CN106222276A - Liquid-phase chip based on HCR detection miRNAs method - Google Patents
Liquid-phase chip based on HCR detection miRNAs method Download PDFInfo
- Publication number
- CN106222276A CN106222276A CN201610643310.4A CN201610643310A CN106222276A CN 106222276 A CN106222276 A CN 106222276A CN 201610643310 A CN201610643310 A CN 201610643310A CN 106222276 A CN106222276 A CN 106222276A
- Authority
- CN
- China
- Prior art keywords
- probe
- target mirna
- hcr
- single strand
- microsphere
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses liquid-phase chip based on HCR detection miRNAs method, the invention provides and a kind of detect the method for target miRNA content in RNA to be measured, comprise the steps A:1) synthesize each self-corresponding probe M, probe 1 and probe 2 according to the design of one or more targets miRNA, 2) probe M corresponding for described target miRNA, described target miRNA correspondence microsphere, probe 1 and probe 2 are carried out HCR reaction, obtain HCR product；3) fluorescent labeling detection, according to whether determine whether containing one or more targets miRNA containing fluorescence signal.The method of the present invention not only makes the sensitivity of Traditional liquid phase chip be greatly improved, in terms of quantification range, specificity and accuracy, has good behaviour simultaneously, it is contemplated that, for setting up miRNAs liquid-phase chip detection system quicker, sensitive, simple, mark the newest to tumor is provided detection means.
Description
Technical field
The present invention relates to biological technical field, particularly relate to a kind of liquid-phase chip based on HCR detection miRNAs method.
Background technology
Although circulation miRNAs is the Noninvasive tumor markers that can be transformed into clinic, but due to great majority detection now
Method is all limited by sensitivity, much has the circulation miRNAs of diagnostic value may be out in the cold because not detecting, therefore separate and
Detect the miRNAs in acellular body fluid sample and still there is challenge.Although it addition, the technology such as PCR are in terms of unique identification analyte detection
Achieve major progress, but monitor single index and be typically not enough to clinical disease diagnosis.No matter it it is the early stage to diseases such as cancers
Examination, or illustrate miRNAs expression pattern in biosystem, it is required for detecting under extremely low expression multiple short
Chain miRNAs.But present stage, this high-sensitive multiple miRNAs detection method is not yet set up.
The capture microsphere of different miRNAs can be mixed in a reacting hole by liquid-phase chip, is realizing the same of high throughput testing
Time, the selection to index provides preferable motility again, is widely used in the detection by quantitative of miRNAs.Biscontin etc.
Research finds that the lower sensitivity limit of liquid-phase chip is 0.073fmol.Wang etc. utilize liquid-phase chip system to detect pulmonary carcinoma group simultaneously
Knit the content of middle miR-21, miR-31 and miR-222, and represent that the detection of the method is limited to 1fmol/ μ l.But, there have to be the most fixed
Amount PCR data shows, the miRNAs content that in serum, pulmonary carcinoma is special is about 18.57fM～1.74pM.Visible, liquid-phase chip technology
Owing to omitting amplification step, and lack effective signal amplifying system simultaneously, also cannot complete to miRNAs content such as blood plasma relatively
The detection of low sample.
Cross chain reaction (hybridization chain reaction, HCR) is that one is caused by short chain, and need not
Enzyme just can realize the technology of amplification in room temperature.Biotin labeled hairpin structure probe can be enriched to magnetic bead table by HCR reaction
Face, it is achieved the signal directly carried out on magnetic bead amplifies.
Summary of the invention
It is an object of the invention to provide and a kind of detect the method for target miRNA content in RNA to be measured.
The method that the present invention provides, target in RNA to be measured during for being detected by HCR increased response liquid-phase chip detection platform
The fluorescence signal of miRNA, it is achieved the detection of target miRNA content in RNA to be measured.
In above-mentioned detection RNA to be measured, the method for target miRNA content comprises the steps:
A, Criterion curve, method comprises the steps:
1) each self-corresponding probe M, probe 1 and probe 2 are synthesized according to the design of each target miRNA,
Corresponding probe M, probe 1 and the probe 2 of each target miRNA is as follows:
Described probe M from 5 ' ends include successively HCR cause chain first and the fragment second of described target miRNA specific bond and
The fragment third catching sequence specific combination of microsphere corresponding with described target miRNA；
Described HCR causes chain first to be made up of single strand dna b* and single strand dna c successively from 5 ' ends；
Described single strand dna c is not identical with described target miRNA sequence or specific bond, and size is 6-8nt's
Single strand dna；
The described fragment second with target miRNA specific bond is held successively by single strand dna b and single strand dna a from 5 '
Composition；
Described single strand dna b* and described single strand dna b specific binding pair make described probe M be formed with viscous
The loop-stem structure of property end；
From 5 ' ends, described probe 1 includes that described HCR causes the specific bond fragment of chain first and described target miRNA successively；
Described HCR causes the specific bond fragment of chain first to be divided by single strand dna c* and described single stranded DNA successively from 5 ' ends
Sub-b forms；
Described target miRNA is made up of single strand dna a* and described single strand dna b* successively from 5 ' ends；
Described single strand dna b* and described single strand dna b specific binding pair make described probe 1 be formed with viscous
The loop-stem structure of property end；
From 5 ' ends, described probe 2 includes that HCR causes chain first and the fragment second of described target miRNA specific bond successively
Described HCR causes chain first to be made up of single strand dna b* and single strand dna c successively from 5 ' ends；
The described fragment second with target miRNA specific bond is held successively by single strand dna b and single strand dna a from 5 '
Composition；
Described single strand dna b* and described single strand dna b specific binding pair make described probe 2 be formed with viscous
The loop-stem structure of property end；
2) probe M corresponding for described target miRNA is fixed on microsphere, then by the microsphere of fixing probe M respectively and not
With the target miRNA standard solution of concentration under the effect of probe 1 corresponding to described target miRNA and probe 2, carry out HCR
Reaction, obtains HCR product；
Each target miRNA correspondence one microsphere；
The fluorescence color of every kind of microsphere is different；
3) HCR product described in fluorescent labeling, obtains product to be detected；Detect the fluorescence face of described product to be detected again
Normal complexion fluorescence intensity, with the logarithm of the variable concentrations of described target miRNA standard solution as abscissa, with described target
The logarithm of the fluorescence intensity that the variable concentrations of miRNA standard solution is corresponding is that vertical coordinate does standard curve；
B, by RNA to be measured replace variable concentrations target miRNA standard solution, repeat step A, obtain mesh in RNA to be measured
The fluorescence intensity of mark miRNA；
C, the fluorescence intensity of target miRNA in described RNA to be measured is substituted in described standard curve, obtain in RNA to be measured
Target miRNA content.
In said method, the target miRNA standard solution of described variable concentrations is 1 target miRNA standard solution
Or multiple target miRNA standard solution mixed liquor；
In said method, specific bond is complementary；Target miRNA can be one or more miRNA；A* with a recruits mutually
Right, c* Yu c complementary pairing；1 corresponding a kind of microsphere of target miRNA.
In said method, step 2) include following a-c:
A, probe M solution corresponding for described target miRNA and microspheres solution are uniformly mixed so as to obtain reaction system 1, reaction, obtain
System containing microsphere-probe complex；
B, variable concentrations target miRNA standard solution mix with the described system containing microsphere-probe complex respectively
Obtain reaction system 2, reaction, obtain the different system containing sample-microsphere-probe complex；
C, by probe 2 solution corresponding to probe 1 solution corresponding for described target miRNA, described target miRNA and different institutes
The system containing sample-microsphere-probe complex of stating is uniformly mixed so as to obtain reaction system 3, and HCR reacts, and obtains different HCR reaction and produces
Thing.
The solvent of standard solution is buffer A: weigh 1.925g NaCl, 0.19g MgCl2, it is dissolved in 50ml
In RNasefree water, and adding 2ml Tris-HCl (1M, pH8), RNasefree water is settled to 100ml.
In said method, described step 2) in, the solute proportioning of each solution of addition is as follows:
Described probe M: described microsphere: described variable concentrations target miRNA standard solution: described probe 1: described probe
2 is 100fmol:2500: 5 × 10-7pmol-5×10-2Pmol:500fmol:500fmol.
Or in described step B, described probe M: described microsphere: described probe 1: described probe 2 is 100fmol:2500:
500fmol:500fmol；
Or in described step B, described probe M: described microsphere: miRNAs in described RNA to be measured: described probe 1: described spy
Pin 2 is 100fmol:2500: 5 × 10-7pmol-5×10-2Pmol:500fmol:500fmol.
In said method, the concentration of described probe M solution is 10nM；The addition volume of described probe M solution is 10 μ l；
Or, the concentration of described microspheres solution is 2.5 × 105Individual/ml, the addition volume of described microspheres solution is 10 μ l；
Or, described variable concentrations target miRNA standard solution concentration is 10-1pM-104PM, described variable concentrations target
The addition volume of miRNA standard solution is 5 μ l；
Or, described probe 1 solution concentration is 50nM, and the addition volume of described probe 1 solution is 10ul；
Or, described probe 2 solution concentration is 50nM, and the addition volume of described probe 2 solution is 10ul.
In said method, described reaction condition is under 400rpm rotating speed, 37 DEG C of incubation 1h；
Or, described HCR reaction condition is under 400rpm rotating speed, 37 DEG C of incubation 20min.
In said method, 5 ' and 3 ' the end equal labelling biotin of described probe 1 and described probe 2；
Described fluorescently-labeled label is streptomycin-phycoerythrin；
The reaction condition of described labelling is the lower 20 DEG C of incubation 30min of 200rpm rotating speed.
In said method, in step 1) and step 2) between also comprise the steps: described probe M, described probe 1 and
Described probe 2 all carries out degeneration annealing, probe M after being processed, process after probe 1 and probe 2 after processing；
The condition of above-mentioned degeneration annealing is 95 DEG C of 5min, 90 DEG C of 3min, 85 DEG C of 3min, 80 DEG C of 3min, 75 DEG C of 3min, 70 DEG C
3min, 65 DEG C of 3min, 60 DEG C of 3min, 55 DEG C of 3min, 50 DEG C of 3min, 45 DEG C of 3min, 40 DEG C of 3min, 37 DEG C of 30min.
Or, in step 2) and 3) between, also comprise the steps: to close and purge step described HCR product successively
Suddenly；
Or, step 3) in, described detection uses streaming fluorescence detector.
In said method, described RNA to be measured is specially the poor RNA of target miRNA, described RNA to be measured and derives from nothing
Cell body fluid sample；
Or described acellular body fluid sample is specially in vitro serum or Blood plasma in vitro.
In said method, described target miRNA is let-7a or miR21；
The nucleotides sequence of probe M corresponding for described let-7a is classified as sequence 1；
The nucleotides sequence of probe 1 corresponding for described let-7a is classified as sequence 2；
The nucleotides sequence of probe 2 corresponding for described let-7a is classified as sequence 3；
The nucleotides sequence of probe M corresponding for described miR-21 is classified as sequence 4；
The nucleotides sequence of probe 1 corresponding for described miR-21 is classified as sequence 5；
The nucleotides sequence of probe 2 corresponding for described miR-21 is classified as sequence 6.
HCR reaction application in target miRNAs content in liquid chromatographic detection RNA to be measured is also that the present invention protects
Scope.
In order to make full use of the advantage of liquid-phase chip Multiple detection, improving the sensitivity of the method, the present invention designs simultaneously
The probe M hybridized with special microsphere sequence and target miRNAs, and a pair can the loop-stem structure probe 1 of phase mutual cross and visiting
Pin 2, establishes a kind of miRNAs liquid-phase chip new detecting method based on HCR.The addition of new signal amplification system, makes liquid phase
Chip can reach 0.1pM to 10nM to the quantitative limit of let-7a up to 0.1pM rank, dynamic quantitative scope.This method sensitive
Spend higher than traditional liquid-phase chip, and similar about the miRNAs detection limit of HCR to other, even better.Wide is the most fixed
Weight range is pointed out, and the method has the potentiality of the miRNAs that detection expression is dramatically different simultaneously.The let-of present invention design
The sequence difference between different miRNAs can well be distinguished by 7a probe, and special target miRNAs only completes signal amplification,
Show preferable specificity, and lay a good foundation for Multiple detection.Blood plasma miRNA s after this method detects 5 times of dilutions has
Preferably the response rate, provides foundation for carrying out clinical practice further with the method.
In order to verify the Multiple detection ability of this method further, Simultaneous Quantitative Analysis miR-21 and let-7a.In order to
Realize signal to amplify, select 21-M, 21-1,21-2 probe of 10 times of concentration when Multiple detection, found that Multiple detection
Each miRNAs between without influencing each other, and the fluorescence intensity of miR-21 with its actual content in the range of 0.01pM to 10nM
Linearly it is correlated with.Owing to every kind of fluorescence-encoded microsphere is only specific to corresponding hairpin structure probe, by reading different microsphere
On fluorescence signal can directly obtain kind and the concentration of miRNAs, therefore to be that one is suitable for many for liquid-phase chip based on HCR
The method of re-detection miRNAs.
In sum, the present invention designs hairpin structure probe, and by Luminex χ MAP liquid-phase chip detection platform, right
Multiple miRNAs detection method based on HCR has carried out preliminary exploration.The method not only makes the sensitivity of Traditional liquid phase chip
It is greatly improved, in terms of quantification range, specificity and accuracy, has outstanding performance simultaneously, will suffer from for improving cancer
The cure rate of person and survival rate provide important help.
Accompanying drawing explanation
Fig. 1 is miRNAs liquid-phase chip Cleaning Principle figure based on HCR.
Fig. 2 is the HCR reaction of agarose gel electrophoresis checking let-7a.
Fig. 3 be concentration and probe concentration (A) and HCR response time (B) on the impact (n=3) of fluorescence signal value.
Fig. 4 is calibration graph (A) and double-log calibration curve (B) (n=3).
Fig. 5 is the specificity of liquid-phase chip based on HCR detection miRNAs.
Fig. 6 is let-7a (A) and the detection of mi-21 (B) single index is compared (n=3) with the fluorescence intensity of Multiple detection.
Fig. 7 is the double-log calibration curve (n=3) of miR-21.
Detailed description of the invention
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
Part main agents is as follows:
NaCl Chemical Reagent Co., Ltd., Sinopharm Group
MgCl2Tianjin Zhi Yuan reagent company limited
Tris-HCl Ambion company
RNasefree water (1.25ml) Thermo Fisher Scientific company
RNasefree water (500ml) Beijing CoWin Bioscience Co., Ltd.
TE buffer Beijing DingGuo ChangSheng Biology Technology Co., Ltd
Bovine serum albumin BSA Sigma company
DNA stem ring probe Takara company
MiRNAs standard substance Takara company
-TAGTMMicrospheres Luminex company
Streptomycin Avidin-phycoerythrin (SA-PE) Invitrogen company
The raw work in 50 × TAE buffer Shanghai
Agarose BIOWEST
10X Loading Buffer TaKaRa company
50bp DNA Ladder (Dye Plus) TaKaRa company
MiRcute miRNA Isolation Kit TIANGEN Biotech (Beijing) Co., Ltd.
TE buffer Beijing DingGuo ChangSheng Biology Technology Co., Ltd
East, chloroform Guangzhou reddening factory
East, isopropanol Guangzhou reddening factory
East, dehydrated alcohol Guangzhou reddening factory
Part main agents is formulated as follows:
Buffer A: weigh 1.925g NaCl, 0.19g MgCl2, it is dissolved in 50ml RNasefree water, and adds 2ml
Tris-HCl (1M, pH8), RNasefree water is settled to 100ml.
2.5%BSA solution: weigh 2.5g BSA, is dissolved in 100ml RNasefree water.
1 × TAE buffer: dilute 50ml 50 × TAE buffer with 2450ml deionized water.
Embodiment 1, the foundation of miRNAs liquid-phase chip detection method based on HCR
One, miRNAs liquid-phase chip Cleaning Principle based on HCR
The principle schematic of miRNAs liquid-phase chip based on HCR detection is shown in Fig. 1.
Probe M is made up of 68 bases, including the sequence of a section with the seizure complementary on microsphere；One section and purpose
The sequence (a-b) that miRNA is complementary；And one section can cause HCR cause chain reaction sequence (c-b*).Probe M is through degeneration
And after annealing, form stem-ring secondary structure, and first quilt in system-TAGTMMicrosphere catches.Work as purpose
After miRNA (a*-b*) is added into, miRNA i.e. hybridizes on probe M, and is opened the hair clip knot of probe M by strand replacement reaction
Structure so that it is expose HCR and cause chain reaction to cause chain (c-b*).
Probe 1,2 is constituted by 44 bases, and respectively at 5', 3' end labelling biotin, forms hair clip after pretreatment
Structure, including the stem of a 16bp, the ring of a 6nt, and the sticky end of a 6nt.
The initiation chain (c-b*) that probe M newly discharges and the sticky end complementary pairing (c*-b) of probe 1, discharge and can beat
Opening the sticky end (a*-b*) of probe 2, probe 2 discharges again the sticky end (c-b*) that can open probe 1 after being opened,
Make next probe 1 be opened, thus cause the chain hybridization of a new round.Along with the prolongation in response time, biotin is visited
Pin 1,2 takes on microsphere.After adding streptomycin Avidin-phycoerythrin (SA-PE) in system, microsphere can be enriched to
Substantial amounts of fluorescence signal, thus realize the amplification of signal.
According to different miRNAs sequences to be measured, and different microspheres catches sequence, designs corresponding probe M, probe
1, probe 2 so that special miRNAs only can be incorporated on the microsphere of its respective color, and cause a series of HCR to react.Instead
When answering liquid to pass through the detection of Luminex 200 instrument, instrument identifies color and the fluorescence intensity of microsphere simultaneously, to miRNAs in sample
Carry out qualitative and quantitative analysis.
Two, the foundation of method
(1), detect in RNA to be measured whether contain target miRNA
Step I:
1, each self-corresponding probe M, probe 1 and probe 2 are synthesized according to the design of one or more targets miRNA,
Corresponding probe M, probe 1 and the probe 2 of each target miRNA is as follows:
From 5 ' ends, above-mentioned probe M includes that HCR causes the complementary fragment second of chain first and above-mentioned target miRNA and with upper successively
State the fragment third catching complementary of target miRNA correspondence microsphere；
Above-mentioned HCR causes chain first to be made up of single strand dna b* and single strand dna c successively from 5 ' ends；
The above-mentioned fragment second complementary with target miRNA is held successively by single strand dna b and single strand dna a group from 5 '
Become；
Above-mentioned single strand dna b* and above-mentioned single strand dna b complementary pairing make above-mentioned probe M form band toughness end
The loop-stem structure of end；
From 5 ' ends, above-mentioned probe 1 includes that above-mentioned HCR causes the complementary fragment of chain and above-mentioned target miRNA successively；
Above-mentioned HCR causes the complementary fragment of chain first from 5 ' ends successively by single strand dna c* and above-mentioned single strand dna b
Composition；Above-mentioned target miRNA is made up of single strand dna a* and above-mentioned single strand dna b* successively from 5 ' ends；
Above-mentioned single strand dna b* and above-mentioned single strand dna b complementary pairing make above-mentioned probe 1 form band toughness end
The loop-stem structure of end；
From 5 ' ends, above-mentioned probe 2 includes that HCR causes chain first and the fragment second of above-mentioned target miRNA complementation successively
Above-mentioned HCR causes chain first to be made up of single strand dna b* and single strand dna c successively from 5 ' ends；
The above-mentioned fragment second complementary with target miRNA is held successively by single strand dna b and single strand dna a group from 5 '
Become；
Above-mentioned single strand dna b* and above-mentioned single strand dna b complementary pairing make above-mentioned probe 2 form band toughness end
The loop-stem structure of end；
Above-mentioned probe M, above-mentioned probe 1 and above-mentioned probe 2 are all carried out degeneration annealing, after being processed after probe M, process
Probe 2 after probe 1 and process；
2, probe M corresponding for above-mentioned target miRNA is fixed on above-mentioned target miRNA correspondence microsphere, then by fixing spy
The microsphere of pin M and sample to be tested, under the effect of probe 1 corresponding to above-mentioned target miRNA and probe 2, carry out HCR reaction, obtain
HCR product；
Specific as follows:
A, probe M solution corresponding for above-mentioned target miRNA and microspheres solution are uniformly mixed so as to obtain reaction system 1, reaction, obtain
System containing microsphere-probe complex；
B, RNA solution to be measured and the above-mentioned system containing microsphere-probe complex are mixed to get reaction system 2, reaction,
To the system containing sample-microsphere-probe complex；
C, probe 2 solution corresponding to probe 1 solution corresponding for above-mentioned target miRNA, above-mentioned target miRNA is contained with above-mentioned
The system having sample-microsphere-probe complex is uniformly mixed so as to obtain reaction system 3, and HCR reacts, and obtains HCR product.
Above-mentioned HCR product is closed and washing step successively；
3, fluorescent labeling above-mentioned HCR product, obtains product to be detected；Use the detection of streaming fluorescence detector above-mentioned again
The fluorescence signal of product to be detected, according to whether determine whether containing one or more targets miRNA containing fluorescence signal；If having
Fluorescence signal, then have target miRNA, if not having fluorescence signal, does not then have target miRNA.
(2) target miRNA content in RNA to be measured, is detected
1, Criterion curve:
Variable concentrations target miRNA standard substance are used to replace the RNA to be measured in above-mentioned (one) method, it is thus achieved that variable concentrations mesh
The fluorescence intensity of mark miRNA standard substance, concentration and each self-corresponding fluorescence intensity with variable concentrations target miRNA standard substance are done
Standard curve；
2, use step I in said method to detect RNA to be measured, obtain the fluorescence of target miRNA in RNA to be measured
Intensity；
3, by the fluorescence intensity described standard curve of substitution of target miRNA in described RNA to be measured, obtain in RNA to be measured
Target miRNA content.
Embodiment 2, miRNAs liquid-phase chip based on HCR detect whether containing let-7a
Utilize miRBase data base querying let-7a and miR-21 sequence:
Let-7a:5'-UGAGGUAGUAGGUUGUAUAGUU-3'；
MiR-21:5'-UAGCUUAUCAGACUGAUGUUGA-3'.
Synthetic let-7a and miR-21, and it is diluted to 100 μMs with TE buffer ,-20 DEG C of preservations, obtain let-to be measured
7a standard solution and miRNA21 standard solution to be measured.
One, miRNAs liquid-phase chip based on HCR detection let-7a content
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1) selection of microsphere
Buy No. 12 and No. 26-TAGTMMicrosphere, is respectively used to let-7a and miR-21 content detection.Its
In, No. 12-TAGTMThe seizure sequence cross-linked on microsphere is: 5'-AGTAGAAAGTTGAAATTGATTATG-
3'(12 microsphere is used for detecting let-7a), No. 26-TAGTMThe seizure sequence that microsphere is cross-linked is: 5'-
TTTGATTTAAGAGTGTTGAATGTA-3'(26 microsphere is used for detecting miR-21).
All microspheres all keep in Dark Place in 4 DEG C.
Each microsphere being fixed with probe have one unique fluorescence-encoded.
2), each self-corresponding probe M, probe 1 and probe 2 are synthesized according to let-7a and miR-21 design
According to the seizure sequence in let-7a sequence and No. 12 microspheres, the DNA hairpin structure designing and synthesizing its correspondence is visited
Pin 7a-M, 7a-1,7a-2 (are shown in Table 1)；
According to the seizure sequence in miR-21 sequence and No. 26 microspheres, the DNA hairpin structure designing and synthesizing its correspondence is visited
Pin 21-M, 21-1,21-2 (are shown in Table 1).
The complementary series of seizure sequence that 45-68 position is No. 12 microspheres of probe 7a-M: sequence 1,23-44 position are
The complementary series of let-7a, 1-22 position HCR causes chain；
Probe 7a-1: sequence 2 1-22 position is that HCR causes chain complementary series, 23-44 position to be let-7a nucleotides sequence
Row；
Probe 7a-2: sequence 3 23-44 position AACTATACAACCTACTACCTCA is the complementary series of let-7a, 1-
22 are caused chain for HCR；
Probe 21-M: sequence 4 45-68 be the complementary series of seizure sequence of No. 26 microspheres, 23-44 position be miR-21
Complementary series, 1-22 position be HCR cause chain；
Probe 21-1: sequence 5 the 1st-22 causes chain complementary series, 23-44 position to be miR-21 nucleotides sequence for HCR
Row；
Probe 21-2: sequence 6 23-44 position be the complementary series of miR-21,1-22 position be that HCR causes chain.
The 3' end of above-mentioned probe M and the seizure complementary on microsphere, the 5' end of probe 1 and the 3' end labelling of probe 2 are raw
Thing element.
Experiment probe used is all by high performance liquid chromatography (HPLC) purification, after TE buffer is diluted to 100 μMs ,-20
DEG C preserve.
Table 1 is let-7a and miR-21 liquid-phase chip detection DNA hairpin probe sequence used and labelling
3) probe pretreatment
By the buffer A configured, probe 7a-M is diluted to 10nM, probe 7a-1 and probe 7a-2 and is diluted to respectively
50nM.After three kinds of probe dilution, put into PCR instrument and carry out pretreatment, obtain pretreated probe 7a-M solution, pretreated
Probe 7a-1 solution and pretreated probe 7a-2 solution, in loop-stem structure.
The program of PCR instrument pretreatment is: 95 DEG C of 5min, 90 DEG C of 3min, 85 DEG C of 3min, 80 DEG C of 3min, 75 DEG C of 3min, 70 DEG C
3min, 65 DEG C of 3min, 60 DEG C of 3min, 55 DEG C of 3min, 50 DEG C of 3min, 45 DEG C of 3min, 40 DEG C of 3min, 37 DEG C of 30min.
Probe 21-M, 21-1,21-2 processing method is ibid.
2、
1) probe M is attached on microsphere obtain microsphere-probe complex
No. 12 will bought-TAGTMMicrosphere buffer A is diluted to 2.5 × 105After individual/ml, take 10 μ l,
I.e. ensure in each reaction system containing microsphere 2500, mix with probe 7a-M solution (10nM) after 10 μ l pretreatment, put into perseverance
Temperature blending instrument, with the rotating speed of 400rpm (radius of turn 3mm), in 37 DEG C of incubation 1h, obtains 20 μ l microspheres-probe complex body
System；After microsphere and pretreatment, the proportioning of probe 7a-M is 2500: 100fmol.
2) sample to be tested and microsphere-probe complex hybridization
To 20 μ l above-mentioned 1) microsphere-probe complex system of obtaining adds 5 μ l let-7a to be measured standard solution
(concentration of RNA is 107FM, the amount of material is 5 × 10-7Pmol), constant temperature blending instrument is put into, with 400rpm's after vortex mixing 5s
Rotating speed, in 37 DEG C of incubation 1h, makes let-7a and microsphere-probe complex hybridization, obtains system after 25 μ l hybridization, wherein contain sample
Basis-microsphere-probe complex.
3) HCR reaction
By 10 μ l 50nM pretreated probe 7a-1 solution and 10 μ l 50nM pretreated probe 7a-2 solution etc.
Volume mixture (mol ratio is 1:1), takes 20 μ l mixed liquors and adds 25 μ l above-mentioned 3) after the hybridization that obtains in system, vortex mixes
5s, puts into constant temperature blending instrument, with the rotating speed of 400rpm, 37 DEG C of incubation 20min, to carry out HCR reaction, obtains 45 μ l HCR reactions
System, wherein contains HCR product.
Close: before fluorescent labeling, the BSA aqueous solution of 10 μ l weight/mass percentage composition 2.5% is added above-mentioned HCR reaction system
In, in 37 DEG C of incubation 10min, reaction system after being closed.
Wash plate: reaction system after above-mentioned closing is placed on Magnetic Isolation plate standing 5min, and liquid-transfering gun removes supernatant, afterwards
Add the 25 μ resuspended microspheres of l buffer A, collect all suspensions, obtain reaction system before labelling.
3、
1) fluorescent labeling
With RNasefree water by dilute for streptomycin-phycoerythrin (Streptavidin R-Phycoerythrin, SA-PE)
Releasing to 2ng/ μ l for fluorescent labeling, experiment is now with the current every time, obtains SA-PE solution.
Adding before the 25 above-mentioned labellings of μ l in reaction system by the SA-PE solution after 75 μ l dilutions, whirlpool mixing 5s, at constant temperature
With the rotating speed of 200rpm in blending instrument, in 20 DEG C of incubation 30min, obtain system to be detected.
2) Luminex detects fluorescence signal
Above-mentioned system to be detected being transferred in 96 hole detection plates, streaming fluorescence detector Luminex 200 detects each hole
Fluorescence signal.
Reactant liquor volume 80 μ l is drawn in detection every time, and reads the fluorescence signal of 100 No. 12 microspheres.
According to whether determine whether containing target miRNA containing fluorescence signal, if there being fluorescence signal, then there is target miRNA,
If there is no fluorescence signal, then there is no target miRNA.
Let-7a standard solution to be measured can detect in aforementioned manners.
Same method is used to detect miRNA21 standard solution to be measured, it is also possible to detect.
Two, whether checking let-7a can cause HCR to react
The agarose gel electrophoresis using 3% verifies whether the stem ring probe designed by this experiment can be drawn by target miRNAs
Send out HCR reaction.
Take the testing sample of 9 μ l, add 10 × Loading Buffer of 1 μ l, loading after mixing.Gel is placed in the electricity of 200V
Pressure, runs glue 25min.Observing the band run out of under uviol lamp, gel imaging system is taken pictures preservation.
Result such as Fig. 2, testing sample order is: 1. 1 μM of let-7a；2. 1 μM of probe 7a-M；3. 2 μMs of probe 7a-1；④2
μM probe 7a-2；5. 1 μM of 7a-M and 2 μMs of 7a-1 and 2 μMs of 7a-2 mixes the product hatching 1h；6. 1 μM of 7a-M and 1 μM of let-
The product of 1h is hatched in 7a mixing；7. the product of 1h is hatched in 1 μM of 7a-M, 2 μMs of 7a-1,2 μMs of 7a-2 and 1 μM of let-7a mixing.
When there is 7a-M, 7a-1 and 7a-2 in mixture simultaneously, electrophoresis result only demonstrates a band (band 5), shows now
It is not through HCR and forms [7a-1/7a22]nComposite construction.And when let-7a is added into after system mixing hatches 1h, i.e. visible big
Band in 100bp occurs, the band on 7a-1 and 7a-2 position the most substantially weakens (band 7) simultaneously, and depositing of let-7a is described
Causing HCR reaction.
Three, the optimization of parameter in method
Parameters in above-mentioned one is optimized, specific as follows:
A, optimization concentration and probe concentration
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1), the selection of microsphere: identical with；
2), each self-corresponding probe M, probe 1 and probe 2 are synthesized according to let-7a design: identical with one；
3), probe pretreatment: by the buffer A configured, probe 7a-M is diluted to 10nM, probe 7a-1 and probe
7a-2 is diluted to 20nM, 50nM, 100nM respectively；
2、
1) probe M be attached on microsphere obtain microsphere-probe complex: by above-mentioned 10nM probe M respectively according to one side
Method adds reaction；
2) by buffer A, let-7a standard solution to be measured is diluted to 6 continuous print Concentraton gradient (102FM～
107FM), carry out adding reaction according to the method in；
3) HCR reaction: by 20nM, 50nM, 100nM probe 7a-1 and 20nM, 50nM, 100nM probe 7a-2 respectively according to
The method of one adds reaction；
3、
1) fluorescent labeling: identical with；
2) Luminex detects fluorescence signal: identical with one；
3 multiple holes are done in each reaction, for finding the optimum concentration and probe concentration of detection let-7a.
Result such as Fig. 3 A, although fluorescence signal raises along with probe 7a-1 and the rising of 7a-2 concentration, but each detected value
Dispersion degree (s) raise the most simultaneously, i.e. illustrate that the stability of now detection system and repeatability occur in that substantially reduction.In order to
Making liquid-phase chip detection system can realize signal to amplify, can have again the quantitation capabilities of optimum, the DNA hairpin structure of 50nM is visited
Pin concentration is i.e. selected for subsequent experimental.
Therefore optimal concentration and probe concentration is 10nM probe 7a-M solution, 50nM probe 7a-1 solution and 50nM 7a-2 solution.
B, optimizing reaction time
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1), the selection of microsphere: identical with；
2), each self-corresponding probe M, probe 1 and probe 2 are synthesized according to let-7a design: identical with one；
3), probe pretreatment: by the buffer A configured, probe 7a-M is diluted to 10nM, probe 7a-1 and probe
7a-2 is diluted to 50nM respectively；
2、
1) probe M be attached on microsphere obtain microsphere-probe complex: by above-mentioned 10nM probe M respectively according to one side
Method adds reaction；
2) by buffer A, let-7a standard solution to be measured is diluted to 6 continuous print Concentraton gradient (102FM～
107FM), carry out adding reaction according to the method in；
3) HCR reaction: essentially identical with, adds according to the method for respectively by 50nM probe 7a-1 and 50nM probe 7a-2
Enter reaction；Except for the difference that 37 DEG C of difference oscillation incubation 10min, 20min, 30min, 40min, 50min, 60min；
3、
1) fluorescent labeling: identical with；
2) Luminex detects fluorescence signal: identical with one；
Observe the impact on fluorescence signal of the different HCR response time.3 multiple holes are done in each reaction.
Result such as Fig. 3 B, under conditions of concentration and probe concentration is 50nM, observes the change with the HCR response time of the fluorescence signal value
Change, find the coefficient R of fluorescence intensity and let-7a2In the range of 10min to 20min can with incubative time prolongation and by
Gradually rise, i.e. occur after 20min declining slowly, and declining occurs the most simultaneously in detection system stability.Therefore, 20min
The HCR response time is i.e. selected for follow-up test.
Therefore the HCR response time is 20min.
Four, specific detection
The miRNAs sequence of detection let-7 family is as follows:
let-7a UGAGGUAGUAGGUUGUAUAGUU
let-7b UGAGGUAGUAGGUUGUGUGGUU
let-7c UGAGGUAGUAGGUUGUAUGGUU
let-7d AGAGGUAGUAGGUUGCAUAGUU
let-7e UGAGGUAGGAGGUUGUAUAGUU
let-7f UGAGGUAGUAGAUUGUAUAGUU
let-7g UGAGGUAGUAGUUUGUACAGUU
let-7i UGAGGUAGUAGUUUGUGCUGUU。
By buffer A, let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7i is dilute
Release 1pM as RNA solution to be measured.
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1), the selection of microsphere: identical with；
2), each self-corresponding probe M, probe 1 and probe 2 are synthesized according to let-7a design: identical with one；
3), probe pretreatment: by the buffer A configured, probe 7a-M is diluted to 10nM, probe 7a-1 and probe
7a-2 is diluted to 50nM respectively；
2、
1) probe M be attached on microsphere obtain microsphere-probe complex: by above-mentioned 10nM probe M respectively according to one side
Method adds reaction；
2) carry out adding reaction according to the method in respectively by RNA solution to be measured by buffer A；
3) HCR reaction: 50nM probe 7a-1 and 50nM probe 7a-2 is added reaction according to the method for respectively；
3、
1) fluorescent labeling: identical with；
2) Luminex detects fluorescence signal: identical with one；
Every part of sample duplicate detection 3 times.
Result such as Fig. 5, under identical experiment condition, except let-7a, the fluorescence signal of other 7 miRNAs is the most close
Background value, illustrates that only let-7a can cause HCR reaction to produce the fluorescence signal of high intensity, and prompting this method can effective district
Divide the sequence differences of different miRNAs, there is good specificity.
Embodiment 3, detect target miRNA content in RNA to be measured
(1), Criterion curve
With buffer A 100 μMs of let-7a standard solutions to be measured are diluted to 6 continuous print Concentraton gradient 0.1pM, 1pM,
10pM, 100pM, 1nM, 10nM are as the let-7a standard solution to be measured of variable concentrations.
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1) selection of microsphere: identical with the one of embodiment 2；
2), each self-corresponding probe M, probe 1 and probe 2 are synthesized according to let-7a and miR-21 design: with embodiment 2
One is identical；
3) probe pretreatment: identical with the one of embodiment 2；
2、
1) probe M is attached on microsphere obtain microsphere-probe complex: identical with the one of embodiment 2；
2) sample to be tested and microsphere-probe complex hybridization: RNA solution to be measured be respectively 0.1pM, 1pM, 10pM,
100pM, 1nM, 10nM let-7a to be measured standard solution, remaining method is identical with the one of embodiment 2；
3) HCR reaction: identical with the one of embodiment 2；
3、
1) fluorescent labeling: identical with the one of embodiment 2；
2) Luminex detects fluorescence signal: identical with the one of embodiment 2；
Every part of sample duplicate detection 3 times.Draw standard curve with Excel software analysis and calculate coefficient R2。
Shown in result Fig. 4, between display fluorescence intensity and the actual content of let-7a, there is significant dependency (R2=
0.97946), and linearly it is correlated with in the range of 0.1pM to 10nM, is expressed as log10I=0.0628log10C+2.9714,
Wherein I is fluorescence intensity, and C is the concentration of let-7a.According to result, this method detection miRNAs is quantitatively limited to 0.1pM, prompting
This method has higher sensitivity.
Fig. 4 B is standard curve.
(2) content of let-7a in RNA sample to be measured, is detected
One, the preparation RNA to be measured containing let-7a
1, RNA in sample to be tested is extracted
Take 800 μ l Healthy People pooled plasmas, be divided into 4 parts, use miRcute miRNA Isolation Kit to extract
MiRNAs, extraction step is as follows:
1) during 200 μ l blood plasma add 200 μ l lysates, acutely vibrate 30s, and room temperature stands 5min.
2) with 12, the centrifugation 10min of 000rpm, take supernatant and add in another centrifuge tube.
3) adding 200 μ l chloroforms, acutely vibrating, 15s rear chamber is gentle and quiet puts 5min.
4) with 12, the centrifugation 15min of 000rpm, take upper strata aqueous phase 200 μ l.
5) add the dehydrated alcohol of 60 μ l, after mixing, proceed to adsorption column miRspin.
6) after adsorption column room temperature places 2min, 12,000rpm are centrifuged 30s, abandon post, retain liquid.
7) in remaining liq, add the dehydrated alcohol of 180 μ l, after mixing, proceed to adsorption column miRelute.
8), after room temperature places 2min, 12,000rpm are centrifuged 30s, retain adsorption column.
9) adding 500 μ l protein liquid removals in adsorption column miRelute, stand 2min, 12,000rpm are centrifuged 30s, abandon liquid.
10) adding 500 μ l washing liquids in adsorption column miRelute, stand 2min, 12,000rpm are centrifuged 30s, abandon liquid.Weight
The most once.
11) 12, after 000rmp is centrifuged 1min, dry, to remove residual liquid.
12) adsorption column miRelute proceeds to new 1.5ml centrifuge tube, adds the RNase-free water of 20 μ l, and room temperature stands
5min。
13) 12,000rmp are centrifuged 2min, collect RNA lysate, are 4 parts of RNA extracts.
(2) detection fluorescence signal
2, dilution
4 parts of RNA extracts are mixed into 80 μ l, take 10 μ l and add 40 μ l buffer A and be configured to 20% (volume basis contains
Amount, for the embodiment of extension rate) blood plasma RNA diluent；Take 20 μ l to add 20 μ l buffer A and be configured to the blood plasma of 50%
RNA diluent.
After let-7a standard solution is diluted to 5pM, 500pM, 50nM, take respectively 2 μ l add 8 μ l above-mentioned 20%,
50% and be not diluted the RNA extract of (100%), obtain the RNA to be measured containing let-7a of variable concentrations.
Two, let-7a content in RNA to be measured is detected
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1) selection of microsphere: identical with the one of embodiment 2；
2), each self-corresponding probe M, probe 1 and probe 2 are synthesized according to let-7a and miR-21 design: with embodiment 2
One is identical；
3) probe pretreatment: identical with the one of embodiment 2；
2、
1) probe M is attached on microsphere obtain microsphere-probe complex: identical with the one of embodiment 2；
2) sample to be tested and microsphere-probe complex hybridization: RNA solution to be measured is respectively the variable concentrations of an above-mentioned preparation
The RNA to be measured containing let-7a, remaining method is identical with the one of embodiment 2；
3) HCR reaction: identical with the one of embodiment 2；
3、
1) fluorescent labeling: identical with the one of embodiment 2；
2) Luminex detects fluorescence signal: identical with the one of embodiment 2；
Detect the background signal of let-7a in each concentrations Plasma RNA extract, and add after concentration known let-7a glimmering
Optical signal, and utilize standard curve to calculate the concentration of corresponding let-7a.
The response rate=[(measured value)-(background values)/addition] × 100%.Every part of sample duplicate detection twice.
The results are shown in Table 2.Owing to let-7 content endogenic in blood plasma is less than the detection limit of this method, contain because measuring
Amount, background concentration is i.e. set to 0.According to result, in the blood plasma RNA extract of liquid-phase chip detection 20%, each concentration let-7a returns
Yield is 81.06%-117.99%, and prompting is under this extension rate, and the method detection blood plasma miRNA s has the most accurately
Degree.But, when extension rate improves to 50% or 100%, and the situation more than 80% or less than 120% i.e. occurs in the response rate,
Showing the increase along with plasma concentration, the complicated ingredient in blood plasma can disturb the detection of fluorescence signal, and when in serum
When miRNAs concentration is relatively low, this interference mainly shows as signal inhibitory action.
The content of let-7a in table 2 liquid-phase chip based on HCR detection blood plasma
Embodiment 4, detect let-7a and miR-21 in RNA to be measured simultaneously
Utilize TE buffer respectively let-7a and miR-21 standard substance to be diluted to 1 μM, and respectively take 10 μ l and add to 80 μ l TE
In buffer, making every kind of miRNAs concentration is 100nM, then by buffer A, mixing miRNAs is diluted to 7 continuous print concentration ladders
Degree: 107fM、106fM、105fM、104fM、103fM、102The sample to be tested of fM, 10fM.
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1, the selection of microsphere and the design of DNA hairpin probe synthesize
1) selection of microsphere: identical with the one of embodiment 2；
2), each self-corresponding probe M, probe 1 and probe 2 are synthesized according to let-7a and miR-21 design: with embodiment 2
One is identical；
3) probe pretreatment: probe 7a-M is diluted to 20nM with TE buffer；7a-1,7a-2 are diluted to 100nM；Will
Probe 21-M is diluted to 200nM；After probe 21-1,21-2 are diluted to 1000nM, put into PCR instrument and carry out pretreatment (with implementing
The one of example 1).After pretreatment, 7a-M with 21-M equal-volume is mixed；7a-1,7a-2,21-1,21-2 equal-volume mixes.
2、
1) probe M is attached on microsphere obtain microsphere-probe complex: essentially identical with the one of same embodiment 1, different
It is:
No. 12 and the mixing of No. 26 microsphere equal-volumes that will buy, and with buffer A be diluted to every kind of microsphere concentration be 2.5 ×
105Individual/ml.Take 10 μ l mixing microspheres, add to, in 10 μ l pretreated probe M mixed liquor, put into constant temperature blending instrument, with
The rotating speed of 400rpm, 37 DEG C of incubation 1h.
2) sample to be tested is with microsphere-probe complex hybridization: RNA solution to be measured is respectively 107fM、106fM、105fM、
104fM、103fM、102The sample to be tested of fM, 10fM, essentially identical, except for the difference that with the one of same embodiment 1:
The miRNAs mixed solution taking the 5 each concentration of μ l adds system, puts into constant temperature blending instrument after vortex mixing 5s, with
The rotating speed of 400rpm, 37 DEG C of incubation 1h, make each miRNAs and corresponding microsphere-probe complex hybridization.
3) HCR reaction: essentially identical, except for the difference that with the two of same embodiment 1:
Pretreated 7a-1,7a-2,21-1,21-2 mixed solution taking 20 μ l and adds reaction system, vortex mixes 5s,
Put into constant temperature blending instrument, with the rotating speed of 400rpm, in 37 DEG C of incubation 20min, to carry out HCR reaction.
3、
1) fluorescent labeling: identical with the one of embodiment 2；
2) Luminex detects fluorescence signal: identical with the one of embodiment 2；
Result such as Fig. 6, two miRNAs single index detections are similar to fluorescence intensity during Multiple detection, it is seen that this method exists
Cross interference between no signal in Multiple detection.
The standard curve of miR-21 when drawing Multiple detection.As between fluorescence intensity and the content of Fig. 7, miR-21 at 10fM
Linearly it is correlated with in the range of 10nM, is expressed as log10I=0.1781log10C+1.4703(R2=0.93904) wherein I is
Fluorescence intensity, C is the concentration of miRNAs.Visible, even if 2 miRNAs of detection simultaneously, this method remains to tool to each miRNAs
There is outstanding quantitation capabilities.
Claims (10)
1. detect a method for target miRNA content in RNA to be measured, comprise the steps:
A, Criterion curve, method comprises the steps:
1) each self-corresponding probe M, probe 1 and probe 2 are synthesized according to the design of each target miRNA,
Corresponding probe M, probe 1 and the probe 2 of each target miRNA is as follows:
Described probe M from 5 ' ends include successively HCR cause chain first and the fragment second of described target miRNA specific bond and with institute
That states target miRNA correspondence microsphere catches the fragment third that sequence specific combines；
Described HCR causes chain first to be made up of single strand dna b* and single strand dna c successively from 5 ' ends；
Described single strand dna c is not identical with described target miRNA sequence or specific bond, and size is the strand of 6-8nt
DNA molecular；
The described fragment second with target miRNA specific bond is held successively by single strand dna b and single strand dna a group from 5 '
Become；
Described single strand dna b* and described single strand dna b specific binding pair make described probe M form band toughness end
The loop-stem structure of end；
From 5 ' ends, described probe 1 includes that described HCR causes the specific bond fragment of chain first and described target miRNA successively；
Described HCR causes the specific bond fragment of chain first from 5 ' ends successively by single strand dna c* and described single strand dna b
Composition；
Described target miRNA is made up of single strand dna a* and described single strand dna b* successively from 5 ' ends；
Described single strand dna b* and described single strand dna b specific binding pair make described probe 1 form band toughness end
The loop-stem structure of end；
From 5 ' ends, described probe 2 includes that HCR causes chain first and the fragment second of described target miRNA specific bond successively
Described HCR causes chain first to be made up of single strand dna b* and single strand dna c successively from 5 ' ends；
The described fragment second with target miRNA specific bond is held successively by single strand dna b and single strand dna a group from 5 '
Become；
Described single strand dna b* and described single strand dna b specific binding pair make described probe 2 form band toughness end
The loop-stem structure of end；
2) probe M corresponding for described target miRNA is fixed on microsphere, then by the microsphere of fixing probe M respectively with the denseest
The target miRNA standard solution of degree, under the effect of probe 1 corresponding to described target miRNA and probe 2, carries out HCR reaction,
Obtain HCR product；
Each target miRNA correspondence one microsphere；
The fluorescence color of every kind of microsphere is different；
3) HCR product described in fluorescent labeling, obtains product to be detected；Detect again described product to be detected fluorescence color and
Fluorescence intensity, with the logarithm of the variable concentrations of described target miRNA standard solution as abscissa, marks with described target miRNA
The logarithm of the fluorescence intensity that the variable concentrations of quasi-product solution is corresponding is that vertical coordinate does standard curve；
B, by RNA to be measured replace variable concentrations target miRNA standard solution, repeat step A, obtain target in RNA to be measured
The fluorescence intensity of miRNA；
C, the fluorescence intensity of target miRNA in described RNA to be measured is substituted in described standard curve, obtain target in RNA to be measured
MiRNA content.
Method the most according to claim 1, it is characterised in that:
Step 2) include following a-c:
A, probe M solution corresponding for described target miRNA and microspheres solution are uniformly mixed so as to obtain reaction system 1, reaction, is contained
The system of microsphere-probe complex；
B, variable concentrations target miRNA standard solution are mixed to get with the described system containing microsphere-probe complex respectively
Reaction system 2, reaction, obtain the different system containing sample-microsphere-probe complex；
C, probe 2 solution corresponding to probe 1 solution corresponding for described target miRNA, described target miRNA is contained described in different
The system having sample-microsphere-probe complex is uniformly mixed so as to obtain reaction system 3, and HCR reacts, and obtains different HCR product.
Method the most according to claim 2, it is characterised in that:
Described step 2) in, the solute proportioning of each solution of addition is as follows:
Described probe M: described microsphere: described variable concentrations target miRNA standard solution: described probe 1: described probe 2 is
100fmol:2500: 5 × 10-7pmol-5×10-2Pmol:500fmol:500fmol.
Method the most according to claim 3, it is characterised in that:
The concentration of described probe M solution is 10nM；The addition volume of described probe M solution is 10 μ l；
Or, the concentration of described microspheres solution is 2.5 × 105Individual/ml, the addition volume of described microspheres solution is 10 μ l；
Or, described variable concentrations target miRNA standard solution concentration is 10-1pM-104PM, described variable concentrations target miRNA
The addition volume of standard solution is 5 μ l；
Or, described probe 1 solution concentration is 50nM, and the addition volume of described probe 1 solution is 10ul；
Or, described probe 2 solution concentration is 50nM, and the addition volume of described probe 2 solution is 10ul.
5. according to described method arbitrary in claim 2-4, it is characterised in that:
Described reaction condition is under 400rpm rotating speed, 37 DEG C of incubation 1h；
Or, described HCR reaction condition is under 400rpm rotating speed, 37 DEG C of incubation 20min.
6. according to described method arbitrary in claim 1-5, it is characterised in that:
5 ' and 3 ' the end equal labelling biotin of described probe 1 and described probe 2；
Described fluorescently-labeled label is streptomycin-phycoerythrin；
The reaction condition of described labelling is the lower 20 DEG C of incubation 30min of 200rpm rotating speed.
7. according to described method arbitrary in claim 1-6, it is characterised in that:
In step 1) and step 2) between also comprise the steps: all to carry out described probe M, described probe 1 and described probe 2
Degeneration is annealed, probe M after being processed, process after probe 2 after probe 1 and process；
Or, in step 2) and 3) between, also comprise the steps: to close and washing step described HCR product successively；
Or, step 3) in, described detection uses streaming fluorescence detector.
8. according to described method arbitrary in claim 1-7, it is characterised in that:
Described RNA to be measured derives from acellular body fluid sample；
Or described acellular body fluid sample is specially in vitro serum or Blood plasma in vitro.
9. according to described method arbitrary in claim 1-8, it is characterised in that:
Described target miRNA is let-7a or miR21；
The nucleotides sequence of probe M corresponding for described let-7a is classified as sequence 1；
The nucleotides sequence of probe 1 corresponding for described let-7a is classified as sequence 2；
The nucleotides sequence of probe 2 corresponding for described let-7a is classified as sequence 3；
The nucleotides sequence of probe M corresponding for described miR-21 is classified as sequence 4；
The nucleotides sequence of probe 1 corresponding for described miR-21 is classified as sequence 5；
The nucleotides sequence of probe 2 corresponding for described miR-21 is classified as sequence 6.
10. detect a method for target miRNA content in RNA to be measured, for by the detection detection of HCR increased response liquid-phase chip
Time RNA to be measured in the fluorescence signal of target miRNA, it is achieved the detection of target miRNA content in RNA to be measured；
Or HCR reaction application in target miRNAs content in liquid-phase chip detects RNA to be measured.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610643310.4A CN106222276B (en) | 2016-08-08 | 2016-08-08 | Liquid-phase chip miRNAs detection method based on HCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610643310.4A CN106222276B (en) | 2016-08-08 | 2016-08-08 | Liquid-phase chip miRNAs detection method based on HCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106222276A true CN106222276A (en) | 2016-12-14 |
| CN106222276B CN106222276B (en) | 2019-12-10 |
Family
ID=57547679
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610643310.4A Active CN106222276B (en) | 2016-08-08 | 2016-08-08 | Liquid-phase chip miRNAs detection method based on HCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106222276B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107099612A (en) * | 2017-06-21 | 2017-08-29 | 深圳市展行生物有限公司 | A kind of method based on short nucleotide chain connecting detection cancer patient's serum miRNA |
| CN107119124A (en) * | 2017-05-10 | 2017-09-01 | 清华大学 | A kind of method of target miRNA content in detection sample to be tested |
| CN107190060A (en) * | 2017-05-25 | 2017-09-22 | 太原理工大学 | MicroRNA detection probes and graphene detection method |
| CN107574227A (en) * | 2017-10-10 | 2018-01-12 | 武汉大学 | A kind of method for nucleic acid analysis based on cascade hybridization chain reaction |
| CN111655865A (en) * | 2018-01-26 | 2020-09-11 | 北京生命科学研究所 | Multiplex immune signal amplification using a hybridization chain reaction based method |
| CN114199816A (en) * | 2021-11-22 | 2022-03-18 | 湖北大学 | Near-infrared light excitation-based photo-thermal sensor for detecting biomarker, preparation method thereof and application thereof in marker detection |
| CN114231599A (en) * | 2020-09-09 | 2022-03-25 | 北京师范大学 | Hybrid nanosphere based on metal-DNA coordination and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305602A (en) * | 2013-03-08 | 2013-09-18 | 深圳市人民医院 | Method for diagnosing early lung cancer by detecting sputum microRNAs based on liquid phase chip |
| CN104877999A (en) * | 2015-05-19 | 2015-09-02 | 深圳市人民医院 | Liquid phase chip miRNA detection kit |
-
2016
- 2016-08-08 CN CN201610643310.4A patent/CN106222276B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305602A (en) * | 2013-03-08 | 2013-09-18 | 深圳市人民医院 | Method for diagnosing early lung cancer by detecting sputum microRNAs based on liquid phase chip |
| CN104877999A (en) * | 2015-05-19 | 2015-09-02 | 深圳市人民医院 | Liquid phase chip miRNA detection kit |
Non-Patent Citations (3)
| Title |
|---|
| DONGBEI LI ET AL.: "xMAP Array Microspheres Based Stem-Loop Structured Probes as Conformational Switches for Multiplexing Detection of miRNAs", 《ANALYTICAL CHEMISTRY》 * |
| SHENG CAI ET AL.: "Label-free technology for the amplified detection of microRNA based on the allosteric hairpin DNA switch and hybridization chain reaction", 《ANALYST》 * |
| 王旭丹: "MicroRNA检测方法的发展现状", 《国际内科学杂志》 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107119124A (en) * | 2017-05-10 | 2017-09-01 | 清华大学 | A kind of method of target miRNA content in detection sample to be tested |
| CN107190060A (en) * | 2017-05-25 | 2017-09-22 | 太原理工大学 | MicroRNA detection probes and graphene detection method |
| CN107099612A (en) * | 2017-06-21 | 2017-08-29 | 深圳市展行生物有限公司 | A kind of method based on short nucleotide chain connecting detection cancer patient's serum miRNA |
| CN107099612B (en) * | 2017-06-21 | 2020-10-30 | 深圳市展行生物有限公司 | Method for detecting cancer patient serum miRNA based on short nucleotide chain connection |
| CN107574227A (en) * | 2017-10-10 | 2018-01-12 | 武汉大学 | A kind of method for nucleic acid analysis based on cascade hybridization chain reaction |
| CN107574227B (en) * | 2017-10-10 | 2020-03-10 | 武汉大学 | Nucleic acid analysis method based on cascade hybridization chain reaction |
| CN111655865A (en) * | 2018-01-26 | 2020-09-11 | 北京生命科学研究所 | Multiplex immune signal amplification using a hybridization chain reaction based method |
| CN111655865B (en) * | 2018-01-26 | 2024-04-12 | 健达九州(北京)生物科技有限公司 | Multiplex immune signal amplification using hybridization chain reaction based methods |
| CN114231599A (en) * | 2020-09-09 | 2022-03-25 | 北京师范大学 | Hybrid nanosphere based on metal-DNA coordination and preparation method and application thereof |
| CN114231599B (en) * | 2020-09-09 | 2023-07-18 | 北京师范大学 | Hybrid nanosphere based on metal-DNA coordination and preparation method and application thereof |
| CN114199816A (en) * | 2021-11-22 | 2022-03-18 | 湖北大学 | Near-infrared light excitation-based photo-thermal sensor for detecting biomarker, preparation method thereof and application thereof in marker detection |
| CN114199816B (en) * | 2021-11-22 | 2023-11-03 | 湖北大学 | Photothermal sensor for detecting biological marker based on near infrared light excitation, preparation method thereof and application thereof in marker detection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106222276B (en) | 2019-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106222276A (en) | Liquid-phase chip based on HCR detection miRNAs method | |
| Yu et al. | An aptamer-based new method for competitive fluorescence detection of exosomes | |
| CN108034658B (en) | Nucleic acid aptamer for detecting human uveal melanoma cells | |
| CN109161542B (en) | Fluorescent in-situ hybridization probe and preparation method and application thereof | |
| CN102260737B (en) | Primers and application thereof in quick detection of nosema bombycis | |
| Sun et al. | Label-free fluorescence dual-amplified detection of adenosine based on exonuclease III-assisted DNA cycling and hybridization chain reaction | |
| JP2021072808A (en) | Labelled 2'-o-methyl rna oligonucleotide probe and automatic rna detection using signal amplification system | |
| WO2019149115A1 (en) | Use of nucleic acid aptamer in alkaline phosphatase heterodimer recognition and binding or in tumor detection | |
| CN101886122A (en) | Method for detecting chlamydia pneumoniae by loop-mediated isothermal amplification and detection kit | |
| Bain et al. | Single-molecule sorting of DNA helicases | |
| CN104480114B (en) | The method of high performance liquid chromatography screening aptamer and aptamer and application | |
| Li et al. | Highly sensitive detection and intracellular imaging of microRNAs based on target-triggered cascade catalytic hairpin assembly | |
| Zhang et al. | A highly sensitive and versatile fluorescent biosensor for pathogen nucleic acid detection based on toehold-mediated strand displacement initiated primer exchange reaction | |
| CN109161580B (en) | HER2 gene fluorescence in situ hybridization probe and preparation method and application thereof | |
| CN107227346A (en) | A kind of inexpensive CBFB gene break quick detection probes and its preparation method and application | |
| CN104730240B (en) | A kind of compound fluorescent nano probe and its preparation method and application | |
| Fernández‐Rhodes et al. | Defining the influence of size‐exclusion chromatography fraction window and ultrafiltration column choice on extracellular vesicle recovery in a skeletal muscle model | |
| CN113699158B (en) | Nucleic acid aptamer of aristolochic acid A as well as screening method and application thereof | |
| CN102321764A (en) | New method used for quantitatively analyzing antisense oligonucleotide in biological sample | |
| CN106929576B (en) | A kind of PML/RARA fusions quick detection probe of low cost and its preparation method and application | |
| CN113549626B (en) | Aptamer Pr-A08 specifically bound with procymidone and application thereof | |
| CN110408620B (en) | Nucleic acid aptamer, obtaining method thereof, derivative thereof and application thereof | |
| CN105986020A (en) | Method and device for constructing sequencing library | |
| Chen et al. | DNA fragment‐assisted microfluidic chip for capture and release of circulating tumor cells | |
| Zeng et al. | Screening ssDNA aptamers against HIV P24 antigen using agarose beads as carriers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |