object of study is shown in
Table 1.
Table 1
2. serum collection:Early morning gathers venous blood 5mL on an empty stomach, after 1500r/min centrifugation 5min, collects serum, -80 DEG C of jellies
Deposit.
3. the measure of serum MFG-E8 levels:Serum MFG-E8 assays adopt ELISA method, and used kit is human milk
Fat ball epidermal growth factor 8 (MFG-E8) ELISA kit, provides (DFGE80) by R&D SYSTEMS companies of the U.S..
4. statistical method:Measurement data is represented with mean ± standard deviation, is compared using t inspections, multigroup number between two groups of data
According to relatively adopt variance analysis test, bivariate is related to adopt Pearson Simple correlation analysis.With P<0.05 is difference
It is statistically significant.
Analysis result shows that MFG-E8 protein levels significantly reduce (1 He of table in the Patients with Cardiac Failure such as DCM and HCM in serum
Fig. 1).More importantly Pearson Simple correlation analysis show, MFG-E8 levels and left ventricular ejection in DCM patients serums
Fraction (LVEF) is proportionate (Fig. 2, r=0.5975, p<0.0001), and with LVED (Left Ventricular End Systolic Dimension) (LVEDd) in negative
Close (Fig. 2, r=-0.3551, p<0.0001);In HCM patients serums, MFG-E8 levels and interventricular septal thickness (IVSd) are in negative
Close (Fig. 3, r=-03987, p=0.0081).In addition, by patient according to USA New York cardiology meeting (NYHA) cardiac function point
Level, it is found that NYHA is classified higher MFG-E8 serum levels lower (table 2, Fig. 4).
Table 2
NYHA is classified |
Number of cases (%) |
LVEF (%) |
MFG-E8(pg/mL) |
II |
33(20.4) |
46.5±11.7 |
3977.2±1254.7 |
III |
83(51.2) |
32.1±6.8 |
2918.1±1027.4 |
IV |
46(28.4) |
25.7±6.5 |
2303.4±1010.5 |
Result above shows that serum MFG-E8 protein levels are closely related with cardiac remodeling and heart failure severity.
2 animal for research of embodiment and raising
1. laboratory animal:From 8-10 week old, body weight 23.5-27.5g, background is the C57BL/6 mices (name of male
WT, purchased from Beijing HFK Bio-Technology Co., Ltd.), general MFG-E8 knock out mice (MFG-E8-KO, purchase
From RIKEN, article No. is 01726).Heartspecific MFG-E8 transgenic mices (MFG-E8-TG) and nontransgenic mice (NTG, together
Age littermate control nontransgenic mice) for experimental subject.
2. feeding environment:All experiment mices are raised in Wuhan University SPF level Experimental Animal Centers.SRF levels mice is raised
Material is purchased from Beijing HFK Bio-Technology Co., Ltd..Rearing conditions:Between 22-24 DEG C, humidity is in 40-70% for room temperature
Between, light and shade replaces lighting hours for 12h, and free water is ingested.
The structure (construction strategy is shown in Fig. 5 A) of 3 heartspecific MFG-E8 transgenic mices of embodiment
CDNA with C57BL/6J mice MFG-E8 genes expands mice MFG-E8 gene with following primer PCR as template
(NCBI, Gene ID:17304, CCDS21379.1):
Forward primer:5 '-AGCTTTGTTTAAACGCCACCATGCAGGTCTCCCGTGTGC-3 ',
Downstream primer:5’-CTAGCTAGCTTAACAGCCCAGCAGCTCCA-3’.
Product that amplification is obtained and with the pCAG-CAT-LacZ carriers after restricted enzyme PmeI and NheI enzyme action
(Beijing Union Medical College basis institute teacher Yang Qinglin laboratory is provided, and preparation process is referring to list of references:Kim T,
Zhelyabovska O,Liu J,et al.Generation of an Inducible,Cardiomyocyte-Specific
Transgenic Mouse Model with PPAR b/d Overexpression[J].Peroxisome
Proliferator-Activated Receptors (PPARs), 57.) connect, obtain transgene carrier pCAG-CAT-MFG-
The expression of E8-polyA, MFG-E8 is by CAG promoters drivens.
The pCAG-CAT-MFG-E8-polyA carriers of structure are configured to into fertilized embryo (C57BL/6J by microinjection
Background), obtain MFG-E8-floxed transgenic mices.Heartspecific MFG-E8 transgenic mices are turned by MFG-E8-floxed
DNA murine and α-MHC-Cre (are purchased from Jackson Laboratory, 005650) mouse hybrid breeding is obtained article No..
Mice toe or tail tissue after taking-up is raw one week, extracts correspondence tissue total protein, using Western Blot
Method screening MFG-E8 expression highest mices (Fig. 5 B).Its brood positive Mus is continued into breeding, so as to obtain stable heredity
Heartspecific MFG-E8 transgenic mouse lines.
The acquisition of 4 myocardial hypertrophy model of embodiment
1. laboratory animal packet:Male background C57BL/6 wild-type mice (WT), MFG-E8 knock out mice (MFG-
E8-KO) and heartspecific MFG-E8 transgenic mices (TG) and nontransgenic mice (NTG), by coarctation of aorta art
(AB) set up myocardial hypertrophy model.8 groups are randomly divided into, are grouped as follows:C57BL/6 background wild-type mice sham operated rats (WT
) and AB art groups (WT AB), MFG-E8 knock out mice sham operated rats (MFG-E8-KO Sham) and AB art group (MFG- Sham
E8-KO AB), nontransgenic mice sham operated rats (NTG Sham) and AB art groups (NTG AB), heartspecific MFG-E8 turn base
Because of mice sham operated rats (TG Sham) and AB art groups (TG AB).
2. myocardial hypertrophy model is performed the operation using aorta arch constriction (AB), model manipulation flow process:
2.1 Preoperative Method
(1) anaesthetize:Mouse weights are given first, anaesthetic (3% pentobarbital sodium) amount needed for calculating according to 90mg/kg body weight is led to
Lumbar injection is crossed, and records injection time point.Folder tail, folder toe are without significant reaction and mice is in good condition for anesthesia Success criteria
(after general injection, about 10min has reaction with the little mousetrap toes of about 50min after anesthesia without significant reaction, and after anesthesia, 30min or so is
Optimal operating time).
(2) art area prepares:By the skin unhairing of mice left chest, left side chest and left fore oxter.Wet yarn is used after shaving
Cloth wipes art area and removes deratization hair, not affect surgical field of view to be advisable.
(3) tracheal intubation:Mice upper front tooth is fixed on V shaped slab inclined-plane with rubber band, and it is rapid by tracheal intubation Jing
Glottis is properly inserted tracheal strips, and subsequent right arm reclining is placed on heating cushion (heating cushion need to be preheated in advance), then by tracheal intubation
It is connected with respirator, fixed mice.If the thorax fluctuating of mice is consistent with breathing unit frequency, tracheal intubation success is illustrated.
2.2 aortic arch descending branch ligations
Right arm reclining is taken, and mice left fore is placed in above right fore, and two forelimbs is fixed with medical adhesive tape.Under right chest
Side is encased inside cotton swab, raises thorax, successively with the ethanol that iodine tincture and volume fraction are 75% to area skin sterilization of performing the operation.Left hand is held
Left skin of chest has been pinched by ophthalmic tweezers, and the right hand is held eye scissorss and cuts off skin about 1cm, successively separating muscle and soft tissue, in 2-3
Rib horizontal opening thoracic cavity, slightly pushes left lung aside with cotton swab, and dissociate aortic arch descending branch, and 7-0 suturess are passed through blood vessel, and in blood
One section of 26G (25.0-27.5g mices) or 27G (23.5-25.0g) syringe needle are placed in parallel above pipe, by blood vessel and pin
First ligatures, then extracts the Vasoconstriction that syringe needle can reach respective degrees out.Ligation is sutured after finishing successively, closes breast
Chamber, inserts thoracic cavity from sealing with syringe and extracts 1cc gases out to recover negative pressure in thoracic cavity, sutured after extracting syringe rapidly
Skin incision.Sham operated rats (Sham) threading after the descending aorta that dissociates is not ligatured, and remaining step is with myocardial hypertrophy mould
Type group.
2.3 postoperative care
After aortic arch descending branch ligation, treat that mice autonomous respiration, folder toe occurs and kickback occurs, extract trachea and insert
Pipe, and mice is put in the rearging cage of bedding and padding, feedstuff and the drinking water crossed equipped with autoclaving, continue to raise in receptacle and see
Examine.Wild type and MFG-E8 knock out mice mices are postoperative 4 weeks, nontransgenic mice and heartspecific MFG-E8 transgenic
Mice carries out the detection of indices for postoperative 4 weeks respectively.
5 myocardial hypertrophy model mice pathology of embodiment are detected and cardiac function detection
First, pathology detection
1. draw materials
(1) previous work:Prepare the urine cup of 10% formaldehyde of volume fraction equipped with 20mL in advance, and post label (mice
Numbering, group, type of surgery and draw materials the date).The culture dish for filling mass fraction 10%KCl solution is placed in into the place that draws materials.Beat
Analytical balance is driven, is returned to zero standby.It is re-weighed execution mice.
(2) draw materials:The vessel pedicle that the curved tweezer of ophthalmology is lived below auricle, cuts heart, is immediately placed in mass fraction 10%KCl
In solution.After cardiac arrest is in relaxing period, it is placed on sterile gauze, gently extrudes heart intracavity liquid, after dipping in dry surface liquid,
Weigh and record, heart is put in corresponding urine cup, detect for pathology after fixed 48h.
(3) measurement of correlation and calculating:Mouse heart, lungs are taken out, filter paper is blotted after pruning, is weighed and is recorded.Cut off little
Skin at Mus hind leg tibia, measures and records tibia length.Calculate ratio (HW/BW) and the heart weight and tibia of heart weight and body weight
The ratio (HW/TL) of length.
2. pathology detection
2.1 prepare paraffin specimen section
Primary operational program includes pruning heart → embedding frame process → flowing water flushing → dehydration → transparent → waxdip → bag
Bury → cut into slices → spread out standby after piece → dry or toast.
2.2 hematoxylin-eosins (HE) are dyeed
Mainly comprise the following steps:55 DEG C of bakings 30min → dimethylbenzene 5min, 3 times → 100% ethanol 1min → 95% ethanol 1min
→ 70% ethanol 1min → distilled water 1min → haematoxylin solution (Zhuhai shellfish rope, BA-4021) 5min → washing 1min → 1% salt
Sour ethanol (taking 3mL concentrated hydrochloric acid to be sufficiently mixed uniformly with 70% ethanol of 297mL) 1-3s → washing 1min → Scott liquid (bicarbonates
Sodium 0.35g, Magnesium sulfate heptahydrate 2g, both are dissolved in 100mL distilled water) 1min → washing 1min → Yihong solution (Zhuhai shellfish rope,
BA-4024) 3-5min → distilled water washes away loose colour → 70% ethanol 1s → 95% ethanol 1s → 100% ethanol 30s, and 3 times → bis-
Toluene 2min, 3 times → take advantage of in the not dry mounting → fume hood immediately of dimethylbenzene and dry up, microscope is taken pictures.
HE dyeing picture statistics:More than 3 clear borders, the approximately centrally located cell of core are selected to use per pictures
6.0 software statistics cell cross sections of Image-Pro Plus are accumulated.
2.3 Picro-Sirius red (PSR) is dyeed
Mainly comprise the following steps:55 DEG C of bakings 30min → dimethylbenzene 2min, 3 times → 100% ethanol 1min → 95% ethanol 1min
→ 70% ethanol 1min → flowing water rinses 0.2% phosphomolybdic acid 2min → 0.1% day wolf of 10min → distilled water 1min → mass fraction
Scarlet picric acid solution drips and 90min → remove residul liquid-removing → 0.01N hydrochloric acid 4s → 70% ethanol 1 time is dyeed in tissue, wet box
1 time → 100% ethanol 30s of → 90% ethanol, 3 times → dimethylbenzene 2min, 3 times → take advantage of the not dry coverslip mounting immediately of dimethylbenzene,
Microscope is taken pictures.
Cardiac muscular tissue is made up of myocardial cell and stroma, and heart is a terminal differentiation organ, and myocardial cell loses increasing
Grow ability, the reaction of myocardial cell that various physiology or pathological stimuli cause, can only be individual cells volume increase and can not
Quantitatively breed.Therefore, in the pathophysiological process of myocardial hypertrophy, it is mainly shown as that myocardial cell volume increases, muscle segment
Increasing number, cell arrangement are disorderly, and cardiac mesenchymal changes the propagation and conversion, collagen fiber density for including Cardiac Fibroblasts
Increase, collagen secretion increases, collagen proportional balancing method imbalance etc..
2nd, real-time fluorescence quantitative PCR (RT-PCR) detection myocardial hypertrophy and myocardial fibrosiies marker levels
1. RNA is extracted
(1) sample of RNA to be extracted is taken out by pre-cooling centrifuge from -80 DEG C of refrigerators, after the abundant pre-cooling cryopreservation tube of liquid nitrogen,
Tissue samples in cryopreservation tube are shredded using microscissorses and be transferred to 1.5mL EP pipes.Add in every pipe heart tissue sample
1mL Trizol, stand 10min.
(2) chloroform is added to each EP pipe according to the amount of 200 μ L/1mL Trizol, turn upside down mixed 15-30sec
After be stored at room temperature 5min.4 DEG C of centrifugations 15min (12000g).
(3) RNA precipitate:Upper strata aqueous phase is carefully transferred in new EP pipes (general 300-400 μ L), adds equivalent volumes
Isopropanol, after mixing, be stored at room temperature 10min, 4 DEG C of centrifugation 10min of rotating speed of 12000g.Prepare 75% ethanol and (use 25%
The deionized water that DEPC was processed is prepared).
(4) ttom of pipe and tube wall visible white flocculent deposit (RNA) after being centrifuged, remove supernatant, add 75% ethanol of 1mL,
Make RNA precipitate resuspended using agitator, and reverse EP pipes, fully rinse RNA precipitate.And be centrifuged with 4 DEG C of the rotating speed of 7500g
5min。
(5) dissolving of RNA precipitate:Supernatant is removed, drying at room temperature 10min is until white precipitate becomes colorless.In advance
Defrosting RT-buffer, dT primer, PCR grade water, a dNTPs.Sunk with the DEPC water dissolving RNAs of appropriate volume (20 μ L)
Form sediment, EP pipes are put to 55 DEG C of water-baths, continue 10min and promote RNA dissolvings.
2. RNA concentration is determined:The RNA concentration of each sample is determined using NanoDrop 2000.
3. reverse transcription (RT)
(1) reverse transcription reaction system (13 μ L of cumulative volume), the dT primer of 1 μ L, the Random primer of 2 μ L, basis
The RNA concentration of measure is corrected total rna concentration to 2 μ g by adding the water of different amounts of PCR grades.
(2) above-mentioned reaction system is placed in PCR instrument (70 DEG C, 10min) after mixing, is reacted PCR reaction tubes after terminating
Ice bath 5min after taking-up.
(3) above PCR reaction tube is placed on ice chest and is played reagent, final volume is 20ul.5 × the RT- of 4 μ L
Buffer, the dNTPs of 2 μ L, the inhibitor of 0.5 μ L, the RTase of 0.5 μ L.
(4) reverse transcription is carried out by following procedure:25℃10min;50℃60min;90℃5min;4 DEG C of 1min, treat that program is tied
Beam, takes out reaction tube, is stored in -80 DEG C of refrigerators.
4. real-time fluorescence quantitative PCR
(1) PCR reaction systems, 20 μ L of cumulative volume:10 μ L's480SYBR Green I Maste(2X)、
The primer (10 μM) of 1 μ L, the water of the PCR grades of 8 μ L, the cDNA templates of 1 μ L.
(2) match somebody with somebody mixed liquor (each gene three wells) according to above-mentioned system:The water of the PCR grades of 25.6 μ L, 32 μ L's480SYBR Green I Maste (2X), the primer of 3.2 μ L.
(3) the addition cDNA templates in above-mentioned mixed liquor:Every 3.2 μ L of pipe.
(4) after mixing on 96 orifice plates point sample, often three multiple holes of pipe point, 96 orifice plate 3000rpm are centrifuged into 2min.
(5) 96 orifice plates of centrifugation are placed on detector, are detected by setup program.
