CN106222298B - LAMP detection kit, detection method and application of RNA virus - Google Patents

LAMP detection kit, detection method and application of RNA virus Download PDF

Info

Publication number
CN106222298B
CN106222298B CN201610598549.4A CN201610598549A CN106222298B CN 106222298 B CN106222298 B CN 106222298B CN 201610598549 A CN201610598549 A CN 201610598549A CN 106222298 B CN106222298 B CN 106222298B
Authority
CN
China
Prior art keywords
virus
sequence
primer
hydration solution
mol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201610598549.4A
Other languages
Chinese (zh)
Other versions
CN106222298A (en
Inventor
严银芳
严文馨
刘军
高平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201610598549.4A priority Critical patent/CN106222298B/en
Publication of CN106222298A publication Critical patent/CN106222298A/en
Application granted granted Critical
Publication of CN106222298B publication Critical patent/CN106222298B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a loop-mediated isothermal gene amplification detection kit for RNA viruses, which comprises the following parts: hydration solution A, hydration solution B, positive control, mineral oil and negative control; and the hydration solution A is prepared from the following components: Tris-HCl, KCl, MgCl2Triton X-100, reverse transcriptase, dNTPs, RNase inhibitor, random primer, sodium dodecyl sulfate, sodium octylphenol polyoxyethylene (10) ether succinate, beta-mercaptoethanol, EDTA, glycerol, dithiothreitol, PEG-4000 and the balance of double distilled water; the hydration solution B contains Tris-HCl, KCl and MgSO4、(NH4)2SO4dNTPs, inner primer FIP, inner primer BIP, outer primer F3, outer primer B3, Bst DNA polymerase, beta-mercaptoethanol, EDTA, glycerol, dithiothreitol, tetramethyl benzidine, H2O2And a virus-specific recognition sequence. The kit can efficiently, quickly, accurately and sensitively obtain the detection result of the virus, has high specificity and strong sensitivity of the detection result, is easy to judge by naked eyes, and is suitable for on-site quick detection.

Description

LAMP detection kit, detection method and application of RNA virus
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to an LAMP detection kit, a detection method and application of an RNA virus.
Background
The traditional methods for detecting and diagnosing viral diseases at present comprise virus neutralization tests, enzyme-linked immunosorbent tests, immunofluorescence antibody tests, immunofluorescence electron microscopy, PCR and the like, which play a great role in the detection of pathogens and the diagnosis and research of diseases, but have the problems of long time, complex operation, expensive equipment and instruments, inconvenience for field detection and the like, and limit the application of the methods in the rapid diagnosis of viruses.
Loop-mediated isothermal gene amplification (LAMP) is a novel gene amplification method and has the following characteristics: simple, quick, and does not require expensiveThe instrument and the equipment are suitable for field use, the thermal denaturation process of the template is not needed, the annealing and the extension are carried out under the same temperature (isothermal) condition, the reaction time is greatly reduced, and the result can be obtained in a short time. LAMP has a very high specificity because it uses 4 primers that recognize 6 sites. A large number of research reports prove that the specificity of LAMP is higher than that of the traditional PCR technology, and different serotypes of the same pathogen can be distinguished, for example, the research results of viruses such as human influenza virus and human herpes virus and the like suggest that LAMP can carry out typing on the same pathogen of multiple serotypes without false positive. LAMP has high sensitivity, can amplify target genes from extremely low trace copies, and has the amplification efficiency as high as 109-1010The copy is 2-3 orders of magnitude higher than that of the traditional PCR technology, and has the same sensitivity as Real-Time TaqMan PCR.
At present, there are 3 methods for determining the result of loop-mediated isothermal amplification: gel electrophoresis detection, turbidity monitoring and color observation by addition of a color-developing agent. The former two judging methods have the disadvantages of complex operation and need of special instruments and equipment, and the method for observing the color by adding the color developing agent has simple operation and does not need special instruments and equipment. There are two types of color-developing agents currently used in LAMP: DNA intercalating dye and metal ion indicator, but the specificity and sensitivity of the two color developing agents are not high, and the result is not easy to judge by naked eyes, so that the application of the color developing agents is limited, therefore, in order to obtain the detection result of the virus efficiently, quickly, accurately and sensitively, a new detection kit containing the color developing agents with high specificity, strong sensitivity and easy to judge by naked eyes is required to be developed.
Disclosure of Invention
The kit can efficiently, quickly, accurately and sensitively obtain the detection result of the virus, has high specificity and strong sensitivity of the detection result, is easy to judge by naked eyes, and is suitable for on-site quick detection.
The first purpose of the invention is to provide a loop-mediated isothermal gene amplification detection kit for RNA viruses, which comprises the following parts: hydration solution A, hydration solution B, positive control, mineral oil and negative control;
the hydration solution A is prepared from the following components per liter: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 70mmol MgCl21mL of Triton X-100, 780U of reverse transcriptase, 0.2mmoL of dNTPs, 1000U of RNase inhibitor, 250pmol of random primer, 0.4-0.7g of sodium dodecyl sulfate, 0.7-1.2g of sodium octylphenol polyoxyethylene (10) ether succinate, 5mmoL of beta-mercaptoethanol, 6.7 mu mol of EDTA, 100mL of glycerol, 30mmoL of dithiothreitol, 8-12g of PEG-4000 and the balance of double distilled water;
each liter of hydration solution B is prepared from the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 6.5mmol MgSO410mmol of (NH)4)2SO40.2mmoL dNTPs, 1.6. mu. mol of each of inner primer FIP and inner primer BIP, 0.2. mu. mol of each of outer primer F3 and outer primer B3, 480U of Bst DNA polymerase, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, 30mmoL L of dithiothreitol, 0.1g of tetramethylbenzidine, 0.1mL of H2O21.0 mu mol of virus specific recognition sequence, and the balance of double distilled water; the virus-specific recognition sequence comprises a virus-specific probe sequence and a deoxyribozyme sequence.
Preferably, the positive control is human serum positive for virus, and the negative control is human serum negative for virus.
Preferably, each liter of the hydration solution A is prepared by adopting 0.6g of sodium dodecyl sulfate, 0.9g of sodium octylphenol polyoxyethylene (10) ether succinate and 10g of PEG-4000.
The invention also provides application of the loop-mediated isothermal gene amplification detection kit for the RNA virus in detecting the rubella virus.
The invention also provides an application of the loop-mediated isothermal gene amplification detection kit for RNA viruses in detecting rubella viruses, and the sequence of the inner primer FIP adopted in the detection of the rubella viruses is as follows: 5 '-CGGCCTGCTGGGGCTTCCCCAC-AGGTTGAACCCGCCTTTGGACA-3';
the sequence of the inner primer BIP is: 5 '-ACGACTAACGGCCACATTAAGT-CCCCGGAGCCCTCGGGATTAAC-3';
the sequence of the outer primer F3 used was: 5'-ACTACAAGCAGTACCACCCCAC-3', respectively;
the sequence of the outer primer B3 used was: 5'-GGCTAACCCGGAGGGGCCAAAC-3', respectively;
the virus-specific recognition sequences used were: 5'-TGATTGCTCACAAGACCGTCCGGGTGCAATCAGTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3' are provided.
The invention also provides application of the loop-mediated isothermal gene amplification detection kit for the RNA virus in detection of measles virus.
The invention also provides an application of the loop-mediated isothermal gene amplification detection kit for the RNA virus in detecting the measles virus, and the sequence of the inner primer FIP adopted in detecting the measles virus is as follows:
the sequence of the inner primer FIP is: 5 '-CCGGATTAAGGAATTTAATCTT-TTCACTGACCTAGTGAAATTCA-3';
the sequence of the inner primer BIP is: 5 '-TACAGCGACAGGGACAACCTGA-TCAGGTTGTCCCTGTCGCTGTA-3';
the sequence of the outer primer F3 used was: 5'-GATGAAGTGGGCCTGAGGACAC-3', respectively;
the sequence of the outer primer B3 used was: 5'-ATGCTCAGTTGTGACAACTCTG-3', respectively;
the virus-specific recognition sequences used were: 5'-TGATTGCAACCCGCCAGAGAGAATCGCAATCAGTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3' are provided.
The invention also provides a method for detecting the RNA virus by using the loop-mediated isothermal gene amplification detection kit for the RNA virus, which is implemented according to the following steps:
step 1, extracting serum of a material to be detected to obtain the serum to be detected;
step 2, taking 3 reaction tubes, respectively marking the reaction tubes as a positive control tube, a test tube and a negative control tube, and respectively adding the same volume of hydration solution A into the positive control tube, the test tube and the negative control tube;
step 3, according to positive control: adding a positive control into a positive control tube when the volume ratio of the hydration solution A is 2: 25; according to the serum to be tested: adding the serum to be tested into the test tube according to the volume ratio of 2:25 of the hydration solution A; according to negative control: adding a negative control into a negative control tube when the volume ratio of the hydration solution A is 2: 25;
respectively adding mineral oil with the same volume into the positive control tube, the test tube and the negative control tube, wherein the volume ratio of the mineral oil to the hydration solution A is 3: 5;
step 4, placing the positive control tube, the test tube and the negative control tube in the step 3 in a water bath at 42 ℃ for 60 minutes, and then placing the tubes in a water bath at 95 ℃ for 10 minutes;
step 5, according to the hydration solution B: adding the hydration solution B into the positive control tube, the test tube and the negative control tube respectively according to the volume ratio of 1:1, and placing the positive control tube, the test tube and the negative control tube in a water bath at 62-66 ℃ for 50-65 minutes;
and 6, judging a result: and (5) cooling the positive control tube, the test tube and the negative control tube in the step (5) to room temperature, observing the change of the solution color, wherein if the test tube and the negative control tube have the same color and are colorless, the serum to be detected has no RNA virus infection, and if the test tube and the positive control tube have the same color and are blue, the serum to be detected has RNA virus infection.
Preferably, the temperature of the water bath in the step 5 is 65 ℃ and the time of the water bath is 60 minutes.
The invention relates to a loop-mediated isothermal gene amplification detection kit for RNA viruses, and provides a specific color development method.A 3 ' end of a specific probe is connected with a deoxyribozyme with a special structure sequence, and a 5 ' end of the probe is connected with a TGATTGC sequence, namely a 5 ' -TGATTGC-virus specific probe sequence-GCAATCA-deoxyribozyme sequence. The special probe structure forms a G-folding hairpin structure at the 5 'end before hybridization with the specific template, when the deoxyribozyme has no peroxidase activity, but the G-folding hairpin structure at the 5' end after hybridization with the specific template is opened, when the connected deoxyribozyme has peroxidase-like activity due to biological inductionCatalytic substrate TMB-H2O2The reaction solution appeared blue. Experiments prove that the color development method has high specificity, strong sensitivity and easy judgment by naked eyes.
The loop-mediated isothermal gene amplification detection kit for RNA viruses provided by the invention uses a unique loop-mediated isothermal gene amplification technology, thoroughly overcomes the defects of long time consumption and difficult visual judgment of reaction results of a general PCR method, and has the following advantages due to the special formula of the hydration solution A: (1) the whole detection process only needs about 2 hours, so that the detection time is greatly shortened; (2) the pretreatment of a sample is not needed, only 2 mu L of serum is needed for detection, and the extraction of nucleic acid of the sample is not needed; (3) the sensitivity of the loop-mediated isothermal gene amplification is 10-100 times that of the PCR method; (4) the products of the loop-mediated isothermal gene amplification do not need electrophoresis, and the reaction result can be directly judged by naked eyes through the color change of the indicator; (5) without using such instruments as a PCR instrument, an electrophoresis tank, a gel imager, a centrifuge and the like.
Drawings
FIG. 1 is a comparison chart of the results of using the loop-mediated isothermal gene amplification primers for rubella virus of the present invention to detect different materials;
FIG. 2 is a graph showing the results of detecting various materials using the loop-mediated isothermal gene amplification primers for measles virus according to the present invention.
In fig. 1, tube 1 is rubella virus tissue culture cell lysate, tube 2 is rubella virus negative human serum, tube 3 is rubella virus serum to be tested, tube 4 is measles virus positive human serum, tube 5 is cytomegalovirus positive serum, tube 6 is respiratory syncytial virus positive serum, tube 7 is influenza virus positive serum, and tube 8 is normal human serum.
In fig. 2, tube 1 is measles virus tissue culture cell lysate, tube 2 is measles virus negative human serum, tube 3 is measles virus positive human serum, tube 4 is rubella virus serum to be tested, tube 5 is cytomegalovirus positive serum, tube 6 is respiratory syncytial virus positive serum, and tube 7 is normal human serum.
Detailed Description
The present invention is described in detail below with reference to specific examples, but the present invention should not be construed as being limited thereto.
The invention provides a loop-mediated isothermal gene amplification detection kit for RNA viruses, which comprises the following parts: hydration solution A, hydration solution B, positive control, mineral oil and negative control;
the hydration solution A is prepared from the following components per liter: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 70mmol MgCl21mL of Triton X-100, 780U of reverse transcriptase, 0.2mmoL of dNTPs, 1000U of RNase inhibitor, 250pmol of random primer, 0.4-0.7g of sodium dodecyl sulfate, 0.7-1.2g of sodium octylphenol polyoxyethylene (10) ether succinate, 5mmoL of beta-mercaptoethanol, 6.7 mu mol of EDTA, 100mL of glycerol, 30mmoL of dithiothreitol, 8-12g of PEG-4000 and the balance of double distilled water;
the term "the balance is double distilled water" means that the solvent is double distilled water when each liter of the hydrated solution a is prepared.
Each liter of hydration solution B is prepared from the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 6.5mmol MgSO410mmol of (NH)4)2SO40.2mmoL dNTPs, 1.6. mu. mol of each of inner primer FIP and inner primer BIP, 0.2. mu. mol of each of outer primer F3 and outer primer B3, 480U of Bst DNA polymerase, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, 30mmoL L of dithiothreitol, 0.1g of tetramethylbenzidine, 0.1mL of H2O21.0 mu mol of virus specific recognition sequence, and the balance of double distilled water; the virus-specific recognition sequence comprises a virus-specific probe sequence and a deoxyribozyme sequence, the nucleotide composition of the virus-specific probe sequence is 5' -TGATTGC-virus-specific probe sequence-GCAATCA-deoxyribozyme sequence, the virus-specific probe sequence can be hybridized with a product of loop-mediated isothermal gene amplification so as to specifically recognize the virus, and the deoxyribozyme on the virus-specific recognition sequence has activity similar to peroxidase after hybridization.
The term "the balance is double distilled water" means that the solvent is double distilled water when each liter of the hydration solution B is prepared.
It should be noted that the inner primer FIP, the inner primer BIP, the outer primer F3 and the outer primer B3 are primers required for loop-mediated isothermal gene amplification, the virus-specific probe sequence is a sequence for specific recognition of viruses, and the sequences of the inner primer FIP, the inner primer BIP, the outer primer F3, the outer primer B3 and the virus-specific probe sequence corresponding to different RNA viruses are different. The technicians in the field design the specific sequences of the inner primer FIP, the inner primer BIP, the outer primer F3, the outer primer B3 and the virus specific probe according to the gene sequence of the virus to be detected, and then the specific RNA virus is detected according to the method of the invention.
The random primer is purchased from Takara, and comprises a plurality of random sequences, each random sequence is composed of 6 random bases, and the bases of the random sequences are different.
Preferably, the positive control is virus positive human serum containing a virus genome nucleic acid sequence, the virus positive human serum is detected to be virus infection positive by a commercially purchased RT-PCR kit, the negative control is virus negative human serum without the virus genome nucleic acid sequence, and the virus negative human serum is detected to be virus infection negative by the commercially purchased RT-PCR kit.
Based on the same invention concept, the invention also provides a method for detecting RNA virus by using the loop-mediated isothermal gene amplification detection kit for RNA virus, which is implemented according to the following steps:
step 1, extracting serum of a material to be detected to obtain the serum to be detected;
step 2, taking 3 reaction tubes, respectively marking the reaction tubes as a positive control tube, a test tube and a negative control tube, and respectively adding the same volume of hydration solution A into the positive control tube, the test tube and the negative control tube;
step 3, according to positive control: adding a positive control into a positive control tube when the volume ratio of the hydration solution A is 2: 25; according to the serum to be tested: adding the serum to be tested into the test tube according to the volume ratio of 2:25 of the hydration solution A; according to negative control: adding a negative control into a negative control tube when the volume ratio of the hydration solution A is 2: 25;
respectively adding mineral oil with the same volume into the positive control tube, the test tube and the negative control tube, wherein the volume ratio of the mineral oil to the hydration solution A is 3: 5;
step 4, placing the positive control tube, the test tube and the negative control tube in the step 3 in a water bath at 42 ℃ for 60 minutes, and then placing the tubes in a water bath at 95 ℃ for 10 minutes;
step 5, according to the hydration solution B: adding the hydration solution B into the positive control tube, the test tube and the negative control tube respectively according to the volume ratio of 1:1, and placing the positive control tube, the test tube and the negative control tube in a water bath at 62-66 ℃ for 50-65 minutes;
and 6, judging a result: and (5) cooling the positive control tube, the test tube and the negative control tube in the step (5) to room temperature, observing the change of the solution color, wherein if the test tube and the negative control tube have the same color and are colorless, the serum to be detected has no RNA virus infection, and if the test tube and the positive control tube have the same color and are blue, the serum to be detected has RNA virus infection.
In the following examples of the present invention, all reagents used are commercially available unless otherwise specified, and the methods involved are conventional, and the RNase inhibitor in the following examples is available from Shengxing Biotechnology Nanjing GmbH.
Example 1
The invention relates to a loop-mediated isothermal gene amplification detection kit for RNA viruses, which is applied to detecting rubella viruses and comprises the following parts: hydration solution A, hydration solution B, positive control, mineral oil and negative control;
wherein, each liter of the hydration solution A is prepared from the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 70mmol MgCl21mL of Triton X-100, 780U of reverse transcriptase, 0.2mmoL of dNTPs, 1000U of RNase inhibitor, 250pmol of random primer, 0.6g of sodium lauryl sulfate, 0.9g of sodium octylphenol polyoxyethylene (10) ether succinate, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, and 30mmoL of dithiothreoseAlcohol, 10g of PEG-4000 and the balance of double distilled water; wherein, each liter of hydration solution B is prepared by the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 6.5mmol MgSO410mmol of (NH)4)2SO40.2mmoL dNTPs, 1.6. mu. mol of each of inner primer FIP and inner primer BIP, 0.2. mu. mol of each of outer primer F3 and outer primer B3, 480U of Bst DNA polymerase, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, 30mmoL L of dithiothreitol, 0.1g of tetramethylbenzidine, 0.1mL of H2O21.0 mu mol of virus specific recognition sequence, and the balance of double distilled water;
the positive control is virus positive human serum containing a rubella virus genome nucleic acid sequence, and the negative control is virus negative human serum without the rubella virus genome nucleic acid sequence.
Wherein the sequence of the adopted inner primer FIP is shown as SEQ ID NO.1 and comprises the following components: 5 '-CGGCCTGCTGGGGCTTCCCCAC-AGGTTGAACCCGCCTTTGGACA-3';
the sequence of the adopted inner primer BIP is shown as SEQ ID NO.2 and comprises the following components: 5 '-ACGACTAACGGCCACATTAAGT-CCCCGGAGCCCTCGGGATTAAC-3';
the sequence of the adopted outer primer F3 is shown as SEQ ID NO.3 and comprises the following components:
5’-ACTACAAGCAGTACCACCCCAC-3’；
the sequence of the adopted outer primer B3 is shown as SEQ ID NO.4 and comprises the following components:
5’-GGCTAACCCGGAGGGGCCAAAC-3’；
the adopted virus specificity recognition sequence is shown as SEQ ID NO.5 and comprises the following components: 5'-TGATTGCTCACAAGACCGTCCGGGTGCAATCAGTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3', the virus-specific recognition sequence comprises a virus-specific probe sequence 5'-TCACAAGACCGTCCGGGT-3' and a deoxyribozyme sequence 5'-GTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3', the 5 ' end of the virus-specific probe sequence is added with TGATTGC, and GCAATCA is added between the virus-specific probe sequence and the deoxyribozyme sequence, thus forming the virus-specific recognition sequence shown in SEQ ID NO. 5.
The method for detecting the rubella virus by using the loop-mediated isothermal gene amplification detection kit for the RNA virus is implemented according to the following steps:
step 1, extracting serum of a material to be detected to obtain the serum to be detected;
step 2, taking 3 reaction tubes, respectively marking the reaction tubes as a positive control tube, a test tube and a negative control tube, and respectively adding 25 mu L of hydration solution A into the positive control tube, the test tube and the negative control tube;
step 3, respectively adding 2 mu L of virus positive human serum into the positive control tube, adding 2 mu L of serum to be tested into the test tube, and adding 2 mu L of virus negative human serum into the negative control tube;
respectively adding 15 mu L of mineral oil into the positive control tube, the test tube and the negative control tube;
step 4, placing the positive control tube, the test tube and the negative control tube in the step 3 in a water bath at 42 ℃ for 60 minutes, and then placing the tubes in a water bath at 95 ℃ for 10 minutes;
step 5, respectively adding 25 mu L of hydration solution B into the positive control tube, the test tube and the negative control tube, and placing the positive control tube, the test tube and the negative control tube in a water bath at 65 ℃ for 60 minutes;
and 6, judging a result: and (5) cooling the positive control tube, the test tube and the negative control tube in the step (5) to room temperature, observing the change of the solution color, if the test tube and the negative control tube have the same color and are colorless, the serum to be detected has no rubella virus infection, and if the test tube and the positive control tube have the same color and are blue, the serum to be detected has rubella virus infection.
The specific test result of the rubella virus primers is as follows:
simultaneously selecting rubella virus tissue culture cell lysate (diluting the rubella virus tissue culture cell lysate by 1000 times when in use), rubella virus negative human serum, rubella virus to-be-detected serum, measles virus positive human serum, cytomegalovirus positive serum, respiratory syncytial virus positive serum, influenza virus positive serum and normal human serum to carry out experiments, detecting the specificity of primers shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 and the sequence specificity (specific to a probe sequence) shown as SEQ ID No.5, and obtaining the result shown in figure 1, wherein the colors of a No.1 tube and a No.3 tube are the same and are blue, which indicates that the rubella virus to-be-detected serum is positive, and the rest tubes are colorless, which indicates that the primers have no amplification to other viruses and no cross reaction. The primer and the probe sequence for detecting the rubella virus have higher specificity.
Example 2
The invention relates to a loop-mediated isothermal gene amplification detection kit for RNA virus, which is applied to the detection of measles virus and comprises the following parts: hydration solution A, hydration solution B, positive control, mineral oil and negative control;
wherein, each liter of the hydration solution A is prepared from the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 70mmol MgCl21mL of Triton X-100, 780U of reverse transcriptase, 0.2mmoL of dNTPs, 1000U of RNase inhibitor, 250pmol of random primer, 0.4g of sodium dodecyl sulfate, 1.2g of sodium octylphenol polyoxyethylene (10) ether succinate, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, 30mmoL of dithiothreitol, 12g of PEG-4000, and the balance of double distilled water;
wherein, each liter of hydration solution B is prepared by the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 6.5mmol MgSO410mmol of (NH)4)2SO40.2mmoL dNTPs, 1.6. mu. mol of each of inner primer FIP and inner primer BIP, 0.2. mu. mol of each of outer primer F3 and outer primer B3, 480U of Bst DNA polymerase, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, 30mmoL L of dithiothreitol, 0.1g of tetramethylbenzidine, 0.1mL of H2O21.0 mu mol of virus specific recognition sequence, and the balance of double distilled water.
Wherein the positive control is virus positive human serum containing a nucleic acid sequence of measles virus genome, and the negative control is virus negative human serum without the nucleic acid sequence of measles virus genome.
Wherein the sequence of the adopted inner primer FIP is shown as SEQ ID NO.6 and comprises the following components: 5 '-CCGGATTAAGGAATTTAATCTT-TTCACTGACCTAGTGAAATTCA-3';
the sequence of the adopted inner primer BIP is shown as SEQ ID NO.7 and comprises the following components: 5 '-TACAGCGACAGGGACAACCTGA-TCAGGTTGTCCCTGTCGCTGTA-3';
the sequence of the adopted outer primer F3 is shown as SEQ ID NO.8 and is as follows: 5'-GATGAAGTGGGCCTGAGGACAC-3', respectively;
the sequence of the adopted outer primer B3 is shown as SEQ ID NO.9 and comprises the following components: 5'-ATGCTCAGTTGTGACAACTCTG-3'
The adopted virus specific recognition sequence is shown as SEQ ID NO.10 and comprises the following components: 5'-TGATTGCAACCCGCCAGAGAGAATCGCAATCAGTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3', the virus-specific recognition sequence comprises a virus-specific probe sequence 5'-AACCCGCCAGAGAGAATC-3' and a deoxyribozyme sequence 5'-GTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3', the 5 ' end of the virus-specific probe sequence is added with TGATTGC, and between the virus-specific probe sequence and the deoxyribozyme sequence is added with GCAATCA, forming the virus-specific recognition sequence shown in SEQ ID NO. 10.
The method for detecting measles virus by using the loop-mediated isothermal gene amplification detection kit for the RNA virus is implemented according to the following steps:
step 1, extracting serum of a material to be detected to obtain the serum to be detected;
step 2, taking 3 reaction tubes, respectively marking the reaction tubes as a positive control tube, a test tube and a negative control tube, and respectively adding 50 mu L of hydration solution A into the positive control tube, the test tube and the negative control tube;
step 3, respectively adding 4 mu L of virus positive human serum into the positive control tube, adding 4 mu L of serum to be tested into the test tube, and adding 4 mu L of virus negative human serum into the negative control tube;
respectively adding 30 mu L of mineral oil into the positive control tube, the test tube and the negative control tube;
step 4, placing the positive control tube, the test tube and the negative control tube in the step 3 in a water bath at 42 ℃ for 60 minutes, and then placing the tubes in a water bath at 95 ℃ for 10 minutes;
step 5, respectively adding 50 mu L of hydration solution B into the positive control tube, the test tube and the negative control tube, and placing the positive control tube, the test tube and the negative control tube in a water bath at 63 ℃ for 65 minutes;
and 6, judging a result: and (5) cooling the positive control tube, the test tube and the negative control tube in the step (5) to room temperature, observing the change of the solution color, wherein if the test tube and the negative control tube have the same color and are colorless, the serum to be detected has no measles virus infection, and if the test tube and the positive control tube have the same color and are blue, the serum to be detected has measles virus infection.
Measles virus primer specificity test results:
meanwhile, measles virus tissue culture cell lysate (diluted by 1000 times when in use), measles virus negative human serum, measles virus to-be-detected serum, rubella virus positive human serum, cytomegalovirus positive serum, respiratory syncytial virus positive serum and normal human serum are selected for experiment, the specificity of the primers shown as SEQ ID No.6, SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9 and the sequence specificity (specific to a probe sequence) shown as SEQ ID No.10 are detected, the result is shown in figure 2, the color of the tube 1 and the color of the tube 3 are the same and are blue, the measles virus to-be-detected serum is positive, and the rest tubes are colorless, so that the primer has no amplification to other viruses and has no cross reaction. The primer and the probe sequence for detecting the measles virus have higher specificity.
The sensitivity effect of the present invention will be described below by taking measles virus as an example.
Performing 10-fold gradient dilution on target DNA with known copy number to serve as a template, performing LAMP and conventional PCR amplification respectively, and comparing sensitivity differences of the two, wherein LAMP takes the lowest template concentration of blue which is directly visible to naked eyes as the lowest detection limit; the lowest detection limit of the PCR was determined as the lowest template concentration at which an electrophoretic band appeared.
Experiments show that the lowest template concentration of LAMP detection is 10 of the original template concentration-7About 0.671 pg/. mu.L, and the correlation between the concentration of the amplification product and the concentration of the template is small, whereas the lowest template concentration detected by the conventional PC R is 10 times the original template concentration-5And the amplification shows that the sensitivity of LAMP detection is 100 times higher than that of the conventional PCR method.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Claims (5)

1. A loop-mediated isothermal gene amplification detection kit for RNA viruses is characterized by comprising the following parts: hydration solution A, hydration solution B, positive control, mineral oil and negative control;
the hydration solution A is prepared from the following components per liter: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 70mmol MgCl21mL of Triton X-100, 780U of reverse transcriptase, 0.2mmoL of dNTPs, 1000U of RNase inhibitor, 250pmol of random primer, 0.4-0.7g of sodium dodecyl sulfate, 0.7-1.2g of sodium octylphenol polyoxyethylene (10) ether succinate, 5mmoL of beta-mercaptoethanol, 6.7 mu mol of EDTA, 100mL of glycerol, 30mmoL of dithiothreitol, 8-12g of PEG-4000 and the balance of double distilled water;
each liter of hydration solution B is prepared from the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 6.5mmol MgSO410mmol of (NH)4)2SO40.2mmoL dNTPs, 1.6. mu. mol of each of inner primer FIP and inner primer BIP, 0.2. mu. mol of each of outer primer F3 and outer primer B3, 480U of Bst DNA polymerase, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, 30mmoL L of dithiothreitol, 0.1g of tetramethylbenzidine, 0.1mL of H2O21.0 mu mol of virus specific recognition sequence, and the balance of double distilled water; the virus-specific recognition sequence comprises a virus-specific probe sequence and a deoxyribozyme sequence;
the RNA virus is rubella virus, and the sequence of the inner primer FIP is as follows:
5’-CGGCCTGCTGGGGCTTCCCCAC-AGGTTGAACCCGCCTTTGGACA-3’；
the sequence of the inner primer BIP is as follows:
5’-ACGACTAACGGCCACATTAAGT-CCCCGGAGCCCTCGGGATTAAC-3’；
the sequence of the outer primer F3 is as follows:
5’-ACTACAAGCAGTACCACCCCAC-3’；
the sequence of the outer primer B3 is as follows:
5’-GGCTAACCCGGAGGGGCCAAAC-3’；
the virus specific recognition sequence is as follows:
5’-TGATTGCTCACAAGACCGTCCGGGTGCAATCAGTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3’。
2. the kit for detecting the loop-mediated isothermal gene amplification of RNA viruses of claim 1, wherein the positive control is human serum positive for viruses containing a viral genome nucleic acid sequence, and the negative control is human serum negative for viruses not containing a viral genome nucleic acid sequence.
3. The kit for detecting the LAMP of claim 1, wherein the amount of sodium laurylsulfate used for preparing the hydrated solution A per liter is 0.6g, the amount of sodium octylphenol polyoxyethylene (10) ether succinate is 0.9g, and the amount of PEG-4000 is 10 g.
4. The use of the loop-mediated isothermal gene amplification test kit for RNA viruses of claim 1 for the preparation of rubella virus detection reagents.
5. A loop-mediated isothermal gene amplification detection kit for RNA viruses is characterized by comprising the following parts: hydration solution A, hydration solution B, positive control, mineral oil and negative control;
the hydration solution A is prepared from the following components per liter: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 70mmol MgCl21mL of Triton X-100, 780U of reverse transcriptase, 0.2mmoL of dNTPs, 1000U of RNase inhibitor, 250pmol of random primer, 0.4-0.7g of sodium dodecyl sulfate, 0.7-1.2g of sodium octylphenol polyoxyethylene (10) ether succinate, 5mmoL of beta-mercaptoethanol, 6.7 mu mol of EDTA, 100mL of glycerol, 30mmoL of dithiothreitol, 8-12g of PEG-4000 and the balance of double distilled water;
each liter of hydration solution B is prepared from the following components: 20mmol Tris-HCl pH 8.8, 10mmol KCl, 6.5mmol MgSO410mmol of (NH)4)2SO40.2mmoL dNTPs, 1.6. mu. mol of each of inner primer FIP and inner primer BIP, 0.2. mu. mol of each of outer primer F3 and outer primer B3, 480U of Bst DNA polymerase, 5mmoL of beta-mercaptoethanol, 6.7. mu. mol of EDTA, 100mL of glycerol, 30mmoL L of dithiothreoSugar alcohol, 0.1g of tetramethylbenzidine, 0.1mL of H2O21.0 mu mol of virus specific recognition sequence, and the balance of double distilled water; the virus-specific recognition sequence comprises a virus-specific probe sequence and a deoxyribozyme sequence; the RNA virus is measles virus, and the sequence of the inner primer FIP is as follows:
5’-CCGGATTAAGGAATTTAATCTT-TTCACTGACCTAGTGAAATTCA-3’；
the sequence of the inner primer BIP is as follows:
5’-TACAGCGACAGGGACAACCTGA-TCAGGTTGTCCCTGTCGCTGTA-3’；
the sequence of the outer primer F3 is as follows: 5'-GATGAAGTGGGCCTGAGGACAC-3', respectively;
the sequence of the outer primer B3 is as follows: 5'-ATGCTCAGTTGTGACAACTCTG-3', respectively;
the virus specific recognition sequence is as follows:
5’-TGATTGCAACCCGCCAGAGAGAATCGCAATCAGTGCCAAGCTTAGTCACTTACGCTGGATCTGTACAGATTATCTTATTCGGTTCTTAGCGGAACGCAGGCTCGCAGTCGACGTTACGGACGACCTGCATGATTCTGAAGAAGC-3’。
CN201610598549.4A 2016-07-26 2016-07-26 LAMP detection kit, detection method and application of RNA virus Expired - Fee Related CN106222298B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610598549.4A CN106222298B (en) 2016-07-26 2016-07-26 LAMP detection kit, detection method and application of RNA virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610598549.4A CN106222298B (en) 2016-07-26 2016-07-26 LAMP detection kit, detection method and application of RNA virus

Publications (2)

Publication Number Publication Date
CN106222298A CN106222298A (en) 2016-12-14
CN106222298B true CN106222298B (en) 2019-12-20

Family

ID=57532987

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610598549.4A Expired - Fee Related CN106222298B (en) 2016-07-26 2016-07-26 LAMP detection kit, detection method and application of RNA virus

Country Status (1)

Country Link
CN (1) CN106222298B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021204701A1 (en) * 2020-04-08 2021-10-14 Bayer Aktiengesellschaft Rapid detection of viral infection using rt-pcr

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4112743A4 (en) * 2020-02-27 2024-03-13 Eiken Chemical Method for detecting single-stranded rna virus
CN111944926A (en) * 2020-08-13 2020-11-17 广州市疾病预防控制中心 Primer for detecting measles virus based on LAMP technology, kit and method thereof
WO2023106866A1 (en) * 2021-12-10 2023-06-15 주식회사 씨젠 Tagged loop primer comprising single-stranded interactive double labeling system, and isothermal nucleic acid amplification method using same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102071251A (en) * 2010-10-09 2011-05-25 中国科学院成都生物研究所 PCR (polymerase chain reaction) nucleic acid detection method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060240462A1 (en) * 2005-04-21 2006-10-26 Johnson & Johnson Research Pty Limited Methods for amplification and detection of nucleic acids

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102071251A (en) * 2010-10-09 2011-05-25 中国科学院成都生物研究所 PCR (polymerase chain reaction) nucleic acid detection method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
基于核酸外切酶Ⅲ辅助信号放大的HRP-mimicking DNAzyme催化化学发光体系检测DNA;高媛;《中国优秀硕士学位论文全文数据库：工程科技Ⅰ辑》;20150215(第02期);全文，尤其是摘要 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021204701A1 (en) * 2020-04-08 2021-10-14 Bayer Aktiengesellschaft Rapid detection of viral infection using rt-pcr

Also Published As

Publication number Publication date
CN106222298A (en) 2016-12-14

Similar Documents

Publication Publication Date Title
RU2601129C2 (en) Compositions and methods for quantifying a nucleic acid sequence in a sample
WO2022057060A1 (en) Method and kit for multiple detection of respiratory virus nucleic acids
CN106222298B (en) LAMP detection kit, detection method and application of RNA virus
CN106399590A (en) General nucleic acid isothermal detection reagent of respiratory tract infection associated adenoviruses
CN106048094B (en) Dual real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit, primers and probe for porcine pseudorabies wild strains and gene-deleted strains
Jackson et al. A novel loop-mediated isothermal amplification method for identification of four body fluids with smartphone detection
AU2020100696A4 (en) LAMP-TaqMan ASSAY KIT FOR PIGEON NEWCASTLE DISEASE VIRUS
CN103757127B (en) Rape transgenosis detecting kit
CN108588277A (en) A kind of canine distemper virus visualization nucleic acid detection method
CN104388592B (en) A kind of Porcine epidemic diarrhea virus S gene RT LAMP detection kits and detection method
Miao et al. Rapid detection of Nipah virus using the one-pot RPA-CRISPR/Cas13a assay
US20080090224A1 (en) Nucleic acid detection
CN109777861A (en) The loop-mediated isothermal amplification method of mispairing tolerance and application
CN103589782A (en) Kit for detecting genetically modified soybean
CN108977578A (en) Detect the kit and its method of H7N9 avian influenza virus
CN103589781B (en) Detection kit for genetically modified corn
CN102994650B (en) Multi-gene detection method of encephalitis viruses based on capillary electrophoresis
CN105567868B (en) GeXP multiple rapid detection primers and detection method for detecting akabane virus, bovine viral diarrhea virus and bluetongue virus
CN106191314B (en) LAMP detection kit, detection method and application of DNA virus
CN112980844A (en) Detection kit for SARS-CoV-2 with transcription activity and use method
CN112063759A (en) RT-LAMP primer, kit and detection method for simultaneously detecting multiple viruses of banana
CN105779656A (en) Porcine torque teno sus virus type 2 loop-mediated isothermal amplification kit and application thereof
CN111575403A (en) High-throughput digital PCR kit for detecting RNA virus nucleic acid and detection method
CN107604085B (en) LAMP (loop-mediated isothermal amplification) detection primer group, kit and method for ureaplasma parvum
CN112410445B (en) Method for detecting croton body by TaqMan probe fluorescence quantitative PCR and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20191220

Termination date: 20200726

CF01 Termination of patent right due to non-payment of annual fee