CN1062601C - Viral vaccines - Google Patents

Abstract

The present invention relates to a mutant virus used as a vaccine. As for the essential gene generating infective viruses, the genome of the virus has defects. On one hand, the mutant virus can prevent sensitive species immunized by the mutant virus from the infection of corresponding wild type viruses; on the other hand, the mutant virus can be used as a carrier of an immunogenicity protein which is derived from a pathogen and encoded by foreign DNA incorporating the mutant virus, and the mutant virus can generate mutant viruses in the recombination host cell expressing some genes compensating defects. The host protected by the mutant virus has infectivity, but the defect genes are permitted to at least express some virogenes in the infected host to result in the cell-mediated immune reaction.

Description

Virus vaccines

The present invention relates to virus vaccines, particularly relate to mutated viruses, the vaccine that contains mutated viruses, recombinant cell as vaccine with the transformation of genetic engineering means, and the method for producing vaccine.

Virus vaccines generally is divided into two classes.The first kind is " killed " vaccine, and it is for passing through the virus formulation that kills after suitable chemical substance such as β-Bing Chunsuanneizhi are handled.Second class is " attenuation " vaccine of living, and it is for through to virus genomic specificity genetic manipulation, or more commonly goes down to posterity in certain types of tissue culture systems and reduced pathogenic virus to the host.This vaccine of two types all has its shortcoming separately.Because killed virus vaccines can not duplicate in the host, thus necessary drug administration by injection, and therefore may produce unsuitable immune response.For example killed poliovirus preparation (being Salk vaccine) can produce immunoglobulin (Ig) (Ig) G antibody response, but can not be the generation of intestines internal stimulus IgA at the natural position of primary infection.Therefore, though this vaccine can protect body to avoid taking place poliomyelitic neurological complication, can not block primary infection, and can not give " herd immunity ".In addition, the virus of killing promptly can not enter in the host cell, can not duplicate therein.Therefore can not produce any useful immunological response at the nonstructural proteins that is produced between replicative phase, they can not stimulate the generation at the cellular toxicity T cell of virus antigen." extremely " antigen can not be presented the cell inspection by antigen and pick up and offer the T cell.Yet, can present and cause hormesis by class to t helper cell.T helper cell can help the B cell to produce at antigenic specific antibody again.For the generation of irritation cell toxicity T cell, must process virus antigen by infected intracellular special pathway, and appear on the class as interrupted peptide fragment.It is generally acknowledged that this degradation pathway is the most effective for those synthetic protein in infected cell, could produce virus-specific cellular toxicity T cell so only enter in the host cell and express the proteinic virus of immunogenic virus.Therefore, killed vaccine is the bad inductor of the cellular immunity of inducing anti-disease poison infection.From this viewpoint, the virus vaccines of living is more desirable.

So far, made the attenuated virus of living by deletion non-essential gene or the gene (in the case, damage is to make still reservation function activity of gene, but can not play a role very effectively) that partly damages one or more necessity.But the attenuated virus of living usually has residual pathogenic, and the host is caused harmful effect.In addition, unless cause attenuation, be the virus of strong virus force form more otherwise might reverse through specificity deletion.But there is a fact to be, in the host, can produces some virus protein, this means that they are more more effective than the killed vaccine that those can not produce virus protein.

The attenuated virus of living not only itself can be used as vaccine, and can be used as " vaccine carrier " of other gene, in other words is the gene of portability from second kind of virus (or other pathogenic agent) of palpus antagonism.Generally speaking.Can use the member of Poxviridae such as vaccinia virus as vaccine carrier.When using virus as vaccine carrier, importantly it can not cause pathogenic effects.In other words, must carry out attenuation to it with the same quadrat method that can make simple virus vaccines attenuation.Also can there be same shortcoming as described above when therefore, using in this case.

Have been found that and from viral genome, to delete certain gene, and so-called " complementation " cell is provided, and then the virus of the product that has deleted gene is provided by this cell.This method is achieved in as adenovirus, simplexvirus and retrovirus in some virus.For adenovirus, be fragment conversion human cell line (Graham, Smiley, Russell ﹠amp with 5 type adenovirus DNAs; Nairn, J.Gen, Virol, 36,59-72,1977).Some virogene of this expression of cell lines, and find that it can support to have growth (Harrison, the Graham of virus mutant of the gene of its deleted or inactivation; Williams, Virology 77,319-329,1977).Though the virion of standard can be grown and produce to virus well on this clone (" complementary cell system "), can not grow on normal cell fully.The cell that has shown the T antigen encoding district of expressing SV40 viral genome (papovavirus) can be supported the virus of being deleted by specificity duplicate (Gluzman, Cell, 23,182-195,1981) in this zone.For herpes simplex virus, expression gB glycoprotein (Cai et al, J.Virol.62 have been produced, 714-721,1987), gD glycoprotein (Ligas ang Johnson, J, Virol.62,1486,1988) and direct early protein ICP4 (Deluca et al.J.Virol, 56,558,1985) clone, and shown that these clones can support to have the duplicating of virus of corresponding gene specificity inactivation copy.

The invention provides the mutated viruses as vaccine, wherein coding produces the necessary deleted or inactivation of proteinic virogene of infectious virus institute; And wherein said virus can be grown in having the cell of heterologous nucleotide sequence, the necessary protein that said nucleotide sequence can make said cell expressing be encoded by said virogene deleted or inactivation.

The present invention also provides and has comprised above-mentioned virus, together with the vaccine of one or more vehicle and/or adjuvant.Viral genome itself can provide immunogen, maybe can contain the heterologous gene of expressing this immunogen protein and insert section.

The present invention also provides with aforesaid, is used to prepare the complementary cell of the attenuated virus transfection of vaccine.

The present invention also provides and has used above-mentioned virus preparation to be used for the treatment of or the method for the vaccine of preventing disease.

The present invention also provides the method for producing vaccine, this method comprises the cell of cultivating with the virus infection of the virogene that has deleted or inactivation, the indispensable protein of wherein said virogene a kind of generation of coding for infectious virus, and wherein host cell has the heterologous nucleotide sequence that comprises said virogene and can express necessary protein by said genes encoding, gather in the crops the virus that so produces then, and use it in the vaccine.

Virus can be derived from herpes simplex virus (HSV), and the gene of the glycoprotein h (gH) of wherein for example encoding is by inactivation or deletion.Mutated viruses also can comprise the immunogenic heterologous sequence that coding is derived from pathogenic agent, and host cell can be a recombined eukaryotic cell system of containing the gene of coding HSV glycoprotein h.As another example, virus can be to be derived from certain true poxvirus such as vaccinia virus, and it can comprise that also coding is derived from the immunogenic heterologous sequence of pathogenic agent.

The present invention has shown the unique way that a kind of extra immunoreactive validity of inducing with killed vaccine with by the virus protein that attenuated vaccine produces in vivo and security combine.In preferred embodiments, it comprises two features.At first, normally in viral genome, make the gene inactivation of selection through producing the specificity disappearance.This gene will participate in the generation of infectious virus, but preferably not hinder virus genomic duplicating.Therefore infected cell can produce multiple virus protein by the genetic stocks that duplicates, and can produce new virion in some cases, but these viruses all are not have infectively, and this just means that virus infection can not spread from inoculation position and comes.

Second feature of the present invention is related to the cell that virus provides the expression product of deleted gene, thereby enables growth virus in tissue culture.Therefore, though virus lacks certain necessary proteinic gene of coding,, can breed and generation and provirus are not seen the complete virion what difference is arranged if it grows in the appropriate host cell.These mutated viruses goods have the genome of defective and can not produce in normal host on the meaning of infectious virus from it, and it is a non-activity, so can use it safely by the amount that is enough to directly to produce humoral immune reaction in host.Therefore, mutated viruses not necessarily has infectivity to protected host's cell, and need only use killed vaccine or the identical mode of attenuated vaccine alive to use and can play a role routinely.But can combine with cell from immune virus, enter in the cell, and start the virus replication cycle, thereby can cause to infect and produce therein on the meaning of some virus antigen in protected host cell says, immunity virus itself better be still have infective.The feasible like this chance that the cellular immunization of another stimulation of host immunity system is arranged.

The gene of disappearance or inactivation better is to participate in the virus gene of life cycle as far as possible lately, so just can provide virus protein as much as possible to produce the immunity reaction in vivo.For example, gene can be that participation is packed or some duplicates the gene of back process, as the gH glycoprotein of HSV.But the gene of selecting can be to participate in the gene that viral genome is duplicated, and the proteinic scope of expression in vivo will depend on the stage that gene is expressed under the normal circumstances.For people's cytomegalovirus (HCMV), the gene of selecting can be the gene (except that direct early gene) that stops viral genome to be duplicated in vivo effectively, because (and being important to it really) the direct early gene that produces before viral genome is duplicated is a hyperimmunization originality.

The present invention can be applicable to any virus, wherein one or more essential genes can be identified and can from viral genome, delete or in viral genome by inactivation.For dna virus such as adenovirus, simplexvirus, papovavirus, papillomavirus and parvoviruss, can change to produce specific DNA by the copy of cloned DNA of the selected essential gene of (1) manipulation in vitro, and (2) variant that will change by routine reorganization and sign reservation method is introduced again and is directly realized above-mentioned purpose in the viral genome.But the present invention also can be applicable to RNA viruses.Available existing standard gene engineering copies at the complementary DNA of manipulation in vitro rna virus cdna group, and then in external it is transcribed into RNA.Resulting RNA can be imported in the viral genome again.This technology has been used in normal chain and minus-stranded rna virus such as poliovirus (Racanielloand Baltimore, Science, 214,916-919,1981) and influenza virus (Lutyes et al, Cell, 59,1107-1113,1989) genome in produce specificity and change.

In theory, the necessary proteinic gene of any coding all should be the potential target gene that produces attenuated virus by this method.But in practice, the selection to gene will be decided by many-sided consideration.

1. gene better is that later stage of infecting is needed.Thereby can not interrupt the reproduction process of attenuated virus in early days, this just means that major part even the every other virus antigen of possibility all will produce in infected cell, and to contribute to host immune system with host cell class bonded mode.So present the cellular immunization that just causes developing anti-virus infection by cellular toxicity T cell.Cellular toxicity T cell can be discerned these antigens, thereby kills the virus of cells infected.It is not the required gene of virus assembling fully that the gene of disappearance may have been represented, but it can cells infected be indispensable for the virus that assembles.HSV gH protein promptly is a this proteinic example.Do not having still can produce the HSV virus particle, but their right and wrong to be infective under this proteinic situation.

2. the expression of gene product of selection itself is not have toxicly to eukaryotic cell really, so just can relatively easily produce complementary cell.Yet because gene may be in complementary cell under the control of inducibility promotor, its expression just can only just start when needed like this, so above-mentioned condition is not indispensable.

The character of the sudden change of target gene generation also is a selection factor.Reduce to minimum as long as make to reverse to the danger of wild-type structure, the change of any generation non-functional gene product all is gratifying.These changes comprise the target gene that interrupts the irrelevant sequence of band and cause the specificity disappearance.But treat and/or prevent agent for vaccine is used as, optimal strategy is that deletion should comprise the whole sequence that will be imported in the complementary cell.Can make the danger of regeneration wild-type virus be reduced to minimum level by the reorganization between complementary cell inner virus and cell DNA.

Up to now, though existing several examples that the virus of specificity inactivation is combined with complementary cell (it is described to see above), but these all are the fundamental researchs that is used for virus, or are used to produce the carrier (use retrovirus) of safety of transgenic animal so as to preparation.Also be not used in the purpose of making vaccine so far, and just known to the applicant, also such using method is proposed nobody.

Virus vector except that the safety of using this inactivation virus/complementary cell to make up, the invention still further relates to the vaccine that uses same system production to be used as anti-exotic disease substance with the safe vaccine of producing anti-wild-type virus.

An example of this carrier is based on that HSV makes.The HSV genome is big to be enough to hold a large amount of valuable additional genetic information, and has described several reorganization HSV viruses of carrying and expressing external genetic stocks (as Ligas andJohnson, J.Virol, 1988, document is the same).Therefore can use above-mentioned deleted necessary virogene, and carry and the virus of expressing specific alien gene as the safety barrier that carries out vaccine inoculation, in order to produce the immune response of anti-extraneous protein.

The key character of HSV is that it can and then be hidden in the neurone of infected individuality, and reactivate and cause local damage sometimes.Can use the HSV that lacks certain necessary virogene and express alien gene, in processed individuality, to have a mind to cause the latent infection of neurocyte for this reason.Again activate a kind of like this latent infection and can not cause the generation that damages,, and can cause starting of initial part virus replication cycle because the virus vector of this moment can not fully duplicate again.The expression of alien gene can take place during this period, and causes immune response.Certain proteinic HSV gene that has lacked is optional for the virus assembling if encode, and only relevant with the infectivity of the virus particle that assembles, just such exotic antigen can be mixed in the virion of assembling, to improve its immunogenicity effect.Certainly, the expression of this alien gene and its protein mixing in virion also can occur in mutated viruses initial stage that produces in its complementary host, in the case, promptly when mutated viruses is used as vaccine, can directly extraneous protein be offered processed individuality.

In another example, vaccinia virus (a kind of poxvirus) portability is also expressed the gene from various different pathogens, and has proved that they can become effective vaccine when being used for animal experiment system.The potentiality that are used for human body are very big, but since with widely-used vaccinia virus as the relevant known side effect of antismallpox vaccine, so general not too go up the extensive varicella vaccine that uses unmodified with being intended to the person.Attempted making vaccinia virus attenuation (Buller, Chakrabarti, Cooper, Twardzik ﹠amp by deletion non-essential gene such as cowpox growth factor gene; Moss, J.Virology 62,866-874,1988).But so the virus of attenuation still can be duplicated in vivo, although its levels of replication is very low.Also produced the non-vaccinia virus of disappearance essential gene, but this virus that lacks above-mentioned essential gene when growing when combining with its complementary cell, can provide the safer variant of this virus vector.

Another advantage of the generic strategy of this anti-heterologous protein immunity is that the mode that available same virus vector can not reach with a kind of conventional live vector is carried out repeatedly effectively vaccine inoculation.Because render a service with regard to it, a kind of live-virus vaccine of standard may depend on it by many times infect the ability of duplicating that forms in the host animal body, so its use in the individuality of the immunizing power with anti-this virus just will be severely limited.Do to attack for the second time with virus of the same race, no matter provide the booster immunization of anti-same protein, the new immune response that still produces anti-different proteins may all be invalid.As use the virus vector that lacked certain essential gene (do not expect or require it repeatedly to duplicate), effective immunization also appears after immunization soon.The dosage of mutated viruses can be quite big (because it should be a completely safe) is therefore unlikelyly blocked the early process that these certain hours of still needing just can be mobilized to the fullest extent by host immune response.

Though we have obtained the essential gene of mutated viruses in the above is defective, and can contain the proteinic gene of immunogenicity pathogenic agent, but mutant also can lack more than one essential gene, and/or contains a plurality of immunogenicity pathogenic agent protein genes.Therefore, mutated viruses can comprise with the HIVgp120 gene of mode above-mentioned as vaccine, and the HIVgag protein gene, they can be expressed in vaccinated host and being presented on the host cell surface with MHC-I bonded mode, thus the t cell responses of stimulation of host.

In order to more clearly understand the present invention, will further describe the present invention with non-limited way by embodiment and with reference to following accompanying drawing below.

Fig. 1 illustrates the production sequence of plasmid pGH1;

Fig. 2 illustrates the production sequence of plasmid pGH2;

Fig. 3 a shows the base pair of the complementary oligonucleotide be used to produce plasmid pSP64Ta;

The generation of Fig. 3 b explanation plasmid pSP64Ta;

Fig. 4 a shows two oligonucleotide sequences that are used to produce plasmid pCMVIEP;

Fig. 4 b diagram shows plasmid pCMVIEP;

Fig. 5 diagram shows plasmid pCMVlacZ;

Fig. 6 diagram shows plasmid pGH3;

Fig. 7 diagram shows the strategy that makes up plasmid pGH-120.

Lacked the simple property sore exanthema virus (gH-HSV) of glycoprotein h

Herpes simplex virus (HSV) is a kind of big dna virus, and it can cause various disease conditions in human body, comprises repeatedly the face and the genitalia injury of outbreak, though and rare usually be fatal encephalitis.Use medicine Acyclovir can control the infection that this virus causes to a certain extent, but also not can be used to prevent the vaccine of primary infection with the Chemo-Therapy therapy.The difficulty of anti-HSV vaccine inoculation is that virus generally is to propagate by directly shifting at iuntercellular in vivo.In this case and since circulating antibody can only in and extracellular virus, so humoral immunization is difficult to prove effective.Be the control virus infection, most important still cellular immunization a kind ofly for this reason can produce humoral immunization and cellular immunity, and will be quite desirable to the vaccine of body safety again.

The suitable target gene that carries out inactivation in the SHV genome is glycoprotein h gene (gH).GH protein is a kind of lip-deep glycoprotein of virus coat that is present in.It is generally acknowledged that this protein enters in virus has participated in the film fusion process between infected cell stage.This is because under non-allowable temperature, the temperature sensitivity virus mutant that those these genes have been subjected to damage can not secrete from the cell of virus infection (Desai et al J.Gen.Virol, 69,1147-1156,1988).This protein is to express in the later stage of infecting, so still have a large amount of virus proteins synthetic when it does not exist.

All genetic manipulations are all by " Molecular Cloning ", A LaboratoryManual, and eds, Sambrook, Fritsch and Maniatis, Cold SpringHarborLaboratory Press, the standard method described in 1989 is carried out.

A. express the generation of the clone of HSVgH gene

The gH gene be present in the genomic unique long zone of I type HSV (Unigue Longregion, UL) in, i.e. (McGeoch etal, J, Gen.Virol.69,1531-1574,1988) between the Nucleotide 46382 and 43868.Can in plasmid pAF2, obtain the clone's of this gene copy.This plasmid derives from plasmid pTZgH, comprises the Bgl II-Xho I fragment of complete gH encoding sequence through cutting, and with this fragment cloning in the Bgl II site of above-mentioned plasmid pSP64T and (Gompels and Minson, J.Virol, 63 that produce, 4744-4755,1989).Then by plasmid pSVD4 (Everett, Nucl, Acids Res.11,6647-6667,1983) (zero position with the gD gene is as the criterion to cut away the Hind III fragment of the promoter sequence that comprises glycoprotein D (gD) gene in, from Nucleotide-392 extend to+11), and unique Hind III advantage of being cloned into pAF2 can utilize the promoter sequence that connects with correct direction to drive the gH expression of gene to produce pGH1 (Fig. 1) like this.Therefore this plasmid promptly contains the complete gH encoding sequence that is under the control of 1 type HSVgD gene promoter.This plasmid of purifying then, and use conventional coprecipitation of calcium phosphate technology (Graham and Van der Eb, Virology52,456-467,1973) and plasmid pNEO (Pharmacia LKB, Biotechnology Inc.) cotransfection together in the Vero cell.Cell is gone down to posterity in medicine G418 select to have obtained the Vero cell of neomycin resistance, and clone the colony of these cells with limiting dilution assay.These neomycin resistance cells of amplification are used 2 type HSV virus infection gained samples then in tissue culture.Have transcribing that the 1 type gD promotor of inducing from be present in the complementary cell genome begins with 2 type HSV virus infectiones, thereby stimulate the effect of the proteinic generation of 1 type gH in the complementary cell.Use and knownly can discern the proteinic polyclonal antiserum of I type gH (Desai et al, 1988, document is the same) specifically,, screen the lysate of infected cell according to the gH protein expression with Western trace transfer method.Keep the cell of expressing desired protein then and prepare its refrigerated storage product.This material has been represented gH ⁺Complementary cell system.

B. produce the HSV I C-type virus C that has the gH gene that interrupts

From plasmid pUG102 (Gompels and Minson, Virology 153,230-247,1986) cut away on and contain the 6432 base pair Bgl II fragments of gH encoding sequence together with the HSV flanking sequence, and be cloned into plasmid pAT153 (Twigg andSherrat, Nature, 283,216,1980) in to produce pGH2 (Fig. 2).The Pvu II that goes up this sequence of cutting with two positions (Nucleotide 44955 and 46065 that is equivalent to people's such as McGeoch (1988, document is the same) sequence numbering) in the gH encoding sequence only digests above-mentioned plasmid, and from two fragments bigger one of purifying.Preparation contains and is positioned at the directly sub-downstream of early gene promoter of cytomegalovirus (CMV) as follows then, from the dna fragmentation of the complete beta galactosidase enzyme genes of intestinal bacteria.At first with all paired complementary oligonucleotides (shown in Fig. 3 a) annealing and pSP64T (Krieg and Melton that digest with the Bgl II, the Phosphoric acid esterase processing, Nucl.A cids Res.12,7057-7071,1984) connect, produce the plasmid pSP64Ta as shown in Fig. 3 b.Add joint and also comprise the initiator codon of e.coli (lacZ) and first three codon.Use two oligonucleoside enzymes shown in Fig. 4 a then, with polymerase chain reaction technique (PCR-Molecular Cloning, ed.Sambrook et al document is the same) by plasmid pUG-H1 (Gompels and Minson, 1989, quoted passage is the same) " core area " of amplification CMV direct early gene promoter, wherein said two oligonucleoside enzymes are equivalent to nucleosidase in the sequence-302 respectively to-288 and-13 to people (Virus Research such as-36[nucleosidase sequence number and Akrigg, 2,107-121,1985) starting point of the direct early gene of described CMV is relevant].These oligonucleotide also contain the enzyme point of contact of Restriction Enzyme Hind III at its 5 ' end, be annealed at oligonucleotide under the situation of promotor upstream, also contain another Sma I site.Digest the product D NA of pcr amplification then with the Hind III, and be cloned among the pSP64Ta of Hind III digestion, to produce plasmid pCMVIEP (Fig. 4 b).At last, with BamH I digested plasmid pSC8 (Chakrabartiet al, Mol.Cell.Biol.5,3403-3409,1985), separate the dna fragmentation contain the complete copy of e.coli and only to lack 5 ' least significant end of encoding sequence, and be cloned in unique Bgl II site of pCMVIEP to produce pCMV I lacZ (Fig. 5).And then contain the dna fragmentation that is in the beta-galactosidase gene under the control of CMVIE promotor with separation with Sma I digestion pCMVlacZ, and be connected with the Pvu II fragment of the above-mentioned pGH2 of purifying, to produce pGH3, this plasmid has comprised the copy (Fig. 6) of the gH gene that is cut off by functional beta-galactosidase gene.Next step is that its method is to make between HSVDNA and the plasmid pGH3 to recombinate, and selects those to obtain the virus of functional beta-galactosidase gene then with the wild-type gH gene in the variant displacement HSV genome of this interruption.So calcium phosphate precipitation technology (Graham and Van der Eb of available standards, 1973, quoted passage is the same) with HSVDNA (the Killington and Powell of plasmid pGH3 DNA together with isolating purifying from the HSV virus particle of purifying, " Techniques in Virology:APractical Approach " (ed, B.W.J.Mahy) pp.207-236, IRLPress, Oxford (1985)) together cotransfection to the cell of the expressing the gH gene (gH described in the A part ⁺Complementary cell system) in.Then in the presence of chromogenic substrate 5-bromo-4-chloro-3-indyl-β-D-galactoside (X-gal) (this substrate is becoming blue material under the beta-galactosidase enzymes effect), use the agar tectum, apply at gH the filial generation HSV virus shop that obtains of transfection experiment thus by the plaque method of inspection of standard ⁺On the complementary cell individual layer, promptly manifest blueness by containing and expressing the plaque that obtains after the viral genome infection of beta-galactosidase gene.Therefore these viral genome should carry the variant of the gH gene that is interrupted, and picking agar bolt from the suitable part of plate is reclaiming virus, by at gH from these plaques ⁺Cultivating virus in the complementary cell system prepares virus and stocks sample.Because these viruses are carried the non-functional variant of gH gene, so they should be able to form plaque not containing and express on the cell of the copy of source functional within the gH gene, can further confirm it according to detecting that viral sample forms the ability of plaque on wild-type Vero cell monolayer and comparing like this with the gH complementary cell.At last, stock from these and to produce viral DNA virus, and check the dna structure of the expection around the gH gene with Southern trace detection method.After further having confirmed correct genetic construction, viral sample is inoculated into gH ⁺In the culture in enormous quantities (infection multiplicity=0.01) of complementary cell system, the cell that results infect after 3 days is therefrom to prepare gH genetic flaw venereal disease poison in a large number.Discharging CAV, the total mixture of supersound process is stored in-70 ℃ down as the total stock pile of virus with the ultrasonic disruption infected cells.At gH ⁺Complementary cell is fastened and is carried out the plaque detection, to determine the titre of viral stock pile.The sample of stocking thing with this virus is by preceding method preparation work stoste, more as follows with these work stoste infection experiment chamber animals then.

C. to gH ^-The comparative studies of the provide protection of the virus of HSV and heat-killed

In order to estimate that the host to this viral immunological response, attacks experiment according to following experimental program to mouse.

GH as follows relatively lives ⁺The protective effect of the wildlife of virus formulation and inactivation (WT) virus (SC16 virus strain) preparation.

Be used for the preparation of the inactivation wild-type virus of vaccine inoculation

Vero cell cultures 1 type HSV (SC16 virus strain) with low infection multiplicity (0.01pfu/ cell).Results are viral after 3 days, and reclaim the endochylema inner virus with Dounce homogenate method.Removed nucleus in centrifugal 15 minutes with 500 * g, and use the BeckmanSW27 rotor, went up centrifugal 60 minutes, from supernatant liquor, to reclaim virus at 40% sucrose cushion (12K).The virus of band is piled in dilution, through sucrose gradient centrifugation (Killington andPowell, 1985, quoted passage is the same) precipitation and purifying.Results virus band from gradient, and centrifugal recovery virus.Virus is suspended in the slow middle salt solution (PBS) of phosphoric acid salt again, on immature hamster (BHK) cell, detects infectivity, and carry out grain count with electron microscope with plaque titration.The particle of preparation: the infectivity ratio is 110 particles/pfu.In PBS with viral dilution to 2.5 * 10 ¹⁰Pfu/ml made virally inactivated in 60 minutes in 20 ℃ with the beta-propiolactone processing.Be divided into some equal portions then and put-70 ℃ of preservations down.

The work gH that is used for vaccine inoculation ^-The preparation of virus

Basically by the above-mentioned method preparation for preparing wild-type virus, different is that viral growth is at the gH that contains and express 1 type HSVgH gene ⁺In the complementary cell system, and without beta-propiolactone processing deactivation.The particle of said preparation: the infectivity ratio is 150: 1.Its concentration is transferred to 2.5 * 10 ¹⁰Gfu/ml is divided into some equal portions and is added among the PBS in-70 ℃ of preservations down.

Vaccination program

By droplet use and on the animal auris dextra cut, with the inactivation WT virus that is added on the various various dose in the 2 μ l phosphate buffered saline (PBS)s or the gH that lives ^-Virus inoculation is following respectively organize 4 week female balb/c mouse in age (available from Tucks U.K.Ltd):

A group contrast-virus-free

B group 5 * 10 ⁴The pfu virus vaccines

C group 5 * 10 ⁵The pfu virus vaccines

D group 5 * 10 ⁶The pfu virus vaccines

E group 5 * 10 ⁷Behind the pfu virus vaccines 14 days, with 2 * 10 ⁶PfuHSV-1 virus strain SC16 (wild-type virus) does similar inoculation to attack all mouse on left ear.Kill mouse and the viral communication power of check in left ear and right cervical ganglia C II, C III and C IV (bonded) after 5 days.For carrying out research in latent period, after 1 month, kill other animals vaccinated and under fire, and excision C II, C III and C IV neuroganglion carry out the latent infection check.Sample is placed substratum insulation 5 days, and the plaque method of inspection of making the homogenate and the standard of using is checked the existence of infective virus.Following result all shows with pfu/ organ numerical table.

Table 1

Inoculation gH alive ^-The titre of virus back existing challenge virus in the acute phase that infects

^*The cervical ganglia c II, c III and the c IV that merge

Table 2

The titre of the challenge virus that in the acute phase that infects, exists behind the WT HSV-1 of inoculation deactivation

^*The cervical ganglia c II, c III and the c IV that merge

Table 3

Conduct is present in cervical nerve behind the inoculation gH=HSV-1 alive

The challenge virus titre of the latent virus in the joint

^*The cervical ganglia c II, c III and the c IV that merge

Table 4

Cervical nerve behind the WT HSV-1 of inoculation deactivation

Hide in the joint titre of challenge virus

^*: cervical ganglia C II, C III and the C IV of merging

(p.f.u=plaque forming unit; GH ^-Be the virus that the gH genetic flaw is arranged).

These results have shown the titre of the challenge virus wtSC16 that exists in interior ear of acute infection period and the cervical ganglia.Therefore wherein low titre shows uses gH ^-Virus inoculation effective, and high titre shows weak effect.Can obviously find out from these results, with the gH that lives ⁺HSV virus is carried out vaccine inoculation than much better with the effect of equivalent deactivation WT virus.For preventing that challenge virus from duplicating in ear, the dosage of needed inactivation of viruses preparation is 5 * 10 ⁷Pfu, and required gH alive ^-The dosage of virus will lack 100-1000 doubly.With 5 * 10 ⁵Pfu or gH how alive ^-Virus is done vaccine inoculation, also can block acute infection period challenge virus duplicating in cervical ganglia, also shows the significant protective effect that is formed with to latent infection in the cervical ganglia simultaneously.

Lack the carrier of the HSV of gH gene: the gp120 gene of SIVmac142 virus strain is imported gH as anti-exotic antigen immunity ^-In the genome of HSV virus

The virus of available above-mentioned disappearance essential gene is as exotic antigen being passed to immune safety barrier and above-mentioned gH ^-HSV virus promptly is such suitable carrier.Any required exotic antigen of available this expressing viral, but noticeable especially still express the major antigen protein that human immunodeficiency virus (HIV) is a HIV (human immunodeficiency virus).The mode that for this reason can a kind ofly guarantee its expression during recombinant virus infection normal cell (being the incomplementarity cell) is with these sequences insertions gH ^-In the HSV viral genome.With such virus infection individuality, can after reactivating, it progressively cause latent infection, and cause producing suddenly exotic antigen, and then stimulate at this proteinic immune response.

Because at present can't be directly in human body to this method research that experimentizes, so, can use monkey HIV (human immunodeficiency virus) SIVmac (isolating simian immunodeficiency virus in the macaque body) in the monkey body, to test as the work of starting stage.Employed for this purpose suitable SIV gene is the gp120 proteinic gene of coding as one of this virus major antigen target protein.Therefore this gene is imported gH ^-In the HSV genome, and estimation is with the effectiveness of this virus as vaccine protection monkey antagonism SIV attack.

At first with the back of SIVgp120 gene clone to cytomegalovirus IE core promoter (Gompels and Minson, 1989, document is the same), and then the DNA magazine that will contain gp120 gene and upstream CMV promotor is cloned into (Fig. 2) among the plasmid pGH2.With the gained plasmid and from gH ^-Among the HSV DNA of purifying together cotransfection to gH ⁺In the complementary cell system, destroyed the clone and separate recombinant virus of beta-galactosidase gene through screening, this recombinant virus has obtained the gp120 gene, and has replaced with it and to be present in gH ^-Beta-galactosidase gene in the HSV virus.

A. make up recombinate plasmid in the HSV genome of SIVgp120 encoding sequence

Whole procedure as shown in Figure 7, from cloning the genomic DNA copy of SIV (Chakrabarti et al.Nature 328,543 (1987))) cut away Sac I restriction fragment (being equivalent to base 5240-8721) and be cloned into plasmid pUC118 (Vieraand Messing, Methods in Enzymology, 153,3,1987) in the Sac I site, to produce plasmid pSIV1, be converted into the single-stranded dna of being convenient to operate with the site-directed mutagenesis method then.Use the synthetic oligonucleotide

5′GAAGAAGGCTATAGCTAATACAT

Change this DNA zone that comprises SIVenv gene (being positioned between 6090-8298) through site-directed mutagenesis (Brierley et al, Cell57,537,1989), to introduce the restriction enzyme site of EcoR V enzyme at position 6053-6058 place.

Use the synthetic oligonucleotide then

5 ' CAAGAAATAAACTATAGGTCTTTGTGC imports second EcoR V site at 7671-7676 place, the intragenic position of the SIVenv that is equivalent to the interregional cracking site of env gene order gp120 and gp40, produce plasmid pSIV2.With EcoR V digestion SIV2, make the dna fragmentation (1617 base pair) of the gp120 part that is equivalent to the SIVenv gene again.

Use following two synthetic oligonucleotide, make the core area of direct early gene promoter of CMV with round pcr by plasmid pUG-H1 (Gom pels and Minson, 1989, document is the same).

Upstream primer

5′ATC?GAATTC?CTATAG?CCTGGCATTATGCCCAGTACATG

EcoRⅠ EcoRⅤ

Downstream primer

5′TCAAAGCTT?CTATAG?CCCGGGGAGCTCTGATTATATAGACCTCCC

HindⅢ EcoRⅤ SmaⅠ

Cut the product of this reaction with EcoR I and Hind III enzyme then, produce a dna fragmentation, it is cloned among the plasmid pUC118 with EcoR I and the digestion of Hind III again, obtains plasmid pCMVIE2, this plasmid has a unique Sma I site at the downstream part of CMV promoter sequence.Preparation contains the EcoR V fragment of SIVmacgp120 encoding sequence as stated above.Then it is cloned in this Sma I site, and selects to have the SIV coding region of inserting, thereby be able to begin to express the plasmid pSIV3 of this encoding sequence from promotor with correct direction.Digest this plasmid with the EcoR V then and comprise the tack dna fragmentation of SIV sequence and CMV promotor,, obtain pGH-120 this fragment cloning in the pGH2 of Puv II digestion (Fig. 2) with generation.

B. make up and carry reorganization gH-HSV and SIVgp120

By the gH that makes up by top described method ^-Purify DNA in the HSV virus, and with the pGH-120DNA cotransfection of purifying to gH ⁺In the complementary cell.In the presence of X-gal, use the agar tectum will separate from the progeny virus shop of this transfection mixture and apply then at gH by aforesaid standard plaque method of inspection ⁺On the individual layer of complementary cell.Because parental generation gH-virus has been carried the functional beta-galactosidase gene that is positioned at residual gH encoding sequence, so when having X-gal, will form blue plaque.Yet, owing to recombinant virus has obtained the SIVgp120 encoding sequence and has replaced beta-galactosidase gene with it, so will produce white plaque.Through picking agar bolt, reclaim virus from these white plaques, and pass through at gH ⁺These viruses of breeding prepare viral stock pile in the complementary cell system.From these stock piles, produce viral DNA, and use the suitable probe that is derived from the SIV encoding sequence, check existing of gH gene correct dna structure on every side with the Southern blotting.Be used for carrying out in animal body the virus stock solution used of vaccine inoculation at last by the preceding method preparation.

Can and use the vaccine that contains attenuated virus by standard technique preparation as known in the art.For example, vaccine also can contain one or more vehicle and/or adjuvant, and the effective dose of the attenuated virus that provided by vaccine can be provided by technology as known in the art.

Claims (30)

1. mutant DNA virus produces the application in the immunoreactive vaccine in the individuality that will treat being prepared as prevention or therapeutic purpose, there is defective in the genome of wherein said virus on the indispensable gene of selected generation infectious virus particle, thereby mutated viruses can infect the normal host cell and duplicate and express virogene in this cell, but can not produce new infectious virus particle, unless this viral communication one complementary host cell, and should the complementation host cell have carried and can express a kind of heterologous nucleotide sequence that produces this must known viral gene function; Said normal host cell is different from said complementary host cell.

2. purposes according to claim 1, wherein said defective allow when mutated viruses infects host cell except that described complementary host cell generation and discharge non-infectious virion.

3. according to the purposes of claim 1, wherein said virus can be protected the infection of being avoided corresponding wild-type virus by its immune susceptible individual.

4. according to the purposes of claim 1, wherein virus has also been carried the immunogenic genetic material of coding from the exogenous pathogenic agent of virus, thereby makes after infecting the normal host cell this virus to carry out duplicating and expressing to a certain degree to this immunogenic genetic material of encoding.

5. according to the purposes of claim 4, wherein said virus provides antiviral immunity can for the susceptible individual with this mutated viruses immunity.

6. according to each purposes among the claim 1-5, wherein virus is simplexvirus, adenovirus or papovavirus.

7. according to each purposes among the claim 1-5, wherein virus is the mutant strain of simplexvirus.

8. according to the purposes of claim 7, wherein virus is the mutant strain of herpes simplex virus.

9. purposes according to Claim 8, wherein defective is present in the glycoprotein gene.

10. according to the purposes of claim 9, wherein defective is present in the glycoprotein gH gene.

11. according to each purposes among the claim 1-5, wherein virus can be set up the latent infection with regular reinvocation in by the individuality of its infection, thereby causes producing in the cell of the latent infection of this infected individuality the protein by this encoding viral.

12. according to each purposes among the claim 1-5, the wherein recombinant cell lines of complementary cell.

13. preparation as each is defined among the claim 1-5, be the method for the immunoreactive vaccine of generation in by the individuality of its processing of prevention or treatment usefulness, this method comprises that cultivation has been carried through transformation and the complementary host cell of energy expressing heterologous nucleotide sequence, this heterologous nucleotide sequence provides mutated viruses to have the function of the selected indispensable gene of dcc gene group at this, described cell is by this virus infection, thus the infectious virus particle that allows generation to have the dcc gene group; And from culture, reclaim viral.

14. a method for preparing the virus vaccines preparation, this method comprises:

(1) cultivate the cell of the non-retroviral infection suddenlyd change, the genome of wherein said virus selected be used to produce on the necessary gene of infectivity reovirion have defective,

Culturing cell is a complementary host cell, and it has carried and energy expressing heterologous nucleotide sequence, and this heterologous nucleotide sequence provides the function of this essential virogene, thereby makes culturing cell can produce the infectivity reovirion,

Though this virus can infect the normal host cell and duplicate and express the virus antigen gene in this normal host cell, but can not from this normal host cell, produce the infectivity reovirion, thus this normal host cell be different from described carried and can expressing heterologous nucleotide sequence the complementary host cell of essential known viral gene function is provided;

(2) the infectivity reovirion that this cell cultures deposits yields should virus;

(3) from culture, reclaim virus; With

(4) utilize this virus preparation to contain for every dose and be no more than 5 * 10 ⁷The vaccine preparation of pfu virus.

15. according to the method for claim 14, wherein the virus that is reclaimed is used to be mixed with every dose and contains and be no more than 5 * 10 in step (4) ⁶The vaccine preparation of pfu virus.

16. according to the method for claim 15, wherein the virus that is reclaimed is used to be mixed with every dose and contains and be no more than 5 * 10 in step (4) ⁵The vaccine preparation of pfu virus.

17. according to the method for claim 16, wherein the virus that is reclaimed is used to prepare every dose and contains and be no more than about 5 * 10 in step (4) ⁴The vaccine preparation of pfu virus.

18. according to the method for claim 13, wherein said defective allows virus to produce when the host cell that infects except that described complementary host cell and discharges non-infectious virion.

19. according to the method for claim 13, wherein said virus can be protected the infection of being avoided corresponding wild-type virus by its immune susceptible individual.

20. method according to claim 13, wherein virus has also been carried the immunogenic genetic material of the viral exogenous pathogenic agent of encoding, thereby make mutated viruses can infect the normal host cell and this immunogenic genetic material of encoding is carried out duplicating and expressing to a certain degree, but can not cause that the new particulate of infective virus produces, unless the complementary host cell of this virus infection.

21. according to the method for claim 20, wherein said defective allows when mutated viruses infects host cell except that described complementary host cell from wherein producing and discharging non-infectious virion.

22. according to the method for claim 20 or 21, wherein virus can provide and be subjected to the antiviral immunity of its immune susceptible individual.

23. according to the method for claim 13, wherein virus is dna virus.

24. according to the method for claim 13, wherein virus is simplexvirus, adenovirus or papovavirus.

25. according to the method for claim 13, wherein virus is the mutant of simplexvirus.

26. according to the method for claim 25, wherein virus is the mutant of herpes simplex virus.

27. according to the method for claim 26, wherein said defective is positioned at glycoprotein gene.

28. according to the method for claim 27, wherein said viral genome defective is positioned at glycoprotein gH gene.

29. according to the method for claim 13, wherein virus can be set up the latent infection with regular reinvocation in being subjected to the individuality of its infection, causes producing in the cell of this individual latent infection the protein by encoding viral.

30. according to the method for claim 13, wherein complementary host cell is a recombinant cell lines.

Images