CN106480067A - The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. - Google Patents
The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. Download PDFInfo
- Publication number
- CN106480067A CN106480067A CN201611039068.6A CN201611039068A CN106480067A CN 106480067 A CN106480067 A CN 106480067A CN 201611039068 A CN201611039068 A CN 201611039068A CN 106480067 A CN106480067 A CN 106480067A
- Authority
- CN
- China
- Prior art keywords
- ntnac096
- nicotiana tabacum
- gene
- feeble
- old
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8266—Abscission; Dehiscence; Senescence
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides one grows tobacco the old and feeble application of NtNAC096 Gene Handling Nicotiana tabacum L., belong to biological tobacco control field, significantly can be regulated and controled using the aging of Nicotiana tabacum L. NtNAC096 gene pairss Nicotiana tabacum L..This utilizes genomic dna sequence total length 1203bp of Nicotiana tabacum L. NtNAC096 gene, is made up of 3 exons and 2 introns.Above-mentioned application specifically includes following steps：(1) Nicotiana tabacum L. NtNAC096 gene cloning, sequence analysis；(2) expression analysis are carried out to NtNAC096 gene；(3) pass through to build Nicotiana tabacum L. NtNAC096 gene overexpression carrier, carry out Nicotiana tabacum L. NtNAC096 gene function analysis；(4) using CRISPR/Cas9 gene editing technology, Nicotiana tabacum L. NtNAC096 gene target site is designed, builds NtNAC096 gene knockout carrier；Tobacco bred is carried out with genetic transformation, obtains the tobacco plant of slow down aging.
Description
Technical field
The present invention relates to Nicotiana tabacum L. aging control field, the more particularly, to one NtNAC096 Gene Handling Nicotiana tabacum L. that grows tobacco is old and feeble
Application.
Background technology
Leaf senile is the last stage of leaf development.In Leaf Senescence, chlorophyll and biomacromolecule
Material such as protein, lipid, nucleic acid etc. are degraded, and leave photosynthetic ability reduces, the nutrient substance Degradation and Transformation in aging tissues
After be transported in tender tissue and genitals supply further growth develop or store.Therefore, the old and feeble impact crop of blade
The formation of growth, nutrient accumulation and yield.Nicotiana tabacum L. is a kind of leaf industrial crops, leaf area size and old and feeble direct shadow of Maturity
Ring and arrive production yields and quality.
At present, the control of plant senescence is concentrated mainly on the regulation aspect to phytohormone, auxin, the basic element of cell division
Etc. suppressing leaf senile, ethylene, abscisic acid can promote leaf senile；Artificially slow down Leaf senescence development, on the one hand can lead to
Cross and reduce the old and feeble synthesis promoting hormone or metabolism, on the other hand also can increase synthesis or the metabolism of senescence inhibitory hormones.But
Often there is the defect in effect in the effect of hormonal regulation external source.In consideration of it, being begun one's study using the old and feeble method of Gene Handling, mesh
The Nicotiana tabacum L. aging gene of front only minority is identified, and the gene still having substantial amounts of plant senescence related requires study and utilizes.
Content of the invention
It is an object of the invention to provide the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L., can pass through
The aging of NtNAC096 Gene Handling Nicotiana tabacum L., delays the aging of Nicotiana tabacum L. by gene editing, thus efficiently controlling the aging of Nicotiana tabacum L.
Process.
In order to achieve the above object, the technical scheme is that:
The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L., the genomic dna sequence of Nicotiana tabacum L. NtNAC096 gene is complete
Long 1203bp, its nucleotide sequence is as follows：
Wherein, the atg that in sequence, double underline indicates is start codon, and the tga that double underline indicates is termination codon
Son, the part that single underscore indicates is intron, and Nicotiana tabacum L. NtNAC096 gene is made up of 3 exons and 2 introns.
Further, the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L., enters including to Nicotiana tabacum L. NtNAC096 gene
Row gene function analysis, knock out NtNAC096 gene, obtain the tobacco plant of slow down aging.
Further, the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L., comprises the steps：(1) Nicotiana tabacum L.
NtNAC096 gene cloning, sequence analysis；(2) expression analysis are carried out to NtNAC096 gene；
(3) pass through to build Nicotiana tabacum L. NtNAC096 gene overexpression carrier, carry out Nicotiana tabacum L. NtNAC096 gene function analysis；
(4) using CRISPR/Cas9 gene editing technology, Nicotiana tabacum L. NtNAC096 gene target site is designed, builds NtNAC096 base
Because of knockout carrier；Tobacco bred is carried out with genetic transformation, obtains the tobacco plant of slow down aging.