For the primer sequence such as table 3 below of real-time fluorescence quantitative PCR:
Table 3
Gene |
Forward primer (5 ' to 3 ') |
Reverse primer (5 ' to 3 ') |
Anp-Mouse |
ACCTGCTAGACCACCTGGAG |
CCTTGGCTGTTATCTTCGGTACCGG |
Bnp-Mouse |
GAGGTCACTCCTATCCTCTGG |
GCCATTTCCTCCGACTTTTCTC |
Myh7-Mouse |
CCGAGTCCCAGGTCAACAA |
CTTCACGGGCACCCTTGGA |
Ctgf-Mouse |
TGACCCCTGCGACCCACA |
TACACCGACCCACCGAAGACACAG |
Collagen I-Mouse |
AGGCTTCAGTGGTTTGGATG |
CACCAACAGCACCATCGTTA |
Collagen III-Mouse |
CCCAACCCAGAGATCCCATT |
GAAGCACAGGAGCAGGTGTAGA |
Gapdh-Mouse |
ACTTGAAGGGTGGAGCCAAA |
GACTGTGGTCATGAGCCCTT |
3rd, ultrasound detection cardiac function
1. early-stage preparations
(1) anesthetic machine prepares:First connect the intake interface on oxygen cylinder and anesthetic machine, then to turn on dosing mouth on anesthetic machine close
Capping, is rapidly added isoflurane and tightens closure to safe scale.Total valve on oxygen cylinder is turned on, flow control valve is adjusted
Knob, outlet pressure maintain 0.2-0.3mPa.
(2) mice to be measured prepares:After mice to be detected is anaesthetized with isoflurane rapidly, left anterior pectorial region shaving, by what is handled well
Mouse head is stretched in anesthetis conduit pullover, maintains the stable narcotism of mice with 1.5-2.0% isofluranes.
2. cardiac function detection
The present embodiment evaluates myocardial hypertrophy and cardiac function with M types echocardiography.Mice takes left lateral position or faces upward
Clinostatism, and in shaving area uniform application ultrasonic coupling agent (Tianjin Cheng Xin companies).Using high-frequency ultrasound in diagnosis instrument, frequency is
15MHz, selection standard papillary muscles of left ventricle short axis view, in measurement LVED (Left Ventricular End Systolic Dimension) (LVEDD), left room end-systole
Footpath (LVESD) and shortening fraction (LVFS).
4th, result
WT and MFG-E8-KO mice AB postoperative pathology testing result is shown in Fig. 6-8.WT mices in Sham (sham-operation) group
And the difference between the HW/BW and HW/TL of MFG-E8-KO mices is not statistically significant;The WT mice AB HW/BW of postoperative 4 weeks
It is higher than its Sham group with HW/TL;AB is postoperative 4 weeks, and the HW/BW and HW/TL of MFG-E8-KO mices raise (Fig. 6) compared with WT mices.
HE stained can be observed:Sham group heart no significant differences, AB groups increase compared with the heart of Sham groups, and MFG-E8-KO is little
The heart of Mus is significantly greater than WT group mices;Sham groups cardiac muscle sarcostyle cell arrangement is neat, fine and close, and form is complete, karyon and
Nucleolar structure is clear;AB group myofilament arrangement disorders, loose, myocardial cell volume is significantly increased, and form is irregular, born of the same parents' nuclear hyperchromatism,
Increase, deformity, kernel are obscured, and MFG-E8-KO groups then increase compared with WT group cellular masts, and difference is statistically significant.Myocardial cell
Cross-sectional area statistical result shows that MFG-E8-KO groups then significantly increase (Fig. 7) compared with WT group cardiomyocytes cross-sectional areas.PSR is dyeed
Show, AB groups myocardium of ventricle interstitial collagen content increases compared with Sham groups, collagen increase around arteries becomes apparent from, collagen increases
Slightly, arrangement disorder is into network-like;The postoperative MFG-E8-KO mouse cardiac muscles interstitial collagen contents of AB and perivascular collagen content are higher than
WT group mices (Fig. 8).The result of real-time quantitative PCR shows that the postoperative 4W of coarctation of aorta is compared with WT groups, and MFG-E8-KO groups are little
Rat heart tissue in myocardial hypertrophy mark (Anp, Bnp and Myh7) and myocardial fibrosiies mark (Collagen I,
Collagen III and CTGF) mRNA level in-site substantially rise (Fig. 9).In addition, each group mice row ultrasonic cardiography to postoperative 4W
Figure detection, evaluates its ventricular dilatation and cardiac function, and discovery is compared with Sham groups, WT the and MFG-E8-KO mice left ventricle chambers of the heart
Significantly expand, show as LVED (Left Ventricular End Systolic Dimension) (LVEDd), left room end systolic diameter (LVESd) and increase, and cardiac function
Index fractional shortening of the ventricular minor semi axis (LVFS) is significantly reduced, it is often more important that the gene knockout of MFG-E8 further promotes AB handss
The expansion and the deterioration (Figure 10) of cardiac function of the left ventricle of art induction.These results suggest that, MFG-E8 gene knockouts are obviously promoted
The generation development of the cardiac remodeling of pressure inducement.
Figure 11-13 is the postoperative pathology testing results of NTG and MFG-E8-TG mice AB.In sham operated rats, NTG and
The equal zero difference of indices of MFG-E8-TG mices.And AB is postoperative 4 weeks, the HW/BW and HW/TL of NTG mices is apparently higher than which
Sham groups, and compare with NTG mices, the HW/BW and HW/TL of MFG-E8-TG mices significantly reduce (Figure 11).HE stained can
It was observed that:AB is postoperative, and NTG mouse hearts size and cardiomyocytes cross-sectional area are significantly greater than Sham groups, and MFG-E8-TG mices
These parameters substantially reduce (Figure 12) compared with NTG mices.PSR dyeing is visible:TG mice AB postoperative myocardial interstitial collagen contents and
Perivascular collagen content is below NTG mices AB groups (Figure 13).The result of real-time quantitative PCR shows that coarctation of aorta is postoperative
4W, compares with NTG groups, the myocardial hypertrophy mark (Anp, Bnp and Myh7) and cardiac muscle in MFG-E8-TG group mouse heart tissues
The mRNA level in-site of Fibrosis Markers (Collagen I, Collagen III and CTGF) is decreased obviously (Figure 14).Ultrasonic cardiography
Figure detection shows that compare with NTG mices, MFG-E8-TG group mices significantly suppress the left room heart cavity diameter of pressure load induction
Expansion and cardiac function deterioration.Show as LVED (Left Ventricular End Systolic Dimension) (LVEDd), left room end systolic diameter
(LVESd) reduce, and parameters of left ventricular function fractional shortening of the ventricular minor semi axis (LVFS) significantly rises (Figure 15).These results suggest that careful
Dirty specificity MFG-E8 overexpression substantially inhibits the cardiac remodeling and cardiac function of pressure load induction to deteriorate.
Embodiment 5MFG-E8 disturbs the original that (AdshMFG-E8) and overexpression (AdMFG-E8) adenoviruss stimulate to Ang II
For the impact of cardiac myocyte hypertrophy
1. primary newborn SD rat myocardial cells culture
(1) newborn 1 day Sprague-Dawley neonatal rat 8,75% alcohol disinfecting below cervical region, with eye scissorss and microforcepses
Heart is removed, is put in the glass dish for filling 10mL DMEM/F12 culture medium.Another is taken again, repeats above procedure.
(2) heart is cleaned with DMEM/F12 culture medium, and heart is cut into into 1-2mm3Fragment.It is transferred to and is placed with rotor
In serum bottle, DMEM/F12 is sucked, add pancreatin Digestive system.Rotating speed is 120r/min, digests 15min, the static several seconds, discards
Supernatant.
(3) pancreatin Digestive system is added, rotating speed is 120r/min, digests 15min.Static several seconds, Aspirate supernatant are used
The DMEM/F12 culture medium of 20% calf serum terminates digestion, is placed in 4 DEG C of Refrigerator stores.Repeat the step, circulation is several times.
Should exhaust as far as possible when taking supernatant, when piece of tissue bleaches and substantially becomes hour, terminate digestion.
(4) myocardial cell suspensions for gathering are centrifuged into 8min, abandoning supernatant with 1500rpm rotating speeds.In centrifuge tube
Appropriate culture medium is added, re-suspended cell is softly blown and beaten, is concentrated in 1 50mL centrifuge tube, cell suspension 40 μm of filtrations of cell
Net filtration.
(5) cell is seeded in the culture dish of 100mm, adherent 90min during difference draws not adherent cell suspension mistake
Filter.Brdu (final concentration 0.1mM) is added according to the total amount of cell suspension, after mixing, is added to the coated device of 0.1% gelatin
In ware.
(6) jog cell dispersion, not whirlpool rock.37 DEG C, 5%CO2Incubation changes culture with PBS 1 time in 48 hours
Base.
2.MFG-E8 disturbs the cardiac muscle that (AdshMFG-E8) and overexpression (AdMFG-E8) adenoviruss are induced to Jing Ang II
The impact of cellular mast model
2.1 recombination adenovirus construction
Recombinant adenoviruss used by of the invention comprising AdshRNA (adenoviruss containing shRNA (silence RNA), with compare),
AdshMFG-E8 (adenoviruss containing shRNA-MFG-E8 (silence RNA-MFG-E8 fusion protein), the expression of silence MFG-E8),
AdGFP (adenoviruss containing GFP (green fluorescent protein), with comparing) and AdMFG-E8 ((the green fluorescence eggs containing GFP-MFG-E8
- MFG-E8 fusion protein in vain) adenoviruss, MFG-E8 overexpression).
The expression vector of MFG-E8 is buied from InvivoGen companies of the U.S., using adenoviral expression systems AdenoVec structures
Build restructuring AdGFP, AdMFG-E8;ShRNA, shMFG-E8 carrier is buied from SuperArray companies of the U.S., using adenoviruss table
Restructuring AdshRNA, AdshMFG-E8 are built up to system AdenoVec.
The identification of 2.2 recombinant adenoviruss
Take viral crude extract and add lysate, supernatant is taken Jing after mixing, be centrifuged and enters performing PCR amplification, product as template
Identified by gel electrophoresiss.
The amplification of 2.3 recombinant adenoviruss
Before transfection, inoculation HEK293 cells, reach whne cell and liquid are changed when 50-70% converges, and add and carry containing recombinant adenoviruss
The fresh medium of body, culture 90 minutes after add fresh medium again, cultivate to about 50% cell from culture plate
When coming off, cell suspension is collected.Multigelation is to prepare viral crude extract, sick by CsCl Density ultracentrifugations purification
Venom.
2.4 recombinant adenoviruss titer determinations
HEK293 cells are inoculated with 96 orifice plates, after 24 hours, add the virus liquid of doubling dilution, 1-10 row to add dilution
Virus liquid, 8 repeating holes of each concentration, 11-12 row add virus-free complete culture solution, culture to be seen after 10 days under the microscope
Cytopathic effect (CPE) is examined, the positive rate of each concentration is calculated.Virus titer is counted using Spearman-Karber Method
Calculate:Titre (pfu/mL)=10 (x+0.8), each concentration positive rate summations of x=.Precondition:Negative control is without CPE and growth suppression
Phenomenon processed;Minimum diluted concentration group has CPE;Maximum dilution concentration group is without CPE.
The identification of 2.5 recombinant adenovirus toxic actions
With 2 × 108The AdMFG-E8 and AdGFP of pfu/virus concentration and AdshMFG-E8 and AdshRNA infect the training of 6 holes
Cultured myocardial (about 80% degree of converging) in foster plate, collects cell after 24 hours, after adding protein lysate to crack 50 minutes
Supernatant is collected, and 50 μ g samples is taken Jing after 10%SDS-PAGE electrophoretic separation, is Western blot with MFG-E8 specific antibodies
Analysis.According to the expression of MFG-E8 albumen, determine whether are adenoviruss AdMFG-E8 and AdGFP and AdshMFG-E8 and AdshRNA
Predictive role can be played.The cell MFG-E8 protein expression contents infected by AdGFP and AdshRNA are constant.By AdshMFG-E8
The cell MFG-E8 protein expression contents of infection are substantially reduced;Contrary, the cell MFG-E8 albumen tables infected by AdMFG-E8
Dramatically increase up to content.
Adenoviruss 10MOIs infects the culture primary cardiomyocytes of 3 days respectively, with 1 μM of Angiotensin II after 12 hours
(Ang II, purchased from Sigma, A9525) or control PBS stimulate 48 hours, then carry out immunofluorescence test.As a result show, Jing
The myocardial cell surface product of AdshMFG-E8 adenovirus infections AdshRNA compared with matched group is significantly increased, and Jing AdMFG-E8
Myocardial cell surface product after adenovirus infection is substantially reduced (Figure 16) compared with AdGFP matched groups.That is the interference adenoviruss of MFG-E8
The adenoviruss of cardiac myocyte hypertrophy, MFG-E8 overexpression are then promoted then to suppress cardiac myocyte hypertrophy.
From above example result:
1., in the patients serum of Patients with Cardiac Failure, MFG-E8 protein levels are substantially reduced, and with cardiac remodeling and mental and physical efforts
The exhaustion order of severity is closely related.MFG-E8 can become the new bio index of Diagnosing Cardiac reconstruct and heart failure.
2., in the myocardial hypertrophy disease model that aorta arch constriction causes, MFG-E8 gene knockouts significantly promote cardiac muscle
The deterioration of plump, fibrosiss and cardiac function, MFG-E8 gene overexpressions significantly suppress myocardial hypertrophy, fibrosiss, improve
Cardiac function.Therefore MFG-E8 genes have cardiac remodeling, the effect of cardiac function protecting for suppressing pressure load induction.MFG-E8 can
Become treatment cardiac remodeling and improve the newtype drug of heart failure.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention not by above-described embodiment
Limit, other any spirit without departing from the present invention and the change, modification, replacement made under principle, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Wuhan University
<120>Application of the milk fat globule epidermal somatomedin 8 in the diagnosis and treatment of cardiac remodeling and heart failure
<130> 1
<160> 16
<170> PatentIn version 3.3
<210> 1
<211> 39
<212> DNA
<213> Artificial
<220>
<223>Forward primer
<400> 1
agctttgttt aaacgccacc atgcaggtct cccgtgtgc 39
<210> 2
<211> 29
<212> DNA
<213> Artificial
<220>
<223>Downstream primer
<400> 2
ctagctagct taacagccca gcagctcca 29
<210> 3
<211> 20
<212> DNA
<213> Artificial
<220>
<223>Anp forward primers
<400> 3
acctgctaga ccacctggag 20
<210> 4
<211> 25
<212> DNA
<213> Artificial
<220>
<223>Reverse primer
<400> 4
ccttggctgt tatcttcggt accgg 25
<210> 5
<211> 21
<212> DNA
<213> Artificial
<220>
<223>Bnp forward primers
<400> 5
gaggtcactc ctatcctctg g 21
<210> 6
<211> 22
<212> DNA
<213> Artificial
<220>
<223>Bnp reverse primers
<400> 6
gccatttcct ccgacttttc tc 22
<210> 7
<211> 19
<212> DNA
<213> Artificial
<220>
<223>Myh7 forward primers
<400> 7
ccgagtccca ggtcaacaa 19
<210> 8
<211> 19
<212> DNA
<213> Artificial
<220>
<223>Myh7 reverse primers
<400> 8
cttcacgggc acccttgga 19
<210> 9
<211> 18
<212> DNA
<213> Artificial
<220>
<223>Ctgf forward primers
<400> 9
tgacccctgc gacccaca 18
<210> 10
<211> 24
<212> DNA
<213> Artificial
<220>
<223>Ctgf reverse primers
<400> 10
tacaccgacc caccgaagac acag 24
<210> 11
<211> 20
<212> DNA
<213> Artificial
<220>
<223>Collagen I forward primers
<400> 11
aggcttcagt ggtttggatg 20
<210> 12
<211> 20
<212> DNA
<213> Artificial
<220>
<223>Collagen I reverse primers
<400> 12
caccaacagc accatcgtta 20
<210> 13
<211> 20
<212> DNA
<213> Artificial
<220>
<223>Collagen III forward primers
<400> 13
cccaacccag agatcccatt 20
<210> 14
<211> 22
<212> DNA
<213> Artificial
<220>
<223>Collagen III reverse primers
<400> 14
gaagcacagg agcaggtgta ga 22
<210> 15
<211> 20
<212> DNA
<213> Artificial
<220>
<223>Gapdh forward primers
<400> 15
acttgaaggg tggagccaaa 20
<210> 16
<211> 20
<212> DNA
<213> Artificial
<220>
<223>Gapdh reverse primers
<400> 16
gactgtggtc atgagccctt 20