CN106434688A - Artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof - Google Patents
Artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof Download PDFInfo
- Publication number
- CN106434688A CN106434688A CN201610615347.6A CN201610615347A CN106434688A CN 106434688 A CN106434688 A CN 106434688A CN 201610615347 A CN201610615347 A CN 201610615347A CN 106434688 A CN106434688 A CN 106434688A
- Authority
- CN
- China
- Prior art keywords
- dep1
- gene
- base
- exon
- target
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof. The rice DEP1 gene mutant body as well as a corresponding allele is obtained by modifying a 5th exon of a DEP1 gene by adopting a CRISPR/Cas9 gene targeting modification technology, so that a base of the 5th exon is replaced, lost and inserted. The artificial fixed-point rice DEP1 gene mutant body and the application thereof disclosed by the invention have the benefits that the artificial mutation is performed on the 5th exon of the rice DEP1 gene by adopting the CRISPR/Cas9, and the mutant body capable of obviously improving the rice yield and the allele are screened; the DEP1 gene mutant body disclosed by the invention as well as the corresponding allele can improve the yield of rice plants by 13-51 percent and is even superior to a natural mutation type.
Description
Technical field
The present invention relates to rice genome editor's breeding field, more particularly, to a kind of Oryza sativa L. vertical compact panicle DEP1 manually pinpoints
Mutant and its application.
Background technology
Oryza sativa L. is one of important cereal crops of China, and rice yield accounts for the 40% about of cereal crops.Improve Oryza sativa L. to produce
Amount, has great meaning to guarantee national food security.The raising of rice in China yield mainly has two periods：First period
It is the 1950's, has risen breeding wheat for semidwarfness, be i.e. " revolution of short stem " or " Green revolution ", second period is 70 years 20th century
Since generation, hybrid rice is widely popularized.Oryza sativa L. expert Chen Wenfu thinks the superelevation that heterosis utilization is combined with ideotype
Delivery and feed infant kind, will be the break-through point that following rice yield improves.
Erect head is one of ideotype of rice high yield kind, and Erect Panicle Rice spike length is big compared with short, Spikelet density, leaf
Piece compared with straight, Leaf angle is little, group structure is good, is conducive to the raising of the efficiency of light energy utilization and the accumulation of Rice Photosynthesis product.2009
The pleiotropic gene DEP1 of control Oryza sativa L. Erect Panicle and grain number per spike map based cloning, this base from the super rice varieties Shennong-265 of northeast
Because having 5 exons and 4 introns, the polypeptide of coding has the function similar to phospholipid glycollic amide associated proteins.Sequence
Row compare and find why high yield is because this gene in the 5th Exon deletion 637bp base to Shennong-265, and insert 12bp
Base, can result in premature transcription termination so that Rice Panicle becomes close, branch stalk number and grain number per spike increase, and rice yield is significantly increased.
On producing, the allele of wide variety of DEP1 high yield type is consistent with the genotype of Shennong-265 at present, so
And this Yield Genes type is to produce under the conditions of natural mutation, whether the effect of high yield reaches the maximum potential of DEP1 gene
Also uncertain.
Content of the invention
The invention discloses a kind of artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 and its application.The present invention is by straight
5th aobvious son of vertical dense cluster DEP1 gene carries out artificial mutation, the normal translation of impact DEP1 gene, lead to gene function to be lost or
Weaken thus improving the yield of Oryza sativa L. further.
Technical scheme is as follows：A kind of artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene, described Oryza sativa L.
The artificial directed mutants of vertical compact panicle DEP1 gene adopt CRISPR/Cas9 gene target modification technique the to DEP1 gene the 5th
Exon is modified so that the base of the 5th exon occurs replacement, deletion and/or insertion (three kinds mutational formats can random combine)
Obtain the artificial directed mutants of DEP1 gene；
Modify target spot to be located in one section of repetitive sequence of the 5th exon, the first target position is located at the 5th exon 499-
At 519 bases, the second target spot is located at the 5th exon 530-549 base, modifies target site sequence for two and is
AGCTGCGGTTGCAACGGCTG.
The present invention makes the base of the 5th exon replace, lack by CRISPR/Cas9 gene target modification technique
Or insert and 7 DEP1 allele of acquisition, these allele all can improve rice yield.
Described CRISPR/Cas9 gene target modification technique causes 4 bases CGGC in the second target spot 544-547 base
Disappearance, obtain DEP1 gene mutation body DEP1-D1, the 5th exon base sequence such as SEQ ID of mutant DEP1-D1
NO.1, this mutation physical ability improves rice yield 10% about.
Further, 31 bases at the second target spot for the described CRISPR/Cas9 gene target modification technique
CTTCCAAGCTGCGGTTGCAACGGCTGCGGCT adopts 10 bases TGTCCAAGCT to replace, and obtains DEP1 gene mutation body
The 5th exon base sequence such as SEQ ID NO.2 of DEP1-D2, mutant DEP1-D2, this mutation physical ability improves rice yield
More than 20%.
Further, described CRISPR/Cas9 gene target modification technique causes 2 in the first target spot 515-516 base
The disappearance of individual bases G G, inserts 1 base A between the second target spot the 546th and 547 bases, obtains DEP1 gene mutation body
The 5th exon base sequence such as SEQ ID NO.3 of DEP1-D3, mutant DEP1-D3, this mutation physical ability improves rice yield
More than 20%.
Further, described CRISPR/Cas9 gene target modification technique causes 3 in the first target spot the 515th～517 base
The disappearance of individual bases G GC, the second target spot the 538th～552 base causes the disappearance of 15 bases TTGCAACGGCTGCGG, obtains
The 5th exon base sequence such as SEQ ID NO.4 of DEP1 gene mutation body DEP1-D4, mutant DEP1-D4, this mutant
Rice yield more than 30% can be improved.
Further, described CRISPR/Cas9 gene target modification technique is between the first target spot the 517th and 518 bases
Cause the insertion of 1 base C, obtain DEP1 gene mutation body DEP1-D5, the 5th exon base sequence of mutant DEP1-D5
As SEQ ID NO.5, rice yield is improved more than 45% by this mutant.
Further, described CRISPR/Cas9 gene target modification technique causes in the first target spot 516-517 base
The disappearance of 2 bases G C, simultaneously 518-519 base TG be changed into GT, have 4 bases in the second target spot the 544th～547 base
The disappearance of CGGC, thus obtaining DEP1 gene mutation body DEP1-D6, the 5th exon base sequence of mutant DEP1-D6 is such as
SEQ ID NO.6, rice yield can be improved more than 50% by this mutant.
Further, described CRISPR/Cas9 gene target modification technique causes 545-546 base in the second target spot
The disappearance of 2 bases G G in place, obtains DEP1 gene mutation body DEP1-D7, the 5th exon base sequence of mutant DEP1-D7
As SEQ ID NO.7, rice yield is improved more than 50% by this mutation physical ability.
The present invention also provides the artificial directed mutants of described Oryza sativa L. vertical compact panicle DEP1 gene in breeding of hybridized rice and base
Because of the application in group editor's rice breeding.
The mechanism of the present invention is as follows：The present invention by for Oryza sativa L. vertical compact panicle DEP1 gene, using CRISPR/Cas9 base
Because targeting modification technology carries out rite-directed mutagenesises in the 5th exon design target spot of DEP1 gene, thus producing different mutation classes
Type, i.e. different allele.In order to be able to enable DEP1 gene the 5th exon to produce disappearance or the change of large fragment base,
The present invention especially have selected two target spots of design in one section of repetitive sequence in the 5th exon, the so target sequence of design
Two positions just can be simultaneously targeting, easily cause the disappearance of large fragment, then be easier to hinder normally turning over of the 5th exon
Translating, weakening gene function, thus improving rice yield.The present invention passes through to observe these different types of mutation to rice yield
Impact, filters out the excellent mutation type of performance, and rice yield can be improved more than 45%, better than certainly by excellent mutation type
So mutation type in boundary.
Compared with prior art, the invention has the advantages that：The present invention adopts CRISPR/Cas9 to vertical compact panicle
The aobvious son in the 5th of DEP1 gene carries out artificial mutation, and filters out the mutant that can significantly improve rice yield.The present invention provides
DEP1 gene mutation body rice yield can be brought up to more than 50%, the even better than mutation type of nature.
Brief description
Fig. 1 is DEP1 gene mutation body DEP1-D1 the 5th exon base sequence figure；
Fig. 2 is DEP1 gene mutation body DEP1-D2 the 5th exon base sequence figure；
Fig. 3 is DEP1 gene mutation body DEP1-D3 the 5th exon base sequence figure；
Fig. 4 is DEP1 gene mutation body DEP1-D4 the 5th exon base sequence figure；
Fig. 5 is DEP1 gene mutation body DEP1-D5 the 5th exon base sequence figure；
Fig. 6 is DEP1 gene mutation body DEP1-D6 the 5th exon base sequence figure；
Fig. 7 is DEP1 gene mutation body DEP1-D7 the 5th exon base sequence figure；
Fig. 8 is wild type vertical compact panicle DEP1 gene the 5th exon base sequence figure；
Note：In figure black overstriking region is target sequence, and the base of insertion is represented using italic, and the base of disappearance adopts
"-" represents.
Specific embodiment
With reference to specific embodiment, technical scheme is described in further details.
Embodiment 1
The base sequence of DEP1 gene is as shown in SEQ ID NO.8.
5th exon base sequence (wild type) of DEP1 gene, as shown in SEQ ID NO.9, is shown in Fig. 8.
The present embodiment target spot of DEP1 gene the 5th exon based on CRISPR/Cas9 Technology design, have selected 2 sequences
Arrange close and consistent target spot AGCTGCGGTTGCAACGGCTG, the first target position is located at the 5th exon 499-519 alkali
Ji Chu, the second target spot is located at the 5th exon 530-549 base.Target sequence is synthesized by the present embodiment,
Oligo15’-GGCAAGCTGCGGTTGCAACGGCTG-3 ',
Ologo2：5’-AAACAGCTGCGGTTGCAACGGCTG-3’.
The present embodiment is using containing cas9 expression cassette (35S promoter startup) and guid rna expression box, (rice Os U3 open
Mover) binary vector Pcambia1300 carry out vector construction for skeleton carrier, by target sequence insert skeleton carrier in, tool
Body way is：Oligo1 and Oligo2 is carried out phosphorylation of annealing, using restriction enzyme A ar I, enzyme is carried out to skeleton carrier
Cut, then using T4 ligase, the target sequence after phosphorylation of annealing is connected into skeleton carrier OsU3 promoter and sgRNA-
Between scaffold sequence, complete vector construction.
After vector construction, carrier is proceeded to Agrobacterium EHA105, enter as receptor so that the japonica rice variety Japan in Oryza sativa L. is fine
Row Agrobacterium-mediated Transformation.Through screening, differentiation, obtain T0 after rooting process for transfer-gen plant.Collection T0 carries for plant leaf
Take DNA, enter performing PCR detection in 2 target spot periphery design detection primers of DEP1 gene the 5th exon, detection primer is：
DEP1-test-f:TGCCAAACTGAGCTTTTACATGG,
DEP1-test-r:TGAAGATGTTGAAGCAGCTGGAG.
PCR primer is carried out SANGER sequencing, determines the T0 undergoing mutation for plant.
Plant jumping phenomenon is detected in T0 generation is carried out sowing, carries out the plantation in T1 generation, T1 is for Plant Leaf for collection
Piece extracts DNA, is detected using detection primer as above, determines that DEP1 gene mutation type is homozygous mutation or heterozygosis is dashed forward
Become；Design hygromycin (entirely writing) detection primer, primer sequence is simultaneously：HYG-f:CTATTTCTTTGCCCTCGGAC,HYG-r:
CCTGACCTATTGCATCTCCC, the presence of detection hygromycin fragment, determine that foreign vector T-DNA fragment whether there is with this.
Filter out 7 kinds of DEP1 mutation types be homozygous mutation simultaneously HYG be detected as feminine gender plant carry out sowing.
The plant that T1 generation is filtered out carries out sowing, carries out the plantation in T2 generation, and every kind of mutation type plants 49 plants.In theory
T2 is on behalf of the Mutants homozygous of 7 kinds of mutation types.In order to verify this point, random screening plant part has carried out genotype inspection
Survey it was demonstrated that T2 is the Mutants homozygous of 7 kinds of mutation types really for plant.In order to determine the impact to yield for 7 kinds of mutation types,
In the period of maturation in T2 generation, to the setting percentage of every kind of genotype, grain number per spike, effective fringe, mass of 1000 kernel and single plant yield Isoquant index
Counted, found that 7 kinds of DE P1 gene mutation bodies all dramatically increase single plant yield.
Corresponding mutant is as follows：4 base deletions of DEP1-D1 the second target spot, the second target sequence is changed into
AGCTGCGGTTGCAA----TG, the Base sequence of the 5th exon is as shown in SEQ ID NO.1；See Fig. 1.
DEP1-D2 second target spot and 31 bases in front and back are replaced by 10 bases, between the first target spot to the second target spot
Sequence is changed into AGCTGCGGTTGCAACGGCTGTGGCTGTCCAAGCT, the Base sequence such as SEQ ID NO.2 institute of the 5th exon
Show；See Fig. 2.
DEP1-D3 the first target spot 2 base deletion, the second target spot single base insertion, the first target spot is to the sequence of the second target spot
It is changed into AGCTGCGGTTGCAAC--CTGTGGCCTTCCAAGCTGCGGTTGCAACGGACTG, the Base sequence of the 5th exon is such as
Shown in SEQ ID NO.3；See Fig. 3.
DEP1-D4 the first target spot 3 base deletion, the second target spot and subsequent 15 base deletions, the first target spot is to the second target
The base sequence of point is changed into：AGCTGCGGTTGCAAC---TGTGGCCTTCCAAGCTGCGG---------------；Outside 5th
The Base sequence of aobvious son is as shown in SEQ ID NO.4；See Fig. 4.
The single base of DEP1-D5 first target spot is inserted, and the base sequence of the first target spot is changed into
AGCTGCGGTTGCAACGGCCTG, the Base sequence of the 5th exon is as shown in SEQ ID NO.5；See Fig. 5.
DEP1-D6 the first target spot 2 base deletion, the first target spot latter two base TG is changed into GT, and the second target spot 4 base lacks
Lose, the base sequence of the first target spot to the second target spot is changed into AGCTGCGGTTGCAACG--
GTTGGCCTTCCAAGCTGCGGTTGCAA----TG, the Base sequence of the 5th exon is as shown in SEQ ID NO.6；See Fig. 6.
DEP1-D7 the second target spot 2 base deletion, the second target bases sequence is changed into：AGCTGCGGTTGCAAC--CTG the 5th
The Base sequence of exon, as shown in SEQ ID NO.7, is shown in Fig. 7.
The impact to single plant yield of 7 kinds of DEP1 gene mutation bodies, as shown in table 1.
Table 1
Note：" ns " represents all not notable in 0.01 and 0.05 level difference, and " *, * * " is illustrated respectively in 0.05,0.01 difference
Reach significant level；D1-D7 is 7 kinds of mutants, and wide is wild type control.
As shown in Table 1, the amount of increase in production of the gene mutation body of 7 kinds of DEP1 is from 13%～51%, wherein DEP1-D6 and
The effect of increasing production of DEP1-D7 is the most notable, has reached more than 50%, the far superior to mutation type in nature.
SEQUENCE LISTING
<110>Yunnan Na Bo bio tech ltd
<120>A kind of artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene and its application
<130> 20160728
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 999
<212> DNA
<213>Artificial sequence
<400> 1
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caacggctgt ggccttccaa gctgcggttg 540
caatgcggct cgtgctcttg cgcccaatgc aaacccgatt gtggctcgtg ctctaccaat 600
tgctgtagct gcaagccaag ctgcaacggc tgctgcggcg agcagtgctg ccgctgcgcg 660
gactgcttct cctgctcgtg ccctcgttgc tccagctgct tcaacatctt caaatgctcc 720
tgcgctggct gctgctcgag cctgtgcaag tgcccctgca cgacgcagtg cttcagctgc 780
cagtcgtcat gctgcaagcg gcagccttcg tgctgcaagt gccagtcgtc ttgctgcgag 840
gggcagcctt cctgctgcga gggacactgc tgcagcctcc cgaaaccgtc gtgccctgaa 900
tgttcctgtg ggtgtgtctg gtcttgcaag aattgtacag agggttgtcg atgcccacgg 960
tgtcgtaacc catgctgtct cagtggttgc ttatgttga 999
<210> 2
<211> 982
<212> DNA
<213>Artificial sequence
<400> 2
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caacggctgt ggctgtccaa gctcgtgctc 540
ttgcgcccaa tgcaaacccg attgtggctc gtgctctacc aattgctgta gctgcaagcc 600
aagctgcaac ggctgctgcg gcgagcagtg ctgccgctgc gcggactgct tctcctgctc 660
gtgccctcgt tgctccagct gcttcaacat cttcaaatgc tcctgcgctg gctgctgctc 720
gagcctgtgc aagtgcccct gcacgacgca gtgcttcagc tgccagtcgt catgctgcaa 780
gcggcagcct tcgtgctgca agtgccagtc gtcttgctgc gaggggcagc cttcctgctg 840
cgagggacac tgctgcagcc tcccgaaacc gtcgtgccct gaatgttcct gtgggtgtgt 900
ctggtcttgc aagaattgta cagagggttg tcgatgccca cggtgtcgta acccatgctg 960
tctcagtggt tgcttatgtt ga 982
<210> 3
<211> 1002
<212> DNA
<213>Artificial sequence
<400> 3
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caacctgtgg ccttccaagc tgcggttgca 540
acggactgcg gctcgtgctc ttgcgcccaa tgcaaacccg attgtggctc gtgctctacc 600
aattgctgta gctgcaagcc aagctgcaac ggctgctgcg gcgagcagtg ctgccgctgc 660
gcggactgct tctcctgctc gtgccctcgt tgctccagct gcttcaacat cttcaaatgc 720
tcctgcgctg gctgctgctc gagcctgtgc aagtgcccct gcacgacgca gtgcttcagc 780
tgccagtcgt catgctgcaa gcggcagcct tcgtgctgca agtgccagtc gtcttgctgc 840
gaggggcagc cttcctgctg cgagggacac tgctgcagcc tcccgaaacc gtcgtgccct 900
gaatgttcct gtgggtgtgt ctggtcttgc aagaattgta cagagggttg tcgatgccca 960
cggtgtcgta acccatgctg tctcagtggt tgcttatgtt ga 1002
<210> 4
<211> 985
<212> DNA
<213>Artificial sequence
<400> 4
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caactgtggc cttccaagct gcggctcgtg 540
ctcttgcgcc caatgcaaac ccgattgtgg ctcgtgctct accaattgct gtagctgcaa 600
gccaagctgc aacggctgct gcggcgagca gtgctgccgc tgcgcggact gcttctcctg 660
ctcgtgccct cgttgctcca gctgcttcaa catcttcaaa tgctcctgcg ctggctgctg 720
ctcgagcctg tgcaagtgcc cctgcacgac gcagtgcttc agctgccagt cgtcatgctg 780
caagcggcag ccttcgtgct gcaagtgcca gtcgtcttgc tgcgaggggc agccttcctg 840
ctgcgaggga cactgctgca gcctcccgaa accgtcgtgc cctgaatgtt cctgtgggtg 900
tgtctggtct tgcaagaatt gtacagaggg ttgtcgatgc ccacggtgtc gtaacccatg 960
ctgtctcagt ggttgcttat gttga 985
<210> 5
<211> 1004
<212> DNA
<213>Artificial sequence
<400> 5
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caacggcctg tggccttcca agctgcggtt 540
gcaacggctg cggctcgtgc tcttgcgccc aatgcaaacc cgattgtggc tcgtgctcta 600
ccaattgctg tagctgcaag ccaagctgca acggctgctg cggcgagcag tgctgccgct 660
gcgcggactg cttctcctgc tcgtgccctc gttgctccag ctgcttcaac atcttcaaat 720
gctcctgcgc tggctgctgc tcgagcctgt gcaagtgccc ctgcacgacg cagtgcttca 780
gctgccagtc gtcatgctgc aagcggcagc cttcgtgctg caagtgccag tcgtcttgct 840
gcgaggggca gccttcctgc tgcgagggac actgctgcag cctcccgaaa ccgtcgtgcc 900
ctgaatgttc ctgtgggtgt gtctggtctt gcaagaattg tacagagggt tgtcgatgcc 960
cacggtgtcg taacccatgc tgtctcagtg gttgcttatg ttga 1004
<210> 6
<211> 997
<212> DNA
<213>Artificial sequence
<400> 6
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caacggttgg ccttccaagc tgcggttgca 540
atgcggctcg tgctcttgcg cccaatgcaa acccgattgt ggctcgtgct ctaccaattg 600
ctgtagctgc aagccaagct gcaacggctg ctgcggcgag cagtgctgcc gctgcgcgga 660
ctgcttctcc tgctcgtgcc ctcgttgctc cagctgcttc aacatcttca aatgctcctg 720
cgctggctgc tgctcgagcc tgtgcaagtg cccctgcacg acgcagtgct tcagctgcca 780
gtcgtcatgc tgcaagcggc agccttcgtg ctgcaagtgc cagtcgtctt gctgcgaggg 840
gcagccttcc tgctgcgagg gacactgctg cagcctcccg aaaccgtcgt gccctgaatg 900
ttcctgtggg tgtgtctggt cttgcaagaa ttgtacagag ggttgtcgat gcccacggtg 960
tcgtaaccca tgctgtctca gtggttgctt atgttga 997
<210> 7
<211> 1001
<212> DNA
<213>Artificial sequence
<400> 7
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caacggctgt ggccttccaa gctgcggttg 540
caacctgcgg ctcgtgctct tgcgcccaat gcaaacccga ttgtggctcg tgctctacca 600
attgctgtag ctgcaagcca agctgcaacg gctgctgcgg cgagcagtgc tgccgctgcg 660
cggactgctt ctcctgctcg tgccctcgtt gctccagctg cttcaacatc ttcaaatgct 720
cctgcgctgg ctgctgctcg agcctgtgca agtgcccctg cacgacgcag tgcttcagct 780
gccagtcgtc atgctgcaag cggcagcctt cgtgctgcaa gtgccagtcg tcttgctgcg 840
aggggcagcc ttcctgctgc gagggacact gctgcagcct cccgaaaccg tcgtgccctg 900
aatgttcctg tgggtgtgtc tggtcttgca agaattgtac agagggttgt cgatgcccac 960
ggtgtcgtaa cccatgctgt ctcagtggtt gcttatgttg a 1001
<210> 8
<211> 4701
<212> DNA
<213>Oryza sativa L.
<400> 8
tctcttccct ctctctcttt ctctctccaa accccacgca cgccgcgtcg ccgcctcctc 60
ctctccatct ccgctgctat tattgcccgc gcagacgcag gccaccatcc ttcctctcgc 120
tcacgctcgc tgctatatgg gggtcctcct catcgcatcg catcgcatca cctcgcacgg 180
gcgcgcgcgc cgtgccgtgc cgctagctcg atccgcctcg tacgccagct cgctcgctcg 240
ctcccccacc ccgctgctgc acggctgcgc ccgcgctgtc ccctgtcccc ccgctcgccg 300
cggcgattta tacccaccac gccccctgct gctgctataa tgcccatgag tgaaggcggc 360
gaggggtggt tctgagttgg ccgttggcgt gctgcgtgtg gagatggggg aggaggcggt 420
ggtgatggag gcgccgaggc ccaagtcgcc gccgaggtac ccggacctgt gcggccggcg 480
gcggatgcag ctggaggtgc agatcctgag ccgcgagatc acgttcctca aggtgagcgc 540
cccgcggcgg cggcggctgc gtttttctct ataggtttct ctttcacact cgctcgctcg 600
aaattctcgg ggcccgagct ctacttgctt cgtcttcctt tgactttacc gattaatttt 660
aaaaaaaagg agatccgatt cgccgcgcat ttttcaaaac ccaagcggcc gagtacggag 720
ctacccgcta ctgcaagtag gatgctgtga agtgtacagt aatggcgttg ttaattgcgg 780
tagctagtgc tattctagta cttgtagtac tgtttctagg cggaggtgaa tcacggcgcc 840
atcaatccga ggctggcgag acaagcttgg ccctctttgg gcgtggcgcc atggctgtac 900
tacctttgtc gttgtttggt tgggctcctc gttggagaaa agaagagcgt gggcatggac 960
aactgacctg agtggccttg tcagggagag ccatagcagt ggacgtgtct atctccgcca 1020
ttgcttcgtc gacactggac gtgcagacgg catggccatg agggctttgc acgatgggtg 1080
gtgccgtgtt ggtgttatgg gctgccacca tggtttgagg cttttgatgt tgctagattt 1140
tgtgtttaac gagggaggga agaatgtgtt gttcttgaca ctgtgctgtg cttttaagga 1200
gcagagattt cagaagctct tcagatatca gagaacttct ttgtagtagt aatcaaatgc 1260
gctttagaca tctttttatc gtttcttgca aggtcagtcc ctgctttggt acccgatctc 1320
gcttttgtgc aacatcaaag ttacacttac acagtaaagc aggaatcttt atgggaccgt 1380
tcgtactggt caattactcc aggctttgat taatgggttt taagttttaa ccgcagattt 1440
ggtacaagta acaaccttta tttacttttt atttctgcaa ctgtgtcttt taacatgaaa 1500
gaatccagct ccattcaaaa gtttagtttt tattttccat tgtggtgcat ggtcactcag 1560
cctgcagtac tgaattatca aaattttctt ttgtcatttc tctcatgtta agtgcatagt 1620
ctattttact tcaacaggta gaaaaacttt tgtgggtttg tttctagctc aaggaggaaa 1680
ttcatgggtt tgcatctagc acatgagaga acaatattgg tctaacacaa agctcctttt 1740
gtaggatgag cttcacttcc ttgaaggagc tcagcccgtt tctcgttctg gatgcattaa 1800
agagtatgta ctactgccct tcatgcatta cagatatttt gtttttaagt ttttagaaat 1860
ttgaagagct tatgtcaagt atgaaatgtc agcttaattt tattgctgtc cttatctaat 1920
gtcttatgct ctgttttata aaatttggtt gcattttctc ccccagggaa aaatcttgta 1980
taagtgtgtt atgtacttat gtgtataaaa tcttgttgca cttgtatgtc acacttaggc 2040
cctgtttaga tcctccaaaa tggcagtttg ccattttgaa gaaccttttg ccattttgga 2100
tctaaacact agtaacaaaa cttggcaatt tggcatttgg catttgctag tctatagtag 2160
caaattgtgc caaaaagtgc tttggaacca ctctctcttt ctttctctct ctcactttag 2220
tgctagaatg gtaaaagttt aggatgcatc taaacaccaa ctagtacttt tacaatacta 2280
aaacttttgc caccaaaact tttgccattt gccatttgct atttcaaatg gatctaaaca 2340
gggccttagc aaatcaccat atgttaaaat taccttggga tgaaaaagaa aaaggaaacc 2400
agcattgaag tcttgtttga aatgcatatg tacttgtacc attacagaaa ttcttaaaac 2460
tgctgtcttg acagctactt atcaaacagc cccacctgca tcataacgtt cctagtggtg 2520
cctataactc tgcctcagtt attattttgt ggcccactgg tccaacaatt tgaaaaaaat 2580
tatattgaac taaatatatt gaacagtagt atgacgtcct ctttgcttga gttccatatt 2640
acagctcaca gtcctgagat ttgtttcacc gattctttcc atgcgatgtg cacatattct 2700
tattcaattt aaaaaatgaa agcagattat ttttaacaag taacctatca cgttagctta 2760
acattgtata tttgtggtgg aattatgtaa tattccgata tcgcatttga agttttgaac 2820
atgtgtgctc aaattgaggg acacatgact gtagtgaaag caaatataaa tgtctgagca 2880
atggactata ctttgtattc attactacaa gttatgtcct tttgcaggtt gctaatgtcc 2940
tcttacatta cttgtcagga taaatgagtt tgttggtaca aaacatgacc cactaatacc 3000
aacgtatggc ctctaaactt tcagttcccc cattttaagc atgttcgctg tttatttacg 3060
agttttgaca ttgttttttc cttttccaga aagagaagga ggcacagatc ttgccgtctt 3120
tttcggtgga tcgggtatgt tttgatccaa tatagtttgc tcgcaggttc tgaggggcaa 3180
gaacattcaa atatctataa tgttttctgt tggattcaac attcatcact atttccctcg 3240
aaaaaaaagc attcgtcact attggaattg aaagtctgaa agtgcctcta gtccctttgt 3300
atgttaaaag tcaataaaca agcagtagtt ttctatatgc cacattaata ttattgacgc 3360
attttaaaaa gcaaactagt ccagggatgt aatcatcttt gttatctaaa actaaaaaag 3420
gaaaaactag tgctttttta cattaacatt gatttttttg cggctgaaat tacatgtaga 3480
aactttggca taataatctg tactactgcc aaactgagct tttacatggt gaaaatattt 3540
tccctgcaga tcaaaattgt gtatctgcat ttcatgtctt tgctactgtt gcaagtgctc 3600
acccaagtgc aaaagaccaa ggtgcctcaa ttgttcttgc agctcatgct gcgacgagcc 3660
atgctgtaag ccaaactgca gtgcgtgctg cgctgggtca tgctgtagtc cagactgctg 3720
ctcatgctgt aaacctaact gcagttgctg caagacccct tcttgctgca aaccgaactg 3780
ctcgtgctcc tgtccaagct gcagctcatg ctgcgataca tcgtgctgca aaccgagctg 3840
cacctgcttc aacatctttt catgcttcaa atccctgtac agctgcttca agatcccttc 3900
atgcttcaag tcccagtgca actgctctag ccccaattgc tgcacttgca cccttccaag 3960
ctgtagctgc aagggctgtg cctgtccaag ctgtggatgc aacggctgtg gctgtccaag 4020
ctgcggatgc aacggttgtg gctgtccaag ctgcggttgc aacggctgtg gccttccaag 4080
ctgcggttgc aacggctgcg gctcgtgctc ttgcgcccaa tgcaaacccg attgtggctc 4140
gtgctctacc aattgctgta gctgcaagcc aagctgcaac ggctgctgcg gcgagcagtg 4200
ctgccgctgc gcggactgct tctcctgctc gtgccctcgt tgctccagct gcttcaacat 4260
cttcaaatgc tcctgcgctg gctgctgctc gagcctgtgc aagtgcccct gcacgacgca 4320
gtgcttcagc tgccagtcgt catgctgcaa gcggcagcct tcgtgctgca agtgccagtc 4380
gtcttgctgc gaggggcagc cttcctgctg cgagggacac tgctgcagcc tcccgaaacc 4440
gtcgtgccct gaatgttcct gtgggtgtgt ctggtcttgc aagaattgta cagagggttg 4500
tcgatgccca cggtgtcgta acccatgctg tctcagtggt tgcttatgtt gatctagatc 4560
cttttttggt tgttgttttt cttgtatttt ttagttgtta ggcctttgat taagttcgaa 4620
ctttcataaa tatatggtgt ttatcctgta aagaaatgat gatttcaagg atttttcata 4680
gctatgagac gaggttgaac c 4701
<210> 9
<211> 1003
<212> DNA
<213>Oryza sativa L.
<400> 9
atcaaaattg tgtatctgca tttcatgtct ttgctactgt tgcaagtgct cacccaagtg 60
caaaagacca aggtgcctca attgttcttg cagctcatgc tgcgacgagc catgctgtaa 120
gccaaactgc agtgcgtgct gcgctgggtc atgctgtagt ccagactgct gctcatgctg 180
taaacctaac tgcagttgct gcaagacccc ttcttgctgc aaaccgaact gctcgtgctc 240
ctgtccaagc tgcagctcat gctgcgatac atcgtgctgc aaaccgagct gcacctgctt 300
caacatcttt tcatgcttca aatccctgta cagctgcttc aagatccctt catgcttcaa 360
gtcccagtgc aactgctcta gccccaattg ctgcacttgc acccttccaa gctgtagctg 420
caagggctgt gcctgtccaa gctgtggatg caacggctgt ggctgtccaa gctgcggatg 480
caacggttgt ggctgtccaa gctgcggttg caacggctgt ggccttccaa gctgcggttg 540
caacggctgc ggctcgtgct cttgcgccca atgcaaaccc gattgtggct cgtgctctac 600
caattgctgt agctgcaagc caagctgcaa cggctgctgc ggcgagcagt gctgccgctg 660
cgcggactgc ttctcctgct cgtgccctcg ttgctccagc tgcttcaaca tcttcaaatg 720
ctcctgcgct ggctgctgct cgagcctgtg caagtgcccc tgcacgacgc agtgcttcag 780
ctgccagtcg tcatgctgca agcggcagcc ttcgtgctgc aagtgccagt cgtcttgctg 840
cgaggggcag ccttcctgct gcgagggaca ctgctgcagc ctcccgaaac cgtcgtgccc 900
tgaatgttcc tgtgggtgtg tctggtcttg caagaattgt acagagggtt gtcgatgccc 960
acggtgtcgt aacccatgct gtctcagtgg ttgcttatgt tga 1003
Claims (9)
1. a kind of artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene are it is characterised in that described Oryza sativa L. vertical compact panicle DEP1
The artificial directed mutants of gene adopt CRISPR/Cas9 gene target modification technique that the 5th exon of DEP1 gene is modified, and make
The base obtaining the 5th exon occurs replacement, deletion and/or insertion to obtain the artificial directed mutants of DEP1 gene；
Modify target spot to be located in one section of repetitive sequence of the 5th exon, the first target position is located at the 5th exon 499-519 alkali
Ji Chu, the second target spot is located at the 5th exon 530-549 base, modifies target sequence for two and is
AGCTGCGGTTGCAACGGCTG.
2. the artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as claimed in claim 1 are it is characterised in that described
CRISPR/Cas9 gene target modification technique causes the disappearance of 4 bases CGGC in the second target spot 544-547 base, obtains
DEP1 gene mutation body DEP1-D1, the 5th exon base sequence such as SEQ ID NO.1 after disappearance base.
3. the artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as claimed in claim 1 are it is characterised in that described
31 bases at the second target spot for the CRISPR/Cas9 gene target modification technique
CTTCCAAGCTGCGGTTGCAACGGCTGCGGCT adopts 10 bases TGTCCAAGCT to replace, and obtains DEP1 gene mutation body
DEP1-D2, the 5th exon base sequence such as SEQ ID NO.2 of mutant.
4. the artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as claimed in claim 1 are it is characterised in that described
CRISPR/Cas9 gene target modification technique causes the disappearance of 2 bases G G in the first target spot 515-516 base, second
Insert 1 base A between target spot the 546th and 547 bases, obtain DEP1 gene mutation body DEP1-D3, the 5th of mutant is outer aobvious
Sub- base sequence such as SEQ ID NO.3.
5. the artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as claimed in claim 1 are it is characterised in that described
CRISPR/Cas9 gene target modification technique causes the disappearance of 3 bases G GC in the first target spot the 515th～517 base, and second
Target spot the 538th～552 base causes the disappearance of 15 bases TTGCAACGGCTGCGG, obtains DEP1 gene mutation body DEP1-
D4, the 5th exon base sequence such as SEQ ID NO.4 of mutant.
6. the artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as claimed in claim 1 are it is characterised in that described
CRISPR/Cas9 gene target modification technique causes the insertion of 1 base C between the first target spot the 517th and 518 bases, obtains
To DEP1 gene mutation body DEP1-D5, the 5th exon base sequence such as SEQ ID NO.5 after mutation.
7. the artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as claimed in claim 1 are it is characterised in that described
CRISPR/Cas9 gene target modification technique causes the disappearance of 2 bases G C in the first target spot 516-517 base, and simultaneously
518-519 base TG is changed into GT, has the disappearance of 4 bases CGGC in the second target spot the 544th～547 base, thus obtaining DEP1
Gene mutation body DEP1-D6, the 5th exon base sequence such as SEQ ID NO.6 of mutant.
8. the artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as claimed in claim 1 are it is characterised in that described
CRISPR/Cas9 gene target modification technique causes the disappearance of 2 bases G G at 545-546 base in the second target spot, obtains
DEP1 gene mutation body DEP1-D7, the 5th exon base sequence such as SEQ ID NO.7 of mutant.
9. a kind of described artificial directed mutants of Oryza sativa L. vertical compact panicle DEP1 gene as arbitrary in claim 1～8 are in hybridization water
Application in rice breeding and genome editor's rice breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610615347.6A CN106434688A (en) | 2016-08-01 | 2016-08-01 | Artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610615347.6A CN106434688A (en) | 2016-08-01 | 2016-08-01 | Artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434688A true CN106434688A (en) | 2017-02-22 |
Family
ID=58184772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610615347.6A Pending CN106434688A (en) | 2016-08-01 | 2016-08-01 | Artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434688A (en) |
Cited By (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392024A (en) * | 2005-03-31 | 2009-03-25 | 中国科学院遗传与发育生物学研究所 | Rice tillering associated protein and encoding gene and use thereof |
| CN103880936A (en) * | 2012-12-20 | 2014-06-25 | 中国农业大学 | GPA2 gene controlling seeds per ear of plant and applications thereof |
-
2016
- 2016-08-01 CN CN201610615347.6A patent/CN106434688A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392024A (en) * | 2005-03-31 | 2009-03-25 | 中国科学院遗传与发育生物学研究所 | Rice tillering associated protein and encoding gene and use thereof |
| CN103880936A (en) * | 2012-12-20 | 2014-06-25 | 中国农业大学 | GPA2 gene controlling seeds per ear of plant and applications thereof |
Non-Patent Citations (1)
| Title |
|---|
| MEIRU LI.ET AL: "Reassessment of the Four Yield-related Genes Gn1a,DEP1,GS3, and IPA1 in Rice Using a CRISPR/Cas9 System", 《FRONT PLANT SCI.》 * |
Cited By (39)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434688A (en) | Artificial fixed-point rice dense and erect panicle (DEP1) gene mutant body and application thereof | |
| CN106011150A (en) | Rice grain number per ear Gn1a gene artificial site-directed mutant and application thereof | |
| CN106793760B (en) | Virus resistant tobacco and preparation method thereof | |
| US20150291969A1 (en) | Compositions for reduced lignin content in sorghum and improving cell wall digestibility, and methods of making the same | |
| Scowcroft et al. | Chloroplast DNA assorts randomly in intraspecific somatic hybrids of Nicotiana debneyi | |
| CN111333707B (en) | Plant grain type related protein and coding gene and application thereof | |
| CN110862993B (en) | Gene ZKM89 for controlling plant height and ear position height of corn and application thereof | |
| WO2019161146A1 (en) | Compositions and methods for improving crop yields through trait stacking | |
| CN113004383B (en) | Application of corn gene ZmEREB102 in improving corn yield | |
| CN113265422B (en) | Method for targeted knocking out rice grain type regulatory gene SLG7, rice grain type regulatory gene SLG7 mutant and application thereof | |
| CN112500463B (en) | Gene ZmCOL14 for controlling plant height and ear position height of corn and application thereof | |
| WO2023221826A1 (en) | Gene kwe2 that regulates maize ear grain weight and yield, protein encoding same, indel1 marker, expression vector and use thereof in plant trait improvement | |
| CN114262713B (en) | Application of E41 gene in regulating and controlling plant embryo development | |
| CN114657157B (en) | Application of ZmD protein in regulation of corn plant height | |
| CN102174523A (en) | Genes for regulating size of seeds as well as protein coded therewith and application thereof | |
| CN114805509A (en) | Application of protein OsGATA6 in regulation and control of flowering time, panicle shape, grain shape and thousand grain weight of plants | |
| CN113151295A (en) | Rice temperature-sensitive male sterile gene OsFMS1 and application thereof | |
| CN108841840B (en) | Application of protein TaNADH-GoGAT in regulation and control of plant yield | |
| CN109912703B (en) | Application of protein OsARE1 in regulation and control of plant senescence | |
| CN102206639A (en) | Gene adjusting starch anabolism of plant seeds and its application | |
| CN112159464A (en) | Wheat TaSEP gene and application thereof in regulating growth and development | |
| CN110760525A (en) | Nucleotide sequence related to pod shattering resistance of rape and application thereof | |
| CN108892712B (en) | Application of protein TabZIP60 in regulation and control of plant yield | |
| CN113801885B (en) | Rice large grain gene LG1 and application thereof | |
| CN113817754B (en) | Rice short-grain gene SHG1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170222 |