Further, step (2) carries out expression analysis to NtNAC096 gene is to detect NtNAC096 with qRT-PCR method
Gene is in the expression pattern of Nicotiana tabacum L. different tissues and different leaves growthdevelopmental stage.
Further, the method that step (3) builds Nicotiana tabacum L. NtNAC096 gene overexpression carrier is to utilize clontech
NtNAC096 is built and enters over-express vector pRI101-AN by infusion methods of homologous recombination, builds Nicotiana tabacum L. NtNAC096 base
Because of over-express vector pRI101-NtNAC096.
Further, after step (3) builds Nicotiana tabacum L. NtNAC096 gene overexpression carrier, using agriculture bacillus mediated dip-flower
Method infects arabidopsiss and obtains transgenic arabidopsis, carries out Nicotiana tabacum L. NtNAC096 gene function analysis.
Further, step (4) is to two target sites of Nicotiana tabacum L. NtNAC096 gene design, synthetic adjunction header sequence,
Target site is connected on carrier pORE-Cas9, obtains pORE-Cas9/NtNAC096 carrier.
Further, the concrete operations that step (4) carries out genetic transformation to tobacco bred are：pORE-Cas9/NtNAC096
Carrier converts Agrobacterium competence LBA4404, carries out genetic transformation using agriculture bacillus mediated tobacco leaf disc conversion method to Nicotiana tabacum L.,
Obtain the tobacco plant of slow down aging.
With respect to the old and feeble control of existing Nicotiana tabacum L., the beneficial effects of the present invention is:1st, find Nicotiana tabacum L. NtNAC096 first
Gene is used for controlling Nicotiana tabacum L. old and feeble；2nd, gene editing technology is utilized accurately can quickly to utilize Nicotiana tabacum L. NtNAC096 Gene Handling
Nicotiana tabacum L. senescence process, obtains the tobacco plant of slow down aging, in agricultural production by being mutated the screening of this gene nucleotide series
There is highly important application, the harvesting of Nicotiana tabacum L., quality control, screening tobacco bred and raising yield are had very significant
Impact.
Brief description
Fig. 1 is the Nicotiana tabacum L. NtNAC096 gene DNA sequence amplification electrophoretogram of one embodiment of the invention；
Fig. 2 is the Nicotiana tabacum L. NtNAC096 gene cDNA sequence amplification electrophoretogram of one embodiment of the invention；
Fig. 3 is the Nicotiana tabacum L. NtNAC096 gene organization expression analysis of one embodiment of the invention；
Fig. 4 is the Nicotiana tabacum L. NtNAC096 genetic tobacco blade different development stage expression analysis of one embodiment of the invention；
Fig. 5 is that plant over-express vector pRI101-NtNAC096 builds and checking electrophoretogram；
Fig. 6 is the identification of pRI101-NtNAC096 transgenic Arabidopsis plants and phenotypic map；
Fig. 7 comprises target site sequence purpose fragment for Nicotiana tabacum L. CRISPR/Cas9 transgenic positive plant NtNAC096 gene
Electrophoretogram；
Fig. 8 is transgenic cigarette strain endogenous NtNAC096 gene target sequence analysis result figure；
Fig. 9 is Nicotiana tabacum L. NtNAC096 knockout mutations body phenotypic map.
Specific embodiment
The enforcement it is clear that described will be clearly and completely described to the technical scheme in the embodiment of the present invention below
Example is only a part of embodiment of the present invention, rather than whole embodiments.Based on the embodiment in the present invention, this area is common
The every other embodiment that technical staff is obtained under the premise of not making creative work, broadly falls into the model of present invention protection
Enclose.
Embodiments provide one to grow tobacco the old and feeble application of NtNAC096 Gene Handling Nicotiana tabacum L., Nicotiana tabacum L. NtNAC096
, as shown in SEQ ID NO.1, by analysis, Nicotiana tabacum L. NtNAC096 gene is by 3 exons and 2 for the nucleotide sequence of gene
Composition containing son.Nicotiana tabacum L. NtNAC096 gene is carried out knock out after gene function analysis with NtNAC096 gene, obtains slow down aging
Tobacco plant.
The embodiment of the present invention additionally provides the old and feeble application process of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L., specifically include as
Lower step：
S1 Nicotiana tabacum L. NtNAC096 gene cloning, sequence analysis.
This step, with tobacco gene group DNA and cDNA as template, designs primer, and amplification obtains Nicotiana tabacum L. NtNAC096 gene
Genomic DNA and cDNA, the intron of analysis genomic DNA and exon sequence.
S2 carries out expression analysis to NtNAC096 gene.
This step by the expression of Nicotiana tabacum L. NtNAC096 gene is analyzed can obtain the site of action of this gene and
Effect stage.
S3 passes through to build Nicotiana tabacum L. NtNAC096 gene overexpression carrier, carries out Nicotiana tabacum L. NtNAC096 gene function analysis.
By the structure of over-express vector in this step, using the Arabidopsis plant of agriculture bacillus mediated prepare transgenosis,
The checking that functional analyses can carry out to Nicotiana tabacum L. NtNAC096 gene functionally is carried out to this gene on arabidopsiss, should be used as it
Theoretical preparation.
S4 is designed to Nicotiana tabacum L. NtNAC096 gene target site using CRISPR/Cas9 gene editing technology, builds
NtNAC096 gene knockout carrier；Tobacco bred is carried out with genetic transformation, obtains the Nicotiana tabacum L. of slow down aging.
Editor's Nicotiana tabacum L. NtNAC096 gene that can be random with gene editing technology in this step, then pass through transgenic skill
Art can regulate and control the aging of Nicotiana tabacum L., changes the senescence process of Nicotiana tabacum L., cultivates the late tobacco bred declining, and controls Nicotiana tabacum L. on the whole
Old and feeble.
As the preferred embodiments of the present invention, step S2 carries out expression analysis to NtNAC096 gene, can use qRT-PCR
Method detects the expression pattern in Nicotiana tabacum L. different tissues and different leaves growthdevelopmental stage for the NtNAC096 gene.The method of qRT-PCR
Efficiently directly perceived, but it is understood that, the method for this area other detection gene expression, such as RT-PCR, northern
Hybridization etc. can be used for the expression analysis of above-mentioned NtNAC096 gene.
As the preferred embodiments of the present invention, the method building Nicotiana tabacum L. NtNAC096 gene overexpression carrier is utilization
NtNAC096 is built and enters over-express vector pRI101-AN by clontech infusion methods of homologous recombination, builds Nicotiana tabacum L.
NtNAC096 gene overexpression carrier pRI101-NtNAC096.It is understood that over-express vector pRI101-AN be through
The carrier suitable for Nicotiana tabacum L. NtNAC096 gene of screening, other gene overexpression carriers can be used for above-mentioned overexpression
The structure of carrier.
As the preferred embodiments of the present invention, infect arabidopsiss using agriculture bacillus mediated flower-dipping method and obtain T0 for seed,
Screening of Media obtains T1 generation positive Seedling, by positive Seedling selfing 1 generation and continue to screen, final obtain transgenic homozygous strain, right
Transgenic homozygous strain carries out senescent phenotypes analysis and aging index measures.It is understood that other over-express vectors import
The method that arabidopsiss obtain transgenic arabidopsis may also be used for carrying out the functional verification of above-mentioned Nicotiana tabacum L. NtNAC096 gene.
As the preferred embodiments of the present invention, using CRISPR/Cas9 gene editing technology to Nicotiana tabacum L. NtNAC096 gene
Target site is designed, and builds NtNAC096 gene knockout carrier method and is, to two target sites of NtNAC096 gene design, people
Work synthesizes adjunction header sequence, and target site is connected on carrier, obtains pORE-Cas9/NtNAC096 carrier.It is understood that
Two are not limited to the target site of NtNAC096 gene design, can be multiple, the quantity of target site can be determined as needed.
As the preferred embodiments of the present invention, pORE-Cas9/NtNAC096 carrier vector converts Agrobacterium competence
LBA4404, carries out genetic transformation using agriculture bacillus mediated tobacco leaf disc conversion method to Nicotiana tabacum L., obtains the T0 generation of anti-kanamycin
Positive transformants Seedling, collects T0 for transgenic positive seed, kalamycin resistance plate screening T1 generation, resistance Seedling expands through PCR again
Sequencing screening obtains T1 for Mutants homozygous, is sequenced, and obtains the Nicotiana tabacum L. of slow down aging.It is understood that other vector introduction
The method that Nicotiana tabacum L. obtains transgene tobacco may also be used for carrying out aforesaid operations.
In order to become apparent from introducing the Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. aging that the embodiment of the present invention is provided in detail
Application, illustrate below with reference to specific embodiment.
(1) extraction of tobacco gene group DNA
(1) take 100mg about fresh blade put in centrifuge tube, liquid nitrogen flash freezer, grind in dismembyator, add 650 μ L
2 × extract with CTAB buffer (being preheated to 65 DEG C in advance), and mix rapidly；(2) 65 DEG C of water-bath 1h, period is every 15min
Jog is once；(3) mixture adds isopyknic phenol chloroform isoamyl alcohol (25 after being cooled to room temperature:24:1), soft mixing, room temperature is quiet
Put 15min, 4 DEG C, 12000rpm is centrifuged 15min；(4) supernatant is transferred in new centrifuge tube；(5) add isopyknic chloroform different
Amylalcohol (24:1), overturn and mix, 4 DEG C, 12000rpm is centrifuged 15min, and supernatant is carefully transferred in new centrifuge tube；(6) take
Clearly, add equal-volume isopropanol, mix, room temperature places 10min, 12000rpm centrifugation 15min precipitation DNA；(7) outwell isopropyl
Alcohol, 75% ethanol rinse 2 times, after last rinsing, remaining liquid feed is exhausted, instrument concentrated in vacuo adds after being dried
Appropriate amounts of sterilized water dissolving DNA is standby.
2 × extract with CTAB formula of liquid：100mM (PH8.0) Tris.Cl, 20mM (PH8.0) EDTA, 1.4M NaCl, 2%
(w/v) CTAB, 40mM mercaptoethanol.
(2) Nicotiana tabacum L. RNA extracts:Using RNAiso Reagent (TaKaRa) traditional extraction.
(3) reverse transcription synthesis cDNA：Using PrimeScript RT eagent Kit with gDNA Eraser
(Perfect Real Time) (Takara, RR047A) is carried out.
(4) Nicotiana tabacum L. NtNAC096 gene cloning
Design Nicotiana tabacum L. NtNAC096 gene primer
Primer NtNAC096-F:TATTTCTCCCTTCTATTTATTTCCT (5 ' UTR area)
Primer NtNAC096-R:TCACTGGTATTGAAAGGCTGG (termination codon position)
PCR reaction system：
10×PCR Buffer for KOD-Plus-Neo 5μL
2mM dNTPs 5μL
25mM MgSO43μL
Primer NtNAC096-F 1.25μL
Primer NtNAC096-R 1.25μL
DNA(or cDNA)1μL
KOD-Plus-Neo 1μL
ddH2O to 50μL
PCR response procedures：
Step1 94℃2min
Step2 98℃10s
Step3 56℃30s
Step4 68℃1min20s Step2-4 35cycle
Step5 68℃8min
With the genomic DNA of the big gold dollar of Nicotiana tabacum L. Flos Carthami and cDNA as template amplification, obtain 1203bp size fragment, electrophoresis is tied
Fruit, referring to Fig. 1, cDNA electrophoresis result, obtains 1079bp size fragment, and referring to Fig. 2, right side is DL5000marker molecular weight mark
Note.Genome is analyzed, this gene is made up of 3 exons and 2 introns.
(5) utilize fluorescent quantitation qRT-PCR method detection NtNAC096 gene Nicotiana tabacum L. different tissues (root, stem, spire,
Flower, ripening and senscence blade etc.) and different leaves growthdevelopmental stage (S1-S4) expression pattern.
Using FastStart UniversalSYBR Green Master (ROX) Realtime test kit (Roche).Choosing
With the method for relative quantification, using Nicotiana tabacum L. 18S gene as reference gene, template is to obtain under above-mentioned different tissues or developmental stage
The cDNA arriving.Each sample arranges 3 repetitions, simultaneously setting negative control and positive control.
Reaction system (20 μ L)
2×SYBR Green Master MIX 10μL
qRT-F primer(10μM)0.5μL
qRT-R primer(10μM)0.5μL
CDNA dilutes template 1 μ L
ddH2O 8μL
Reaction system is put into ABI7500 quantitative fluorescent PCR system and is entered performing PCR reaction, the three-step approach of employing after fully mixing
PCR response procedures, utilize 2-ΔΔCtMethod determines the relative expression quantity of target gene.
QRT-PCR primer sequence：
NtNAC096-qRT-F:TTCACGACTATTTGATGACAATGCTAAC
NtNAC096-qRT-R:TATTGGTCATTGTGTTTTGGTTGTT
18S-qRT-F:GGTCCAGACATAGTAAGGATTGACAGA
18S-qRT-R:AGACAAATCGCTCCACCAACTAAG
Referring to Fig. 3, Fig. 4, result shows, NtNAC096 gene expression highest in ageing leaves, next to that root tissue.
And in the S2 phase, NtNAC096 gene substantially raises about more than 1300 times, and the S3 phase raises 37.7 times.
(6) utilize clontech infusion methods of homologous recombination to build NtNAC096 and enter over-express vector
PRI101-AN, referring to Fig. 5.
Plant over-express vector pRI101-AN (Takara) used, is carried out double from NdeI and EcoRI to pRI101-AN
Enzyme action, high-fidelity enzymatic amplification carries the NtNAC096 gene of joint, is separately recovered carrier large fragment and genes of interest fragment, utilizes
Purpose fragment is connected into pRI101-AN by infusion HD (clontech) seamless link technology.
Enzyme action system：
pRI101-AN 2μg
10×Cutsmart buffer 4μL
NdeI 2μL
EcoRI-HF 2μL
ddH2O to 40μL
In 37 DEG C of thermostat water bath enzyme action more than 3 hours.
Amplification system is with above-mentioned PCR method, primer sequence：
NtNAC096-35s-F:CACTGTTGATACATATGGTTGGGAAAAATAACTCCGAG
NtNAC096-35s-R:TGTTGATTCAGAATTCTCACTGGTATTGAAAGGCTGG
Digested plasmid and genes of interest amplification are detected by agarose gel electrophoresiies, conventional recovery.
Infusion linked system (5 μ L)：
Linearized vector 3 μ L
Purpose fragment 1 μ L
In-fusion HD 1μL
50℃15min
Fig. 5 shows, is DNA molecular amount labelling DL15000 on the left of Marker, and right side is DL2000, and NtNAC096 fragment is high
Fidelity enzymatic amplification, is purpose fragment on the left of left figure, pRI101-AN double digestion NdeI and EcoRI, and on the right side of left figure, enzyme action is linear
PRI101-AN plasmid band, right side electrophoretogram is that pRI101-NtNAC096 expression vector bacterium colony PCR verifies NtNAC096 band.
Infect arabidopsiss using agriculture bacillus mediated flower-dipping method, obtain T0 for seed, in 1/ with kalamycin resistance
Screened in 2MS culture medium, obtained T1 generation positive Seedling, by positive Seedling selfing 1 generation, and continue to screen, finally obtain OE1/OE2
Two transgenic homozygous strains.
(7) senescent phenotypes analysis is carried out to OE1/OE2, and carry out related aging index mensure:
The mensure of chlorophyll content
Seed grows the arabidopsiss material (transgenic OE and Col-0 WT lines) of 45d after sprouting, respectively choose 30 plants,
The 6th lotus throne leaf (counting from the bottom up) of every plant of clip, carries out the mensure of chlorophyll content,
Laboratory operating procedures are as follows：Every 3 plants of plant are one group, and every group of blade is put in a 15mL centrifuge tube, weigh leaf
Piece fresh weight；Often add 10mL dehydrated alcohol in pipe, make the completely dipped blade of ethanol；Avoid light place overnight, makes blade decolour completely；
Measure light absorption value (using dehydrated alcohol as reference) at 665nm and 649nm for the destaining solution respectively with spectrophotometer, remember respectively
For A665 and A649；Calculate the chlorophyll content of every group of blade according to equation below：Ca=13.95A665 6.88A649Cb=
24.96A649–7.32A665
Chlorophyll content (mg/g)=(Ca+Cb) × V/W.Wherein, V is extracting liquid volume, 10mL；W is fresh weight.
The mensure of chlorophyll fluorescence (Fv/Fm)
Using the OS5p+ type pulsed chlorophyll fluorescence meter of OPTI-SCIENCES company, blade is carried out with the survey of Fv/Fm
Fixed, operating procedure is as follows：Seed grows the Arabidopsis plant material of 45d after sprouting, respectively choose 5 plants, place in dark surrounds
20min；Choose the 6th lotus throne leaf to measure；Connect each part of instrument, open instrument switch, find Fv/ in main interface
Fm process of measurement simultaneously enters；Clamp blade with blade, by measuring probe insertion blade folder, adjusting parameter Ft is so as to numerical value
It is in the range of 150-250；Click on the surveying marker on interface or press measurement button on probe, measured value is just automatic
Record and show；After often having surveyed one group of data, store data in the SD card of fuselage；After measurement is fully completed, dismounting arranges
Good instrument component, the data in SD card is copied out to perform an analysis.
Referring to Fig. 6, in Fig. 6 A, WT is wild type Col-0 to measurement result；OE1/OE2 is to proceed to pRI101-NtNAC096 base
Two strains of cause.Phenotypic map is 45 days arabidopsiss growth period phenotype pictures it can be seen that OE strain shows as senescence phenotype.
Fig. 6 B is transgenic arabidopsis strain chlorophyll and photosynthetic rate analysis.Fig. 6 C be transgenic arabidopsis strain in NtNAC096 and
The marker gene SAG12mRNA horizontal analysiss of old and feeble correlation.In two strains of OE1/OE2, on NtNAC096 expression is obvious
Adjust, show obvious senescence phenotype in sowing after 45 days, by physiological index determining, OE1/OE2 chlorophyll content and photochemical
Learn speed and be significantly lower than VC, old and feeble correlation marker gene SAG12 expression is apparently higher than VC.
(8) using CRISPR/Cas9 gene editing technology, Nicotiana tabacum L. NtNAC096 gene target site is designed, builds
NtNAC096 gene knockout carrier；Tobacco bred is carried out with genetic transformation, obtains the tobacco plant of slow down aging.
Design target site 2：
Target1：GCTATAAAGGAAAGCCCCCTA
Target2：TATAAAGGAAAGCCCCCTAA
Synthetic adjunction header sequence
Target1-F：GATTGCTATAAAGGAAAGCCCCCTA
Target1-R：AAACTAGGGGGCTTTCCTTTATAGC
Target2-F：GATTGTATAAAGGAAAGCCCCCTAA
Target1-R：AAACTTAGGGGGCTTTCCTTTATAC
Knockout carrier builds
1. single-stranded oligo DNA annealing forms double-stranded DNA
2 single-stranded primers of synthesis are diluted to 50 μM, then anneal.
Annealing reaction system：
By 95 DEG C of incubation 3min in reaction system PCR instrument, after incubation, naturally cool to room temperature.
2. the enzyme action of expression vector
Expression vector：pORE-Cas9/gRNA
With BsaI enzyme action expression vector
Carrier 1 μ g
10×CutSmart Buffer 5μL
Enzyme 1 μ L
Add ddH2O to 50μL
37 DEG C of enzyme action 1 hour, reclaim digestion products.
3. target site is connected on expression vector, linked system：Linearisation expression vector 5 μ L, double-stranded DNA 2 μ of annealing
L, T4 ligase Buffer 2 μ L, T4 ligase 1 μ L, Add ddH2O to 20 μ L, 25 DEG C connect 10 minutes.
4. connection product transformed competence colibacillus cell, verifies through PCR and obtains positive colony.
The pORE-Cas9/NtNAC096 building carrier is converted Agrobacterium competence LBA4404, is situated between using Agrobacterium
The tobacco leaf disc conversion method led has carried out genetic transformation to cultivation tobacco bred K326, obtains the T0 generation with anti-kanamycin
Positive transformants Seedling.
Extract positive tobacco seedlings leaves genomic DNA, design primer in the both sides of two gRNA sequences, with genomic DNA be
Template, enters performing PCR amplification, PCR primer is carried out with purification recovery to purpose fragment, connects cloning vehicle and is sequenced, in order to examine
Survey target site fragment mutant form.
Collect the T0 that target site edited for transgenic positive plant seed, kalamycin resistance plate screening T1 generation, resist
Property Seedling again through PCR amplification sequencing screen T1 for Mutants homozygous, electrophoretogram is referring to Fig. 7.Extract leaves genomic DNA, to mesh
Fragment enter performing PCR and expand and carry out product sequencing.Sequencing result shows referring to Fig. 8, Fig. 8, tobacco plant ntnac096-1 and
In ntnac096-2, NtNAC096 gene is all successfully edited, NtNAC096 target area section is detected in ntnac096-1 plant
There is base " C " insertion, NtNAC096 target area section is detected in ntnac096-2 plant base " T " insertion, draws
Play encoding histone frame to change, lead to protein function to be lost, thus obtaining the plant delaying Nicotiana tabacum L. old and feeble.
Using chlorophyll content and the chlorophyll fluorescence assay method of above-mentioned arabidopsiss, leaf position calculates from the beginning of top, according to
Secondary to 1-6 piece develop intact leaf take be measured at random at 3 points.Measurement result referring to Fig. 9, such as Fig. 9 A, mutant is in group
Phase starts just to show obvious slow down aging phenotype.Start to calculate leaf position from top, successively intact leaf is developed to 1-6 piece
Carry out chlorophyll content and value in measuring photosynthesis, chlorophyll content increases with leaf digit and declines in obvious, and mutant leaf
Chlorophyll contents apparently higher than comparison K326, referring to Fig. 9 B；Equally, photosynthetic rate is different inconspicuous in 1-4 leaf potential difference, in 5-6 leaf
Position mutant photosynthetic rate significantly larger than compares K326, referring to Fig. 9 C.Measured by phenotype analytical and relative physiologic index, Nicotiana tabacum L.
After NtNAC096 gene knockout, plant senesecence process is substantially delayed, and illustrates to utilize Nicotiana tabacum L. NtNAC096 using the method for the present invention
Gene successfully obtains Nicotiana tabacum L. evening and declines plant.
<110>Tobacco Institute, Chinese Academy of Agricultural Science
<120>The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L.
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 1203
<212> DNA
<213>Nicotiana tabacum L. NtNAC096 gene
<400> 1
atggttggga aaaataactc cgagcagctt cctcctggat ttaggttcca tcctactgat 60
gaagaattaa tcatgtatta tcttcgaaat caagctacct cgaggccttg tcctgtttca 120
atcatccccg aagttgatgt ctataagttt gatccctggg aattgcctgg ttagtatact 180
cgttaaatcg cgtttaattc aaagaattaa tttgtagttg atttttaagt cttgaattaa 240
ttttttctta tgaaattctt gtagagaaag ctgaatttgg ggaaagggaa tggtactttt 300
tcacccctcg tgataggaag tacccaaatg gagttaggcc aaatagagca gctgtatcag 360
gttattggaa ggctacaggc acagataaag caatatatag tggatcaaaa tatgttggta 420
ttaagaaggc tcttgttttc tataaaggaa agccccctaa gggtattaag actgattgga 480
tcatgcatga atatcgatta agtgaatcca ggtctcaacc aatcaggcca aatggctcca 540
tgagggtaag acttgaattc ttggaattgt tttctactat agtttaactt gtatactatg 600
ttagcataga cgtttttact ctatcagatc attttaaaag gtaattacat gcaataatct 660
atattattga aaatatggca agtaactttc tagaatatgt taagtcgtac tcgtgtaaaa 720
atttcactat aatacatggc agtgttctac catatattat aagagttttt gtcatgacta 780
aaagtacaat tttttcgcca tttttttcag ttggatgatt gggtgctttg tagaatttat 840
aagaagaaga atttgggaaa agctatggag atgatgaaag ttgaagaaga gacacaacag 900
cctgaaatat tgagtactaa tcctgttgaa attattgcta ctactggacc acaaacattg 960
aaattgccaa ggacttgttc actgtctcat ctattggaaa tagattattt tgggtcaatt 1020
tcacgactat ttgatgacaa tgctaacaac caaaacacaa tgaccaatat taatattgga 1080
aatatgcatc atcctgccct ggaaaaattt cagctagggg aattgtcaca ccagtacatg 1140
actagtacca acgttaatgg aaatacgcca atttttgtga atccagcctt tcaataccag 1200
tga 1203
Claims (8)
1. the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. is it is characterised in that the genome of Nicotiana tabacum L. NtNAC096 gene
DNA sequence total length 1203bp, its nucleotide sequence is as follows：
Wherein, the atg that in sequence, double underline indicates is start codon, and the tga that double underline indicates is termination codon, single
The part that underscore indicates is intron, and Nicotiana tabacum L. NtNAC096 gene is made up of 3 exons and 2 introns.
2. the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. according to claim 1 is it is characterised in that above-mentioned should
With including Nicotiana tabacum L. NtNAC096 gene is carried out gene function analysis, knock out NtNAC096 gene, obtain the Nicotiana tabacum L. of slow down aging
Plant.
3. the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. according to claim 2 is it is characterised in that above-mentioned should
With comprising the steps：(1) Nicotiana tabacum L. NtNAC096 gene cloning, sequence analysis；(2) NtNAC096 gene is carried out with expression point
Analysis；(3) pass through to build Nicotiana tabacum L. NtNAC096 gene overexpression carrier, carry out Nicotiana tabacum L. NtNAC096 gene function analysis；(4) utilize
CRISPR/Cas9 gene editing technology is designed to Nicotiana tabacum L. NtNAC096 gene target site, builds NtNAC096 gene knockout
Carrier；Tobacco bred is carried out with genetic transformation, obtains the tobacco plant of slow down aging.
4. the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. according to claim 3 is it is characterised in that step
(2) NtNAC096 gene is carried out expression analysis be with qRT-PCR method detection NtNAC096 gene in Nicotiana tabacum L. different tissues and
The expression pattern of different leaves growthdevelopmental stage.
5. the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. according to claim 3 is it is characterised in that step
(3) method building Nicotiana tabacum L. NtNAC096 gene overexpression carrier is will using clontech infusion methods of homologous recombination
NtNAC096 builds and enters over-express vector pRI101-AN, builds Nicotiana tabacum L. NtNAC096 gene overexpression carrier pRI101-
NtNAC096.
6. the old and feeble application of the Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. according to claim 3 or 5 is it is characterised in that walk
Suddenly, after (3) build Nicotiana tabacum L. NtNAC096 gene overexpression carrier, infect arabidopsiss using agriculture bacillus mediated flower-dipping method and turned
Gene arabidopsiss, carry out Nicotiana tabacum L. NtNAC096 gene function analysis.
7. the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. according to claim 3 is it is characterised in that step
(4) to two target sites of Nicotiana tabacum L. NtNAC096 gene design, synthetic adjunction header sequence, target site is connected to carrier pORE-
On Cas9, obtain pORE-Cas9/NtNAC096 carrier.
8. the old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. according to claim 7 is it is characterised in that step
(4) concrete operations carrying out genetic transformation to tobacco bred are：PORE-Cas9/NtNAC096 carrier converts Agrobacterium competence
LBA4404, carries out genetic transformation using agriculture bacillus mediated tobacco leaf disc conversion method to Nicotiana tabacum L., and the Nicotiana tabacum L. obtaining slow down aging is planted
Strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611039068.6A CN106480067A (en) | 2016-11-21 | 2016-11-21 | The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611039068.6A CN106480067A (en) | 2016-11-21 | 2016-11-21 | The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106480067A true CN106480067A (en) | 2017-03-08 |
Family
ID=58275319
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611039068.6A Pending CN106480067A (en) | 2016-11-21 | 2016-11-21 | The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106480067A (en) |
Cited By (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107653256A (en) * | 2017-11-21 | 2018-02-02 | 云南省烟草农业科学研究院 | A kind of Polyphenol Oxidase in Tobacco gene NtPPO1 and its directed mutagenesis method and application |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105112422A (en) * | 2015-09-16 | 2015-12-02 | 中山大学 | Application of gene miR408 and UCL in cultivating high-yielding rice |
-
2016
- 2016-11-21 CN CN201611039068.6A patent/CN106480067A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105112422A (en) * | 2015-09-16 | 2015-12-02 | 中山大学 | Application of gene miR408 and UCL in cultivating high-yielding rice |
Non-Patent Citations (2)
| Title |
|---|
| NCBI: "NCBI Reference Sequence：XM_016596133.1", 《NCBI》 * |
| YONGFENG GUO等: "AtNAP,a NAC family transcription factor, has an important role in leaf senescence", 《THE PLANT JOURNAL》 * |
Cited By (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN107653256A (en) * | 2017-11-21 | 2018-02-02 | 云南省烟草农业科学研究院 | A kind of Polyphenol Oxidase in Tobacco gene NtPPO1 and its directed mutagenesis method and application |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106480067A (en) | The old and feeble application of Nicotiana tabacum L. NtNAC096 Gene Handling Nicotiana tabacum L. | |
| CN105063061B (en) | A kind of rice mass of 1000 kernel gene tgw6 mutant and the preparation method and application thereof | |
| WO2014036946A1 (en) | Rice brown planthopper resistance gene bph9 and molecular markers, and uses thereof | |
| CN108239647A (en) | A kind of gene, molecular labeling and application for controlling rape plant type | |
| CN106480075A (en) | A kind of gene of regulation and control corn drought stress resistance and its application | |
| WO2021121209A1 (en) | Rice brown-planthopper-resistant gene bph37, and protein, vector, host cell, molecular marker, method and use thereof | |
| CN114540357A (en) | Corn long-chain non-coding RNA lncRNA25659 and application thereof | |
| CN106701895B (en) | Haplotype related to drought resistance of corn and molecular marker thereof | |
| CN108913698B (en) | CAPS marker related to wheat ear germination resistance/sensibility and application thereof | |
| CN116218876A (en) | Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof | |
| CN108004236B (en) | Corn stalk rot disease-resistant molecular breeding method and application thereof | |
| CN114350673B (en) | Rice KOB1 gene for regulating and controlling seed vigor and regulating and controlling method thereof | |
| CN113862387B (en) | Molecular marker of rice drought tolerance regulatory gene OsNAC6 and application thereof | |
| CN108795927A (en) | The clone of common wheat gene TaSPX3 coded sequences and its application | |
| CN109082425B (en) | Rape boron high-efficiency gene BnA3NIP5; transposon insertion fragment TEQ of 1Q and primer and application thereof | |
| CN106434697A (en) | Novel salt-tolerant gene ZmUBP in zoysia matrella as well as expression vector and application thereof | |
| CN108018286A (en) | Initiative, detection and the application of corn transformation event ZM8-143 | |
| CN117363631B (en) | Application of Glyma.08g111100 gene in identification of salt-tolerant alkalinity of soybean | |
| CN116103306B (en) | Application of OsAC37 gene and encoding protein in regulation and control of suitability of paddy rice direct seeding | |
| CN114752698B (en) | SNP locus causing tomato ascorbic acid synthesis difference, screening method and identification method | |
| CN113755520B (en) | Semi-dwarf banana gene editing vector, construction method and application thereof | |
| CN111748573B (en) | Application of IRM1 gene in preparation of preparation for inhibiting plant leaf growth | |
| CN111647578B (en) | Application of USB1 protein in regulation and control of plant drought resistance | |
| WO2023219154A1 (en) | Method for reducing methane emissions from paddy fields, determination method for determining degree of regulation of methane emissions in rice plant, and rice packaging | |
| US20230365985A1 (en) | PROTEINS AND BIOLOGICAL MATERIALS RELATED TO RICE (Oryza sativa L.) YIELD, AND USE THEREOF IN RICE YIELD INCREASE |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |