CN106170560A - Gene order-checking method of future generation - Google Patents

Abstract

The invention discloses enhancing for being checked order by quasiconductor, preferably ion torrent check order quickly and cost-effectively analyze microorganism sequence method.Described method provides the total length analysis in multiple regions (such as gene) of multiple genomes.These methods are identified and are caused giving antibiotic or the gene mutation of the specific gene of the resistance of other compound or sensitivity.Multiple variety classeses, bacterial strain and/or the serotype of specific organism is the most identified by quickly and to effectively examination and the complete genome group in company with organism of suddenling change.By selecting to produce similar size and the primer pair of G/C content of the amplicon with the sequence crossing over whole genome, reacted the sequence that can measure complete genome group by the single PCR of ion torrent Methodological Analysis.Described method can be used for the genome of order-checking viral material such as influenza virus and bacterial components such as tuberculosis antibacterial.

Description

Gene order-checking method of future generation

Sequence table

The application comprises and submits to and therefore by quoting with its overall sequence combined with ASCII fromat via EFS-Web Table.Described ASCII copy is created on May 7th, 2013, named 3022.019.PCT_SL.txt, and size is 37,821 words Joint.

Background of invention

1. invention field

The present invention relates to for identifying gene mutation and the instrument of information nucleic acid, compositions and the method for megabasse by order-checking, Further, especially, relate to by sequencing analysis sequence, gene and the electronic media of complete genome group and program, and relate to And the sudden change identified and comprise the test kit of reagent for identifying the sudden change in biological sample.

2. background describes

Morbid substance mycobacterium tuberculosis lungy (Mycobacterium tuberculosis) (MTB) be that a kind of height passes The bacterial pathogens of metachromia, has significant M & M, particularly in HIV patient.Since 1997 Tuberculosis is always main causes of death in South Africa, for the statistic of association popular with the HIV that this country gradually increases.This Outward, increasing multi-drug resistance (MDR) and extensive drug-resistance (XDR) clinical isolates (clinical isolates) case Example makes the effective remedy measures in the patient of active MTB deteriorate.

Many scarcity of resources regions popular for both MTB and HIV in the world, microscopy is still that for diagnosing MTB Foundation stone.But, it is smear negative that many has the HIV patient of MTB, and microscopy does not provide and resists about antibiotic The information of property.The appearance of multiple medicines-resistance (MDR) and extensive drug-resistance bacterial strain (XDR) causes standard MTB therapeutic scheme to become Invalid.According to a research, in South Africa, the TB patient with HIV of about 20% has MDR MTB.Quickly detection MTB and beginning Effectively treatment is propagated and to improve therapeutic outcome most important reducing.The release of Cephiad ' s Gene Xpert (Xpert) (roll-out) improve the diagnosis of MTB and provide the evidence of rifampicin resistance, but not having to provide the letter about other medicines Breath.It is probably infeasible additionally, place Xpert inspection in many microscopy laboratorys of scarcity of resources environment.Effectively Sputum sample is originally transported to center and is used for the ability of order-checking (NGS) of future generation and provides and utilize center or the training of local laboratory by ground The staff being always or usually as specified and the chance of available infrastructure.

MDR tuberculosis bacterial strain tolerates a line rifamycin antibiotic flat (RIF) and isoniazid (INH), and XDR MTB bacterial strain tolerates Both RIF and INH and any fluoroquinolone and (such as, amikacin, kanamycin or the curling of two wires injectable antibiotic drug Mycin).About the 6% of all MTB cases is the XDR case that greater percentage is the most persistently reported in MDR bacterial strain and South Africa.When 7% The patient of infection standard MTB bacterial strain when yielding to infect, MDR mortality rate lungy rises to almost 50%.Antibiotic resistance The appearance of MTB bacterial strain highlights the quick and instant demand of high accuracy diagnosis, particularly in the developing country in Africa.Separately External migration population makes the geographical supervision of drug resistant strain and follows the trail of more urgent.

MDR bacterial strain is thought that based on drug sensitivity inspection (DST) cultivated be goldstandard, but it is time-consuming, and (several weeks are extremely Several months), the most challenging and with high costs, particularly in the country of resource-constrained.Such as, BACTEC MGIT 960 (Becton Dickinson Microbiology System, Silver Sparks NV, USA) are for measuring antibacterial oxygen Consume automatization's continuous print based on cultivate monitoring system, the test kit of preparation can be used to carry out DST, described test kit for The sensitivity of many antibiotic can be used by bacterial strain.With BACTEC MGIT 960 obtain DST reliable results and reproducible but need Process vibrant and potential communicable culture, a couple of days to several weeks or extension until result can use, special laboratory equlpment And the high cost relevant to instrument and consumable goods.

In recent years, some mensuration based on nucleic acid for detecting MTB drug resistance is developed.One most popular commercially available Available diagnostic assay is the GenoType MTBDR of Hain LifeScienceplus Line Probe Assay (LPA)。 This inspection utilizes nucleic acid extraction, PCR amplification, probe to hybridize and via alkaline phosphatase enzyme reaction colourimetric development on Cross slat (colorimetric visualization).Have shown that LPA is sensitive and special, but there is several shortcoming.LPA is to institute The sensitivity having resistance-related mutation most possibly will not reach 100% forever because many genes giving resistance not yet by Find.Another inherent limitations of LPA is the sample group that can not detect the mixture comprising resistance and susceptible strain.Can't detect Containing being non-existent LPA on previous do not characterized or the bacterial strain of replacement mutation of sudden change of the unknown by amino acid change.This Outward, LPA only allows to detect the most frequent sudden change causing resistance.If bacterial strain comprises the sudden change outside target mutation, it will open country occurs Raw type banding pattern, causes false negative (susceptible) result.

Accordingly, there exist for key gene, the such as full-length gene of relevant to a line and Second line Drug resistance gene Quick, the standardization analyzed, the demand of cost-effective scheme.

Summary of the invention

Instant invention overcomes current strategies and the relevant shortcoming of design, and thus provide to promote and simplify check order instrument, Compositions, method and for analyzing the method for sequence information of nucleic acid, described nucleic acid includes full-length gene and complete genome group.

One embodiment of the invention relates to by quasiconductor order-checking with preferably, and ion torrent sequencing analysis medicine resists Property sudden change.Comprised the nucleic acid segment of genes of interest by PCR amplification, process amplified production and pass through sequencing analysis subsequently.For Comprise the nucleic acid segment of RNA, be DNA by RNA reverse transcription.Order-checking is preferably by Ion Torrent, or includes Ion Torrent Personal Genome Machine (PGM™;Life Technologies) sequenator of future generation carry out.Preferably, Amplified production represents the common full-length gene of the numerous species of organism, bacterial strain and/or serotype, or multiple overlapping genes Section.Amplified production is checked order and identifies and positional mutation.Location is identified known and not previously known both sudden changes and can be used for Progress and the movement of drug resistance is followed the trail of across population.Preferably, the present invention analyzes pathogen, such as, and virus, antibacterial or parasite Nucleic acid.The most described viral pathogen is influenza or the morbid substance of HIV and bacterial pathogens is causative agent lungy Matter.The ion torrent order-checking of nucleic acid segment provides the survey strengthened for quick, effective, cost-effective full-length gene analytical plan Sequence.Drug resistance and the instant mensuration of other sudden change.

Another embodiment of the invention relates to carry out the NGS order-checking of gene or complete genome group, preferred ion Torrent or instrument, compositions and the method for MiSeq order-checking.The present invention includes DNA sequence and the use obtaining purpose organism Multipair nucleic acid primer carries out polymerase chain reaction analysis.Every pair of primer is designed under the conditions of similar PCR expand base simultaneously Because of the overlap section of group and these can carry out as sequencing reaction or multiple genes or whole genome are multiplexed (multiplex).Preferably primer has similar G/C content and overall dimension.The single PCR amplification of genome produces hundreds of Planting amplified production, its sequence includes the full-length gene of organism, big gene and non-coding section or whole genome.Preferably pass through NGS analyzes these products, the matched sequence map setting up whole gene or genome of sequence.

Another embodiment of the invention relates to identifying in the genome of microorganism and gives the anti-of combating microorganisms compound Property the method for sequence motifs, including: multiple nucleic acid samples that multiple different strains or serotype from microorganism obtain are provided； Sequence by the multiple nucleic acid samples of PCR amplification；The sequence being obtained institute's extension increasing sequence by the order-checking of ion torrent is believed Breath；The polymorphism the genome of at least one microbial strains or serotype is identified from the sequence information obtained；With associate mirror Fixed polymorphism and at least one microbial strains or the phenotype of serotype or genome location give combating microorganisms to identify The sequence motifs of the resistance of compound.Preferably, described microorganism is virus, antibacterial, fungus or parasite, and described virus For influenza virus, antibacterial is mycobacterium tuberculosis.Preferably, nucleic acid samples is comprising chaotropic agent, detergent, reducing agent, chelating Agent, buffer agent and alcohol, together be enough to cell lysis, Denatured protein, inactivation nuclease, kill pathogen and non-degradable nucleic acid The aqueous molecular transport medium that amount exists provides.Preferably, amplification uses amplification and antagonism in one-step polymerization enzyme chain reaction Gene that the resistance of microbial compounds is relevant or the primer of nucleic acid segment to carrying out, and polymerase chain reaction comprise following Aqueous mixture in implement: heat-stabilised poly synthase, comprise deoxynucleoside three phosphorus of about equivalent dATP, dCTP, dGTP and dTTP Acid blend, chelating agen, osmotic pressure agent, albumin, magnesium salt；And buffer agent.The most described Antimicrobe compound is antibiotic.

Another embodiment of the invention is related to the Antimicrobe compound treatment identified by the inventive method The disease caused by least one microbial strains or serotype or the method for disease.Preferably, treatment include targeting kill into The special pathogen of the morbid substance of disease or disease.It is also preferable that effective dose by assessment with identify target sequence or The phenotypic characteristic that sequences are relevant determines from the inventive method.

Another embodiment of the invention relates to the method measuring the complete genomic sequence of microorganism, including: A series of amplification is produced by carrying out the single polymerase chain reaction (PCR) of genome in comprising following aqueous mixture Son: heat-stabilised poly synthase；Comprise the deoxynucleoside triphosphate mixture of about equivalent dATP, dCTP, dGTP and dTTP；Chelating agen； Salt；Buffer agent；Stabilizer and multiple primer pair, each primer of wherein said multiple primers pair has similar annealing temperature； Each by quasiconductor order-checking order-checking produced series amplicon, and the sequence of association amplicon and build genome Complete sequence.Preferably, each primer of multiple primers pair includes 15-25 nucleic acid length and each has about 25%-50%'s The primer of G/C content.Preferably, each primer expands amplicon, and the set of the amplicon of PCR amplification to being designed to PCR Comprise the overlap section of complete genomic sequence.Preferably, multiple primers pair and genomic hybridization, and with about every 500-2, 000 nucleotide is spaced apart along genome.Preferably, described microorganism is virus, antibacterial, fungus, parasite or cell, and institute Stating virus is influenza virus, and antibacterial is mycobacterium tuberculosis.

Another embodiment of the invention relates to the method that the sequence of nucleic acid segment is determined in a pacing, including: at core Carrying out polymerase chain reaction to produce a series of amplicons on acid section, wherein PCR comprises containing following thermostable composite: Polymerase；Comprise the deoxynucleoside triphosphate mixture of about equivalent dATP, dCTP, dGTP and dTTP；Chelating agen；Salt；Buffer agent； Stabilizer and multiple primer pair, each primer of wherein said multiple primers pair has 5 DEG C of interior annealing temperatures；Pass through quasiconductor Produced by order-checking order-checking, series amplicon is each, with the sequence associating amplicon the sequence building nucleic acid segment.Preferably Described nucleic acid segment is 1 Mb length or bigger, more preferably greater than 2 or more Mb length, more preferably 5 or more Mb length and more preferably 10 or more Mb length.Preferably, each primer of multiple primers pair is that 16-24 nucleotide is long, and the GC with about 28-35% contains Amount, and there are 3 DEG C of interior annealing temperatures of other primer each.Preferably, each primer represents being designed to PCR amplification The amplicon of a part for nucleic acid segment sequence, and the set of amplicon of PCR amplification represents the complete sequence of described section Lap.Preferably, multiple primers are to about 800-1, and the interval of 200 nucleotide length hybridizes with described section.

Another embodiment of the invention relates to the mixture comprising multipair nucleic acid primer, wherein, when making this set warp When being subject to the polymerase chain reaction relevant to nucleic acid segment, primer produces the set of amplicon, each of which amplicon to gathering Being about 500-2,000 nucleotide is long, so that illustrating the whole sequence of described section in the amplicon set of gained.Preferably Ground, to be about 15-25 nucleotide long to each primer of set for primer, has a G/C content of about 25-45%, and each other 3 DEG C of interior annealing temperatures of primer, and primer comprises genomic hybridization with same microorganism to each primer of set Sequence.Preferably, described microorganism is virus, antibacterial, parasite or fungus.Preferably, described mixture comprises heat-stabilised poly Synthase, containing about equivalent dATP, the deoxynucleoside triphosphate mixture of dCTP, dGTP and dTTP, chelating agen, salt, buffer agent, steady Determine agent and nuclease free water.

Another embodiment of the invention includes the test kit comprising reagent container, and described reagent container preferably comprises use One or more chemical reagent, primer and polymerase in order-checking.The sample being analysed to be enough to kill sample with preferably comprising Present in nuclease in all pathogen, inactivated samples and maintain nucleic acid integrity to cause sample for transhipment and follow-up behaviour Make the chemical constituent of safety, such as, aqueous cracking buffer agent, aqueous or without Spinal Cord Oedema medium or aqueous PrimeStore The reagent container mixing of Molecular Transport Medium.Mixture can be the most miniature in conjunction with (combine) at post To help from sample extraction nucleic acid in centrifugal column, described post can be included in test kit.Extract nucleic acid preferably with facilitate nucleic acid Check the another kind of chemical agent combination thing such as PrimeMix combination that such as PCR checks order.Such reagent composition can wrap Containing positive control sequence, negative control sequence and/or with pathogen exist specific particular target sequence (the phase need high or low Under Stringent hybridization conditions) sequence of specific hybrid.

Another embodiment of the invention relates to realizing the present invention and analyzes the computer-readable medium of method.Preferably meter The sequence information of calculation machine computer-readable recording medium analysis acquisition and the set of the information of concentration.Further preferably by sequence information with from same or similar The sequence information that one or more given data storehouses of the sequence information of sequence obtain relatively and is accredited as microorganism offer antibiosis Element resistance and the sudden change of other phenotypic characteristic.

Other embodiments of the present invention and advantage are listed in description part subsequently, and in part, can be from this description It is clear that or can be from the learning by doing of the present invention.

Accompanying drawing is sketched

Fig. 1 illustrate pncA gene order add 100 flanking bases to and reverse complementary sequence (reverse compliment Sequence), protein sequence and primer sequence.

Fig. 2 illustrates nucleotide sequence and the sequence of TB 16S ribosomal RNA gene sequencing primer of H37RV gene bacterial strain Row.

Fig. 3 illustrates to give the rpoB gene of the sensitivity/resistance to rifampicin and the forward of rpoB and reverse primer sequence Row.

Fig. 4 illustrates mycobacterium tuberculosis H37Ra, complete genome group (GenBank:CP000611.1) GyrA gene with And three groups of forwards and reverse primer.

Fig. 5 mycobacterium tuberculosis H37Ra, complete genome group (GenBank:CP000611.1) catalase-peroxide Compound enzyme-peroxynitrite enzyme (peroxynitritase) T katG and three groups of forwards and reverse primer.

Fig. 6 illustrates the cycle threshold that gyrase A and IS 6110 measures.

Fig. 7 explanation uses the rotation of sequence separator (sequence islates) by number of cycles relative to Ct value Enzyme A measures and IS 6110 measures.

Fig. 8 explanation uses the gyrase A of sequence separator to measure relative to cycle threshold (ct) and IS 6110 measures.

Fig. 9 uses multiple primer that collection share acquirement in ion torrent sequence measurement order-checking influenza A genome Result summary.

Figure 10 is for the sign of the primer pair of the full-length genome ion torrent order-checking of influenza A (H3N2).

The gene order of Figure 11 (A) pncA, coding region is shown as shade, and (B) PCR tiling by described sequence The pncA forward used in (PCR tiling) and reverse primer and pncA region P1-P4.

The architecture of the electronic system of Figure 12 the inventive method.

Invention describes

For numerous disease and the successful treatment of disease, the quickly analysis of drug resistant strain related gene is one and mainly chooses War.Newly occur the real-time geographic supervision of MTB drug resistance will promote more appropriate therapeutic strategy (such as, medicine, antibiotic, Chemicals).Currently, available molecular method such as GenoType MTBDRplusLPA provides limited power of test, special It not when novel/uncommon amino acid replacement is in known drug resistance region or when undiscovered amino acid mutation shadow When ringing drug resistance.Equally, current methodology needs (including ion torrent scheme) expense of multistep, auxiliary equipment and increase With, and be labor-intensive.

Have now surprisingly found that the quasiconductor order-checking scheme for the quickly simplification of sign full-length gene and genome. The present invention includes the standard scheme for gene sequencing, preferably by quasiconductor order-checking the ion torrent of preferred full-length gene Order-checking.Described scheme makes it possible to realize the order-checking of whole coding region, it is allowed to characterizes known mutations and finds new polymorphism. The program also allows for the megabasse nucleotide information that checks order, so that can measuring the complete genome group of cell and organism and holding Change places and position and identify genetic polymorphism.The most described cell and organism are diseases induced protokaryon or eukaryotic cell, or Yeast or fungal cell.The most diseases induced organism includes parasite and fungus, virus, bacterial species.Exemplary Organism includes, but not limited to DNA viruses, RNA viruses, plus or minus single-stranded viral, double-stranded viruses, influenza virus, secondary viscous disease Poison, Measles virus (such as, measles), retrovirus, banzi virus, filamentous form virus, slow virus, Hantaan virus, herpesvirus (example As, VZV, HSV I, HSV II, EBV), hepatitis virus (such as, A, B, C, non-A, non-B), influenza virus (such as, H5N1, H1N1, H7N9), respiratory syncytial virus, HIV or Ebola virus.Exemplary organism also includes but not limited to branch bar Bacterium (such as, mycobacterium tuberculosis (M. tuberculosis)), Bacillus anthracis (Bacillus anthracis), malaria former Eimeria (such as, Plasmodium falciparum (Plasmodium falciparum)), schistosomicide (such as, Schistosoma mansoni (Schistosoma mansoni)), soil draw hot Francisella (Francisella tularensis), clostridium difficile (Clostridium difficile), meningococcal infection, pseudomonas infection, Yersinia pestis (Yersinia pestis) and vibrio cholera (Vibrio cholerae).The invention still further relates to detect with characterize relevant to pathogenic organism but The organism of avirulence.It is non-existent finally that one or more avirulences but the detection of relevant organism can become disease Diagnosis.It addition, the tool and method of the present invention allows the exception identified and characterize in individual odc gene group, such as may be from Birth (geneogenous) that exist for and may be heritable patient's condition.These inherited disorder tool and method by the present invention The most detectable and can characterize and can be by individual (non-afflicted individual) with other non-diseased Normal or crt gene group compare diagnosis.

This is relatively quick (such as, 1,2 or 3 days, or shorter), standardized, cost-effective scheme allows gene Total length is analyzed, such as, to identify the sudden change of one or more changes with DNA, RNA, protein and/or peptide sequence.For For the sample sequence of RNA, it is generally that DNA is used for pcr analysis by the purpose RNA sequence reverse transcription in sample.Preferably identify and table That levies provides the gene mutation to the resistance of antibiotic for one or more for microorganism.With the inventive method identify the most prominent Conjugate one or more sites, transcripting promoter or termination site, termination or the start codon in amino acid encoding region, non- Site, splice site, decorating site in coding region, transcribe or translation factor combines or recognition site, facilitates three dimensional structure One or more sites, or a combination thereof.The preferred gene analyzed includes the MTB relevant with a line and two wires MTB drug resistance Gene (sees Fig. 1-5).The preferred embodiment of MTB-related gene includes, such as, rpoB (rifampicin), katG and inhA are (different Cigarette hydrazine), gyrA and gyrB (fluoroquinolone), pncA and panD (PZA or pyrazinamide) and rrs (16s) (aminoglycoside Class, amikacin, kanamycin, capreomycin, streptomycin) and rspL (streptomycin).

Use the inventive method Ion Torrent Personal Genome Machine (PGM) assessment of future generation 26 the clinical isolates the most different collected in South Africa, including MDR and XDR bacterial strain.It is of special interest for INDELS, It is insertion or the disappearance of the mononucleotide (A, T, G, C) causing the missense in protein structure to change.By from the method for this exploitation Learn the sequencing data obtained to compare with from the HAIN LPA cultivated and gene type DST data.The party's science of law makes for the first time Can check order the whole coding of the gene realizing resistance and noncoding region, it is allowed to characterize known mutations and find new polymorphic Property.?rrs、 rpoB、 katG、 pncA、gyrAPreviously do not characterized with identifying on gyr B, katG, inhA and panD gene Replacement mutation.

The present invention is novel order-checking platform, and such as, instrument of future generation is in scarcity of resources environment such as Africa, Asia and India Middle provided significant potentiality by more utilizations.Specifically, present invention improves and simplifies (up-front) experiment in advance Room preparation process.The methodology of the present invention need not the (typically using manufacturer generally to use or need Utilized or required by the manufacturer) expensive auxiliary piece of equipment.Specifically, the standard of the present invention Change program need not for Agilient Bioanalyzer quantitative for DNA, for the OneTouch ePCR of emulsifying PCR step System, or the PipinPrep for gel excision.Further, since the solution of the present invention relates to entirely-encoding gene (it is necessarily Full-length genome) sequence of resurveying, it is not necessary to DNA is cut into less fragment by Bioruptor.The whole base in addition, it is not necessary that check order Because then group identifies gene.The inventive method and instrument allow to be checked order genes of interest and/or region are pre-selected.Due to Agilent 2100 BioAnalyzer, OneTouch, PipinPrep and Bioruptor are required to extra use training, disappear Consume valuable laboratory table space, and extremely expensive, and the present invention represents marked improvement and the improvement exceeding conventional methodologies.

The order-checking scheme ion used herein torrent order-checking of the present invention illustrates, because this sequence measurement has been applied to Mycobacterium tuberculosis.As thinking the most clearly, described scheme relates to quasiconductor order-checking, and it passes through The order-checking of ion torrent illustrate and, equally, check order while relating to many zoness of different.Described order-checking and nuclei aoid methods can be answered Gene, genome or nucleotide sequence for any series.

Present invention additionally comprises the methodology for selecting the primer pair of target for sequencing purposes.Primer is to preferably with coupling Annealing and melting temperature to target select.Preferably, melt and annealing temperature G/C content based on sequence signature such as sequence, draw Thing is from the probability of hybridization (such as, form the hairpin loop in primer), and the possible structure near binding site.Preferably described Primer is not hybridization certainly under the conditions of order-checking.The preferably G/C content of primer is about 25%-50%, more preferably from about 30%-40%, more preferably from about 25%-35%, and also more preferably from about 40%-50%.Therefore, the primer sequence of target is selected to be used for hybridizing based on sequence signature so that All primers melting to target to will have like that target utilizes and/or annealing temperature.Preferably primer sequence does not comprise primer Sequence according to reason may be from the region of hybridization.The preferably annealing of primer pair and/or dissociation temperature coupling, described temperature can in 5 DEG C, In 4 DEG C, in 3 DEG C, in 2 DEG C, in 1 DEG C and more preferably annealing temperature is identical, melting temperature is identical or the two.Primer is to preferably producing The about 500-about 2 of the raw overlap section representing target, the amplicon that 000 nucleotide (NT) is long, more preferably from about 600-1,500 NT, more Preferably from about 700-1,300 NT, more preferably from about 800-1,200 NT, more preferably from about 900-1,100 NT and more preferably from about 1,000 NT.Primer is usually 12 NT-45 NT length, more preferably 15-35 NT, and more preferably from about 18-25 NT.Although not being rule, General longer primer has relatively low G/C content.For pncA gene (seeing Fig. 1), H37RV gene groups (seeing Fig. 2), RpoB gene (seeing Fig. 3), GyrA gene (seeing Fig. 4) and katG gene (seeing Fig. 5) identify exemplary primer pair.This A little primers are to can be used for combining to simplify in instant test kit the order-checking of full-length gene.

In one embodiment of the invention, it is determined that for measuring the tuberculosis branch of MDR and XDR bacterial strain drug resistance The quasiconductor order-checking scheme (such as, each separator accumulation order-checking 11.4 kb) of five genes of bacillus.Mycobacterium tuberculosisrpoB1,178 amino acid whose β subunits of gene code RNA dependent dna-polymerases.rpoBIn the 81-bp " core space " of gene Sudden change responsible to the rifampicin resistance of about 95% in M. tuberculosis strains.These sudden change in 516 (D → V), The great majority sudden change in three these regions of composition at 526 (H → Y/D) and 531 (S → L) position.21 profits that this research characterizes In Fu Ping-resistant strain, 11 (52.4%) carryrpoBThe S531L sudden change of gene, 7 (33.3%) existrpoBThe 516 of gene Position comprises amino acid replacement, and 3 (14.3%) existrpoB526 of gene comprise sudden change (table 1).At 516 streams observed The rpoB of row is replaced into valine (D516V).6 that the ion torrent order-checking of the present invention discloses in 7 bacterial strains are wrapped in this position Containing rare glycine residue (D516G) (table 1).These 6 bacterial strains are shown as mutant and wild-type band both by LPA There is not (table 1).?rpoB526 of gene identify a uncommon amino acid replacement similarly.?rpoBGene The most popular amino acid replacement of 526 reports is that histidine is to tyrosine or aspartic acid (H526Y/D).Ion torrent check order Showing that 1 in 3 separators comprises a uncommon arginine (R) residue (H526R), it is shown as by HAIN LPA There is not (table 1) in wild type and mutant band both.Although not depositing according to wild type in LPA sample survey and mutant band It is being interpreted resistance, but is still suffering from ambiguity, because the type of aminoacid change the most directly characterizes.This address ion torrent The effectiveness of the discovery of novel amino in MTB bacterial strain in order-checking antagonism supervision and propagation.

Table 1

Checked order by ion torrent, Hain LPA gene type and cultivating is inferred from South Africa 26 (14 MDR, 7 XDR and 5 complete susceptible) initial 900 amino acid residues of the ropB gene of mycobacterium tuberculosis separator^*In 10 ammonia The summary of base acid mutation

katGGene code catalase peroxidase, a kind of enzyme that isoniazid (INH) is converted into activity form.Mostly Number isoniazid resistances withkatGCodon 315 (S315T) is relevant, althoughinhAWithnodSudden change in promoter region also causes Resistance.In 26 bacterial strains of assessment, 16 (62%) comprises typical serine at 315 and replaces to threonine amino acid (S315T), it gives isoniazid resistance (table 2).These sequencing results show and use HAIN LPA and cultivate the ratio that DST makes The concordance of relatively 100%.

Table 2

Checked order by ion torrent, Hain LPA gene type and cultivating is inferred from South Africa 26 (14 MDR, 7 XDR and 5 complete susceptible) summary of 4 amino acid mutations in the katG gene of mycobacterium tuberculosis separator

Pyrazinamide (PZA) is the nicotinamide derivates of synthesis, and it has been utilized as first-line drug since nineteen fifty-two and resists knot Core is sick.Standard DST for PZA is complicated, needs acid pH because external, and its suppression M. tuberculosis growth also makes standard True phenotypic assessment complicates.PZA resistance is owing to coding pyrazinamidasepncASudden change in gene.These give resistance Sudden change Numerous, and include amino acid replacement, frameshit and termination codon sudden change.26 South Africa separator tables from assessment 7 sudden changes are levied, including 1 silent mutation, 5 amino acid replacements and 1 chain terminating mutation.A separator is observed Q122 (termination) stop mutation (table 3) be new, other places were the most once reported.The difficulty of PZA phenotypic assessment and edgepncABase The variability of the sudden change of cause highlights ion torrent gene sequencing further and assesses this hypervariable (hyper variable) MTB base The surcharge of the sudden change in Yin.

Table 3

Checked order by ion torrent and cultivate 26 (14 MDR, 7 XDR and 5 are complete susceptible) from South Africa of deduction The summary of 6 amino acid mutations in the pncA gene of mycobacterium tuberculosis

The fluoroquinolone (FQ) main target in mycobacterium tuberculosis is DNA gyrase, bygyrAWithgyrBGene is separately encoded The II type topoisomerase of two A and B subunits composition.It is positioned at the gyrA gene of referred to as quinolone resistant-decision district (QRDR) Short region in amino acid replacement account for the great majority of known FQ resistance tuberculosis bacterial strain.The displacement of 88,90 and 94 in QRDR Sudden change is observed (table 4) in 10 (38.5%) of these 26 sequences studied.In these 10 bacterial strains 3 existgyrAGene 94 comprise displacement；Two are recorded as D94G displacement, replace for D94Y for 1.D94G and D94Y both is as permutation table Levy and two kinds of amino acid replacements of codon 94 cause the FQ antibiotic resistance of similar level.In the bacterial strain of assessment,gyrABase Because of the most variable, in 26 clinical isolates of assessment, comprise 9 amino acid replacements.Additionally, thesegyrAIn codon two Individual (549 and 613) show heterogeneous residue (table 4), and this is the advantage carrying out the order-checking of ion torrent more than HAIN LPA and DST.

Table 4

Checked order by ion torrent and cultivate 26 (14 MDR, 7 XDR and 5 are complete susceptible) from South Africa of deduction The summary of 10 amino acid mutations in the gyrA gene of mycobacterium tuberculosis separator

It is defined as having obtained extra to FQ, i.e. ofloxacin, and three kinds of injectables " Second line Drug ", i.e. amikacin (AMK), the emerging XDR knot of the MDR case of the resistance of at least one in kanamycin (KAN) or capreomycin (CAP) Core medical record example has become as the public health threat of whole world developing country.Most of resistances to Second line Drug and 16 S cores Sugar body RNArrsSudden change in the codon 1401 (A1401G) of gene, 1402 (C1402T) and 1484 (G1483T) has Close.7 (27%) analyzing Africa MTB bacterial strain in display 26 are defined as XDR, such as the coding mutation of 1401 (A1401G) (table 4) proved.Extra be also found that 492,514 and 878 in the bacterial strain of this analysis three Coding mutation (table 5).G878A is new coding mutation but shows AMK, KAN and CAP sensitive according to DST.

Table 5

Checked order by ion torrent and cultivate 26 (14 MDR, 7 XDR and 5 are complete susceptible) from South Africa of deduction The summary of 4 coding mutations in rrs (16s) gene of mycobacterium tuberculosis separator

Previous research showskatGCodon 463 HegyrASporting strain classification in codon 95 is that epidemiology is lost Pass group 1,2 and 3 genetic marker, and these codons to antibiotic resistance without effect.Group's 1 bacterial strain is group 2 and group 3 bacterial strain Genetic ancestry, its dominant non-human Mycobacterium of connection (mycobacterium microti (M. microti) and Mycobacterium bovis (M. bovis) bacterial strain) and people's mycobacterium africanum (M. africanum) and mycobacterium tuberculosis pedigree.Such as katG codon Replacement mutation in 463 and gyrA codons 95 is proved, 7 in 26 altogether of the African separator that the present invention characterizes (27%), 1 (4%) in 18 (69%) and 26 in 26 is respectively the member of heredity group 1,2 and 3.Follow the trail of group 1 organism pair The most important in MTB detection, because the several separators belonging to heredity group 1 lack insertion sequence 1661 (IS-1661), it is The universal genetic target of the MTB detection assay of several PCR-baseds.

Ion torrent scheme for MTB drug resistance can be readily integrated into throughout countries and regions, such as Africa, print In the scarcity of resources environment of degree and China.Ion torrent methodology need not the ion using expensive auxiliary equipment the most current Pippin Prep Workstation or Agilent 2100 BioAnalyzer, DiaGenode that torrent scheme is recommended Bioruptor Sonication System, Ion OneTouch System, supercentrifuge.This has important meaning Justice, because these instruments and required accessory and consumable goods can be expensive, needs great many of experiments room footprint (footprints) routine maintenance, and is usually needed.

With GenoType MTBDRplusOr MTBDRsl Line Probe Assay (LPA) is contrary, ion torrent PGM scheme provides the total length of gene to characterize so that it may be found that the new amino acid replacement that can be missed by LPA potentially, because LPA is only limitted to known sudden change.Use the program, in clinical field separator, be found that some uncommon aminoacid Change.Additionally, the wide degree of depth of ion torrent sequential covering allows the heterogeneous or bacterial strain heredity group of mixing finding in separator.

The scalability of ion torrent order-checking allows extension with the Additional genes comprising megabasse on a single chip.This Bright methodology is expansible to be currently comprised all the 16 of MTB drug resistance more than 5 total length MTB genes add (16 to comprise Plus) gene.Use ion torrent PGM full-length gene analysis will identify new mutation, when with phenotype minimal inhibitory concentration (MIC) During inspection association, it identifies new tuberculosis resistance residue and the cumulative inhibition of multiple sudden change.

Another embodiment of the invention relates to the use of the megabase sequences of quasiconductor order-checking scheme and identifies.The present invention's Megabasse order-checking relates to the primer pair selecting the different sections of amplification target sequence, and the set of section represents the complete of target sequence whereby Portion.The most described section overlap reaches to allow comparison gained amplicon and form the degree of complete target sequence.Primer is to preferably setting It is calculated as formation and there is about 0.5 k-about 5 k nucleotide, preferably from about 0.6 k-about 3 k nucleotide, most preferably from about 0.7 k-about 2 k core The amplicon of the length of thuja acid and more preferably from about 0.8 k-about 1 k nucleotide.Primer is to preferred G/C content (GC contact) Similar, so that annealing or hybridization temperature is similar or preferably in about 5 DEG C, more preferably in about 2 DEG C, and more preferably at about 1 DEG C In.Further preferably hybridization dissociation temperature is similar, sends out so that annealing and dissociate for polymerization and PCR in closely similar temperature Raw.In annealing and dissociating, the effect length temperature profile of primer, the most all or at least most of primer length phase Seemingly.Preferably from about 15-30 nucleotide of primer length, more preferably from about 20-28 nucleotide, and more preferably from about 18-25 nucleoside Acid.Although preferably all of primer has such similar features, megabasse order-checking can share one at the primer of greater than about 80% Or multiple feature, more preferably 85% or more, more preferably 90% or more, implement when even more preferably 95% or more.Primer is to can Combine (assemble) in test kit to facilitate total length to check order.Targeting amplification target sequence is added to the nucleic acid obtained from sample Primer.According to the use of these similar primers, carry out PCR with a target nucleic acid to be amplified and the mixture of all primers pair anti- Should.On identical mixture, further preferably carry out double pcr analysis.Number of cycles can be 10-50 or more and, preferably Temperature cycles is carried out according to Standard PCR temperature and reaction condition.

Another embodiment of the invention relate to identified by the inventive method Antimicrobe compound treatment by Disease that at least one microbial strains or serotype cause or the method for disease.Preferably, treatment includes that targeting kills as disease The special pathogen of the morbid substance of disease or disease.Further preferably by target sequence or the relevant phenotype of sequences of assessment and qualification Feature determines effective dose from the inventive method, thus susceptible dose in selecting known or inspection is for treating.Preferably, treatment Effective dose can be determined from the order-checking information obtained by sequence measurement of the present invention.For example, as it is known that some sequence, if through surveying Fixed existence, causes some phenotypic characteristic, such as, the resistance processing some antibiotic or other treatment or sensitivity.These sequences The presence or absence of row, and the amount that sequence exists, it is possible to provide effectively treatment and the treatment effective dose for treatment Instruction and guidance.

Another embodiment of the invention includes the test kit comprising reagent container, and described reagent container preferably comprises use One or more chemical reagent, primer and polymerase in order-checking.The sample being analysed to be enough to kill sample with preferably comprising Present in nuclease in all pathogen, inactivated samples and maintain nucleic acid integrity to cause sample for transhipment and follow-up behaviour Make the chemical constituent of safety, such as, aqueous cracking buffer agent, aqueous or without Spinal Cord Oedema medium or aqueous PrimeStore Molecular Transport Medium (retouches in U.S. Patent number 8,084,443,8,080,645 and 8,097,419 Stating, all these patents are explicitly by quoting combination) reagent container mixing.Mixture can be at post, such as centrifugal mini column chromatography Middle combination is to help from sample extraction nucleic acid, and described post can be included in test kit.The nucleic acid extracted preferably is examined with facilitating nucleic acid Test the another kind of chemical agent combination thing such as PrimeMix (title also submitted to of such as PCR order-checking on April 25th, 2011 For " for detecting, identifying and the quantitatively compositions of mycobacteria-specific nucleic acid and method " US Patent Publication Number 2011/ Entitled " the compositions of the nucleotide sequence for detecting and identify in biological sample submitted on April 26th, 0281754 and 2012 And method " international application publication number WO2012/149188 described in, the two is specific binding by quoting) combination.Such Reagent composition can comprise positive control sequence, negative control sequence and/or there is specific particular target sequence with pathogen The sequence of (under the high or low Stringent hybridization conditions that the phase needs) specific hybrid.

Another embodiment of the invention relates to computer-readable programming (seeing Figure 12) realizing the inventive method.Excellent Described computer-readable medium is selected to include providing for the form comprising both the specificity about each sample and general information. This information can easily collect neutralization and store.One exemplary electronic system of the inventive method includes at least one general service Calculating device 100, it includes processing unit (CPU) 120 and will include system storage such as read only memory (ROM) 140 and random access storage device (RAM) 150 connect (couple) to the system of processing unit 120 at interior multiple system components Bus 110.Preferably, it be also possible to use extra system storage.Described electronic method can have more than one CPU's 120 Calculate on device or network link together calculate device group or bunch on operate to provide bigger disposal ability.System is total Line 110 can be any in several types of bus structure, including use various bus architecture any storage bus or Storage control, peripheral bus and local bus.The basic input/output (BIOS) stored in ROM 140 grade can provide help The basic routine of transinformation between element in calculating device 100, such as during starting.Calculate device 100 to enter One step includes storing device such as hard drive 160, disk drive, disc drives, magnetic tape drive etc..Storage device 160 passes through Interface is driven to be connected with system bus 110.Drive and relevant computer-readable medium provides computer-readable instruction, data knot Structure, program module and for calculating the nonvolatile storage of other data of device 100.Infrastructure component is those skilled in the art Whether known and type according to device, such as device are little handheld computing devices, desk computer, computer clothes Business device, portable scanning means or wireless device include wireless personal digital assistant (" PDAs "), board device, have wireless network Network function or " intelligent " phone consider suitably change.Preferably, described system is that technology is unrelated.

Although exemplary environments as herein described uses hard disk, it is used as storing meter in exemplary operating environment Calculation machine may have access to the other type of computer-computer-readable recording medium of data, such as magnetic holder, flash card, digital universal disc, cartridge (cartridges), random access storage device (RAMs), read only memory (ROMs), the cable comprising bit stream or wireless signal Deng.

In order to allow users to and calculate device 100 alternately, input equipment 190 represents any number of input mechanism, example Such as the mike for speech, for gesture or the touch-sensitive screen of picture input, keyboard, mouse, motion input, speech, game machine Controller, TV remote controller etc..Output device 170 can one or many in many output mechanism known to those skilled in the art Kind, such as, printer, monitor, projector, speaker and draft machine.In some embodiments, output can be handed over via network Mutually, such as it is uploaded to website, Email, is attached to or is placed in other e-file and sends SMS or MMS information.One In the case of Xie, multimodal system (multimodal systems) allow users to provide multiple input type with calculate device 100 communications.User's input is typically arranged and managed to communication interface 180 and system exports.It is not intended to the present invention any concrete hard The upper operation of part arrangement, basic feature the most herein easily can be put for the hardware improved or firmware arrangement with its development Change.

For the clearness explained, illustrative system implementation plan is rendered as including that individual function blocks (includes being labeled as The functional device of " processor ").The function that these blocks represent can provide by using shared or special hardware, described hardware bag Include, but be not limited to be able to carry out the hardware of software.The function of the one or more processors such as presented in Fig. 1 can be by single The processor shared or multiple processor provide.(use of term " processor " should not be construed as and refers exclusively to be able to carry out software Hardware.) illustrative embodiment can include microprocessor and/or digital signal processor (DSP) hardware, carry out for storage The read only memory (ROM) of the software of operation discussed below and the random access storage device (RAM) for store results.Also may be used Ultra-large integrated (VLSI) hardware embodiments, and the VLSI circuit of the customization with general service DSP loop combination are provided.

Embodiment in the scope of the invention can also include by carry or have the data structure being stored thereon or based on Computer-the computer-readable recording medium of calculation machine-executable instruction.Such computer-computer-readable recording medium can be general service or dedicated computing The addressable any usable medium of machine.For example, and unrestricted, such computer-readable medium can include RAM, ROM, EEPROM, CD-ROM or other disk storage, disk memory or other magnetic memory apparatus, or can be used for carrying or store in Other medium any of the required program code means of computer-executable instruction or data structure form.When by network or Another kind of communication connection (hardwired, wireless or a combination thereof) is when computer transfer or the information of offer, and computer suitably will even Connect and be considered as computer-computer-readable recording medium.Therefore, any such connection is all properly termed computer-computer-readable recording medium.Above-mentioned Combination also should be included in the range of computer-computer-readable recording medium.

Computer-executable instruction includes, such as, causes general service computer, special-purpose computer or dedicated processes dress Put the certain function of enforcement or the instruction and data of functional group.Computer-executable instruction also includes in independence or network environment Program module performed by computer.It is said that in general, program module includes implementing particular task or realizing specific abstract data class The routine of type, program, object, assembly and data structure etc..Computer-executable instruction, related data structures and program Module represents the example of the program code means for performing steps of the methods disclosed herein.Such executable instruction or phase Close the example that the particular sequence of data structure represents the respective activity of function described in implement the step of.

The preferred embodiments of the invention can be in having many network computing environments planting computer system configurations type Practice, including personal computer, hand held device, many-processor system, based on microprocessor or programmable consumer electricity Sub-product, network PCs, minicomputer, mainframe computer etc..Network can include the Internet, one or more LAN (" LANs "), one or more big city regional network (" MANs "), one or more wide area network (" WANs "), one or more in The Internet, portion etc..Embodiment also can be in distributed computing environment (distributed computing environment) Practice, wherein task by locally or through communication network connect (by rigid line connect, wireless connections, or pass through a combination thereof) remote Journey processing means performs.In a distributed computing environment, program module can be located at Local or Remote memory storage two In person.

Preferably, computer-computer-readable recording medium and Internet connection and addressable publicly available data base, such as, PubMed or GeneBank, and recover the sequence about microorganism to be analyzed and relevant information, including the one of described microorganism Individual or multiple gene or DNA, RNA of portion gene and/or protein sequence.To pass through, such as, ion torrent sequencing analysis Sequence and same or similar microorganism one or more (such as, 1,10¹、10²、10³、10⁴、10⁵、10⁶、10⁷Or the biggest number Mesh) known array or other synthesis or recombination sequence compare.The result obtained can provide with several beat, hundreds of or the most thousands of known The gene of gene comparision or the quickly and thoroughly analysis of Gene Partial.The sudden change representing resistance can easily and rapidly measure and reflect Fixed.

The following example illustrates embodiment of the present invention, but is not construed as limiting the scope of the present invention.

Embodiment

Clinical isolates is from South Africa Pretoria university and South Africa Sandringham National Institute of Communicable Diseases (NICD) Sample achieve obtain amount to 26 clinical isolates the most different, it represents medicine-sensitivity, MD and XDR tuberculosis pathogenic bacteria Strain.H37Rv MTB laboratory strains compares as the order-checking running through scheme and is included.The all MTB separators used are From the archive bacterial strain of pure culture MGIT 960 System pipe (Becton Dickinson, Sparks, MD), wherein make Use Genotype MTBDplusMeasure (HAIN LifeSciences, Germany) to measure according to the manufacturer's instructions profit The genotypic resistance of the gentle isoniazid of good fortune and qualification species.The phenotypic resistance of one line and Second line Drug is used MGIT 960 System is carried out as described earlier.Critical concentration for ofloxacin and kanamycin (Second line Drug) is respectively 2.0 G/mL and 5.0 g/mL.Standard diagnostics algorithm is used to measure the resistance of a line and Second line Drug.

DNA prepares MTB separator blind from start to finish and processes.MTB sample (0.5 mL) is sucked and comprises 1.5 mL PrimeStore Molecular Transport Medium (a kind of molecular transport medium) (Longhorn Vaccines & Diagnostics, San Antonio, TX) cryovial in.The sample of inactivation is transported to from South Africa at ambient temperature Texas, USA San Antonio (3-4 days) is also stored in 5 DEG C until using.STb gene (50 l) uses Qiagen EZ1 Advanced Robot and EZ1 DNA Tissue Kit (Cat No. 953034) is according to the recommendation of manufacturer (Qiagen Inc., Germantown, MD) is from point examinations such as 200 l of the PrimeStore MTM comprising inactivated culture Sample purification.

Design of primers designs new PCR primer for expanding the full length coding region (table 6) of each purpose MTB gene.

Table 6

The pcr amplification primer thing analyzed for the total length of MTB gene

ForrpoB (2 groups of primers),katG、pncA、gyrAWithrrs(16s) primer of gene amplification is to using tuberculosis branch The genome sequence of bacillus H37Rv bacterial strain designs as with reference to (GenBank accession number NC_000962).Primer secondary structure, molten Solve temperature and potential primer-dimer formed use LaserGene 9.1 (DNAStar, Madison, WI) and PrimerExpress 3.0 (Life Technologies, Foster City, CA) measures.All of oligonucleotide all makes (Integrated DNA Technologies (IDT), San Diego, CA) is synthesized with standard desalination primer.

PCR amplification and optimizes a standardized thermal cycle ginseng through design for the amplified reaction of all MTB gene targets Use under manifold.Use Platinum Taq archaeal dna polymerase, 10X buffer agent and 50 mM MgCl₂ (P/N 10966-034; Life Technologies, Foster City, CA) prepare all PCR " pre-composition ".Amplification is comprising 24.1 l Ambion nuclease free water (Cat No. AM 9932; Life Technologies, Foster City, CA)、5 µl 10X PCR buffer agent, 2 l 50 mM MgCl₂(final 2 mM), 0.4 l PCR Nucleotide Mix Ultrapure dNTPS (200 Ms final for each dNTP；P/N 77119; USB, Santa Clara, CA)、0.5 L Platinum Taq archaeal dna polymerase (final 2.5 units) and 2 l primer mixtures (rpoB、katG、pncA、gyrAOrrrsGene；0.4 M final for each primer) 50 l final volume reactant mixtures in carry out." pre-to each 34 l Mixed thing " reactant mixture adds DNA that 16 l extract so that cumulative volume reaches 50 l.Reaction is at MicroAmp Optical 96-hole Sptting plate (P/N N801-0560, Life Technologies, Foster City, CA) is carried out and uses MicroAmp 8-Cap Strips (P/N 4323032, Life Technologies, Foster City, CA) caps. Amplification uses ABI 2720 thermal cycler (Life Technologies, Foster City, CA) to carry out.Thermal circulation parameters is 95 DEG C 2 minutes, then 95 DEG C 30 seconds, 55 DEG C 15 seconds and 72 DEG C 2 minutes, 40 circulations, last 72 DEG C extend 5 minutes.Institute The amplicon obtained is by having ethidium bromide (final 0.1 g/mL；Cat No 161-0433; Bio-Rad, Hercules, CA) 1% (wt/vol) molecular biology grade agarose (Cat No. BP1356; Fischer Scientific, Pittsburg, PA) above add 5 l PCR primer and 1 l GelPilot Loading Dye 5X (P/N 1037649;Qiagen, Germantown, MD) confirm.The electrophoretic separation of product is at 1X Tris Borate-EDTA (TBE) Buffer (Cat No. 1B70153;IBI Scientific, Peosta, IA) in 0.4 mV cm²Carry out 60 minutes.Amplicon visualizes under UV transillumination, uses TrackIt 1 kb Plus DNA Ladder (P/N 10488- 085;Life Technologies, Foster City, CA) carry out size assessment.After visualization, willrpoB、katG、 PncA, gyrA and rrs(16s) residue PCR reactant (~ 45 μ L) transfer of each clinical isolates gene amplification that target is corresponding To single microcentrifugal tube.The gene that what each clinical isolates was corresponding collect uses MinElute Reaction Cleanup Kit (Cat No. 28204;Qiagen, Germantown, MD) to stand PCR according to the manufacturer's instructions pure Change and be eluted in 50 l Low Tris-EDTA (TE) (Cat No. 602-1155-010; Life Technologies, Foster City, CA) in.The concentration of DNA and purity use NanoDrop ND 1000 (Thermo Fischer Scientific, Wilmington, DE) through spectrophotometry.

The preparation of ion torrent library indicates the library of bar code and uses Ion Xpress Plus Fragment Library Kit (Cat No. 4471269, Life Technologies, Foster City, CA) and Ion Xpress DNA Barcoding 1-16 Kit (Cat No. 4468654, Life Technologies, Foster City, CA) according to (Amplicon Library Preparation) is prepared in the Ion Xpress Plus gDNA of modified version and amplicon library The scheme of middle general introduction produces.

Amplicon is shearedChemical shearing uses and comprisesrpoB、katG、pncA、 gyrAWithrrs(16s) gene amplicon The 1-3 g DNA in approximation equimolar pond carry out.DNA shears in 50 l total reaction volume by combining 5 l Ion DNA profiling (the Ion Xpress Plus Fragment that Shear Plus 10X reaction buffer, 10 l enzymes and 35 l collect Library Kit, Cat No. 4471269, Life Technologies, Foster City, CA) carry out.Reaction is mixed Compound 37 DEG C is hatched 45 minutes, uses 5 l Ion Shear Stop Buffer to terminate, and is stored on ice until purification.Cut The DNA cut uses Agencourt Ampure XP-PCR purification globule (P/N A63880; Beckman Coulter, Brea, CA) with Dynal magnetic bead frame (Cat No. 123-21D;Life Technologies, Foster City, CA) according to manufacture The recommendation purification of business.In short, 99 l Agencourt globules and 50 l ion cleavage reaction things are mixed, incubated at room 5 Minute, it is placed on magnetic bead frame, by 70% (v/v) washing with alcohol twice, uses 12 l Low TE Buffer (Cat No. 602-1155-010;Life Technologies Inc., Foster City, CA) eluting.

Adapter connectsAdapter is connected to 0.2 mL low combination PCR pipe (P/N PCR-02-L-C; Axygen Inc., Union City, CA) in by combine 12 l shear amplicon and 1.25 l ligase buffer, 1.25 l P1- IA adapter mixture (Ion DNA Barcoding 1 16 Kit, Cat No. 4468654 Life Technologies, Foster City, CA) and 0.2 l DNA ligase (Ion Xpress Plus Fragment Library Kit, Cat No. 4471269, Life Technologies, Foster City, CA) carry out.Will mixing Thing inhales up and down 5 times and room temperature (22-25 ° of C) hatches 30 minutes.Use Agencourt Ampure XP-PCR purification globule (P/N A63880;Beckman Coulter, Brea, CA) and Dynal magnetic bead frame (Cat No. 123-21D; Life Technologies, Foster City, CA) according to the recommendation purification adapter ligation reaction of manufacturer and be eluted in 10 In l Low TE Buffer.

Nick translation and bar code amplificationUse Ion DNA Barcoding 1 16 Kit and Ion Xpress Fragment Library Kit (respectively Part Nos. 4468654 and 4471269; Life Technologies, Foster City, CA) put on bar code for the amplification subpool from each Patient Sample A.In order to make yield maximize, by group Close 40 l Platinum PCR SuperMix High Fidelity, 4.4 l Ion Primer Mix (BC X wherein X =bar code 1-16) and 10 l connect DNA reaction is adjusted in proportion 2x.Amplification uses ABI 2720 thermal cycler (Life Technologies, Foster City, CA) carry out.Thermal circulation parameters includes 72 DEG C 20 minutes, 95 DEG C 5 minutes, then 10 circulation 95 DEG C 15 seconds, 58 DEG C 15 seconds and 68 DEG C 1 minute.After amplification, use MinElute Reaction Cleanup Kit (Cat No. 28204;Qiagen, Germantown, MD) according to the manufacturer's instructions purification indicate bar Code sample and be eluted in 50 l Low TE (Cat No. 602-1155-010; Life Technologies, Foster City, CA) in.DNA concentration and purity use NanoDrop ND 1000 (Thermo Fischer Scientific, Wilmington, DE) measured by spectrophotometric analysis.The sample indicating bar code of purification be generally in the range of 150-300 Ng/ l, A260/280 purity is 1.7-1.9.In single 1.5 mL nuclease free microcentrifugal tubes combine equimolar concentration (~ The each sample indicating bar code of 2-3 g) and select for size.

Size selectsThe GelPilot 5X of proper volume is added in the MTB library pipe indicating bar code collected Loading Dye (P/N 1037649;Qiagen, Germantown, MD) and be loaded to comprise ethidium bromide (final 0.1 µg/mL; Cat No 161-0433;Bio-Rad, Hercules, CA) 1 % (w/v) agarose gel (Cat No. BP1356;Fischer Scientific, Pittsburg, PA) on.Indicate the library of bar code at 1X TBE Buffer (Cat No. 1B70153;IBI Scientific, Peosta, IA) in 0.4 mV cm²Electrophoresis 60 minutes is the most saturating at UV According to lower visualization.Size estimation uses TrackIt 1 kb Plus DNA Ladder (P/N 10488-085; Life Technologies, Foster City, CA) determine.Gel excision uses sterile scalpel blade to cut under UV transillumination Target region between 75-200 bp is carried out.The agarose gel of excision is cut into slices and is placed in aseptic 1.5 mL microcentrifugal tubes And use PureLink Quick Gel Extraction Kit (Cat No. K210012; Life Technologies, Foster City, CA) stand DNA purification according to the manufacturer's instructions.Use NanoDrop ND 1000 (Thermo Fischer Scientific, Wilmington, DE) indicate through spectrophotometry the DNA library of bar code concentration and Reinheitszahl.The library input recommended for emulsion-based PCR is ~ 140-560 x 10⁶Molecule/18 l.This scope is by using library Stock solution and nuclease free water 1:1000 dilution reach.

Emulsion polymerase chain reaction (emPCR)Emulsion polymerase chain reaction uses Ion Template Preparation Kit (Cat No. 4469000;Life Technologies, Foster City, CA) by adding 582 l free nucleic acids Enzyme water, 200 l 5X PCR reagent mixture, 100 l 10X PCR enzymatic mixtures, 100 ion ball granule (Ion Sphare Particles) and 18 l dilution library template carry out in 1 mL reaction volume.It is sufficiently mixed prepared product then In microcentrifuge of short duration centrifugal.Emulsion use Ultra-Turrax Tube Drive (Life Technologies, Foster City, CA) obtain.To Ion Template Preparation Tube (Cat No. 4467226, Life Technologies, Foster City, CA) middle Emulsion Oil (the Ion Torrent adding 9 mL freezings altogether Preparation Kit; Cat No. 4469000, Life Technologies, Foster City, CA).By emulsion Pipe is placed and is locked on IKA Ultra-Turrax Tube Drive and starts.In pipe is in motion (in motion) Time, whole 1 mL PCR premixed solution (master mix) is dispensed into cap mouth (cap port) and mixes 5 minutes.Breast by mixing Liquid is transferred to 96-hole PCR plate and uses ABI 2720 thermal cycler (Life Technologies, Foster City, CA) Use following thermal circulation parameters to expand: 94 DEG C 6 minutes, then 94 DEG C 30 seconds, 58 DEG C 30 seconds and 72 DEG C 90 seconds, 40 are followed Ring；Then 94 DEG C 30 seconds and 68 DEG C 6 minutes, 5 circulations.

Ion ball granule (ISP) reclaims and Qubit measuresUse Ion Xpress Template Kit (Cat No. 4469001, Life Technologies, Foster City, CA) in the reagent that provides according to the scheme (Ion of manufacturer Xpress Template Kit users' guidebook v2.0,18-19 page) reclaim ion ball granule.Reclaim the quantitative use of granule Qubit 2.0 Fluorometer (Life Technologies, Foster City, CA) and Ion Sphere Quality Control Kit (Cat No. 4468656, Life Technologies, Foster City, CA) according to The recommendation (Ion Xpress Template Kit users' guidebook, 25-26 page) of manufacturer is carried out.Template-positive ions ball particle (ISPs) optimised quantity is between 4-50%.Relative fluorescence units (RFU) value outside this scope obtained does not continues (persued) ISP enrichment subsequently.

ISP is enriched withISPs uses Ion Xpress Template Kit, Ion Sequencing Kit and DynaBeads MyOne Streptavidin C1 globule (respectively Cat Nos. 4469001,4468997 and 650.01; Life Technologies, Foster City, CA) in the reagent that provides according to scheme (the Ion Xpress of manufacturer Template Kit users' guidebook v2.0,15-17 page) enrichment.

The preparation of ion torrent 314 chip and PGM order-checking ion torrent 314 chip (Cat No. 4462923; Life Technologies, Foster City, CA) according to recommendation (the Ion Sequencing Kit users' guidebook v of manufacturer 2.0) prepare and load.Ion torrent PGM runs according to ion torrent 314 chip description, and it includes 65-cycle sequencing side Case, uses 18 megohms of purified water and standard compression argon to be driven across PGM systematic difference fluidics (fluidics).All 'srpoB、 katG、 pncA、 gyrAWithrrsGene and corresponding protein all deposit (accession number in Genbank JX303203-JX303332)。

The whole gyrase base that checks order on ion torrent PGM is measured for detecting gyrase PCR vs. 6110 PCR of TB Cause and the gyrase target (the gyrase target for OCR) for OCR can also be used for identifying that the TB causing resistance suddenlys change. This second PCR target allows accurately to analyze the TB bacterial strain that may not comprise whole IS6110 insertion element.Although IS6110 measures In most bacterial strains, there is multiple gene copy, but some only have one.As shown in Fig. 6,7 and 8, survey with IS6110 Surely comparing this gyrase mensuration and have universal higher cycle threshold, this is owing to there being multiple IS6110 base in those separators Because of copy and the sensitiveest.Therefore the traceable any possible TB sudden change of method checked order by this full genome is the most remote Suddenly change from the TB of detection site.

Phenotype and genotype results pass throughrpoB、 katG、 pncA、 gyrAWithrrs(16s) the ion torrent of gene Check order the aminoacid of 26 mycobacterium tuberculosis separators is characterized and summarize in table 1-5 respectively, and with BACTEC MGIT 960 (phenotypes) and/or HAIN GenoType MTBDRplus(genotype) LPA compares.By BACTEC MGIT 960 phenotype analyticals, in 26 MTB clinical isolates, 14 (54%) are MDR, and 7 (27%) are XDR, and 5 (19%) are to medicine Sensitive.Ion torrent PGM sequence measurement shows and cultivates, by MGIT 960, the phenotypic resistance (table 1-5) obtained and pass through The genotype that Hain LPA obtainsrpoBWithkatGBoth data (table 1,2) 100% (26/26) are consistent.

rpoBGene mutation, compared with H37Rv wild-type strain, identifies 10 in 26 clinical isolates altogetherrpoB Amino acid replacement.Common S531L sudden change is most popular, but observed it is also known that give the password of the resistance to rifampicin Sudden change (table 1) in son 516 and 526.It addition, in the open reading frame of rpoB but at the rifampicin resistance-certainly of 81-base pair Determine district (RRDR;Table 1) outside observe sudden change.The V194I observed outside RRDR in a bacterial strain sports one may Unique metathesis incoherent with rifampicin resistance.At least one bacterial strain is remembered beyond the resi-dues 900 of rpoB protein 5 amino acid replacements are recorded.There are 7 and wherein according to what LPA wild-type band did not exist the most corresponding sudden change band, there is rpoB The bacterial strain of sudden change (6 at 516,1 at 526).In 6 of these 7 separators, ion torrent check order at 516 Known mutations site in show a uncommon amino acid replacement (that is, glycine), at the most commonly known generation figured silk fabrics ammonia Acid (V) displacement (D516V) (table 2).Similarly, in separator intermediate ion torrent order-checking known mutations position at 526 Point shows arginine (R), tyrosine (Y) or aspartic acid (D) displacement (H526Y/D) generally occur herein.

katGGene mutation existskatGGene is observed 4 amino acid replacements, all resistant strains exist known tax Give the S315T (table 2) of isoniazid resistance.Clinical strains (the table including R463L, W191R and N138H sudden change is detected by DST 2), and previously characterized.katGIn displacement (R463L) previously display at 463 to antibiotic resistance without effect and Can be used for mycobacterium tuberculosis separator is categorized as heredity group 1 (Arg463) or 2/3 (Leu463).26 assessed are faced In bed separator, 7 (27%) is the member of heredity group 1, as this R463L displacement proves.

pncAGene mutation is comprisingpncAAmong 561 bps of full length gene coding region at least one bacterial strain Have recorded 7 coding mutations (table 3).The aminoacid that 9 (34.6%) in 26 bacterial strains comprise imparting pyrazinamide resistance is dashed forward Become (table 3).In a bacterial strain, at 195, nucleotide, characterize a silence (synonym) coding mutation (C195T).5 Bacterial strain comprises the known imparting of previously sign amino acid replacement (C14R, A102V, V139G, R154G to the resistance of pyrazinamide And L172P).At the residue 122 of pncA protein, new the dashing forward of a code termination codon is found in a separator Becoming (Q122 termination) (table 3), it was reported the most elsewhere.

gyrAGene mutation is in the 2,517 bp total lengths of coding DNA gyrase subunit AgyrAGene is observed 9 solely Special sudden change.Only passing throughgyrAThe quinolone resistant of the displacement definition at middle codon 88,90 and 94 determines bag in district (QRDR) Bacterial strain containing sudden change have recorded the resistance to fluoroquinolone (FQ).Region outside QRDR it was additionally observed that many extra dashing forward Become, be included in two " hybrid bacterial strain " sudden change (table 4) at 549 and 613 of gyrA albumen.The sudden change (S95T) of known 95 To FQ resistance without effect, but can be used for strain classification is heredity group 2 or 3.Divide in 19 clinics of total belonging to heredity group 2/3 In thing, according to the assessment (T=heredity group 2, S=heredity group 3) to gyrA 95,18 (96%) is group 2,1 (4%) For group 3.

rrs(16s) gene mutation is comprising total length 16srrsHave recorded 4 nucleotide among 1,540 bps of gene Sudden change.Contained by DST, 7 (27%) clinical isolates display tolerance aminoglycosides in 26, and all of bacterial strain A1401G sudden change (table 5) of known imparting resistance.Observe two other amino acid mutations (C492T and A514C), but previously Have shown that and do not suppress aminoglycoside effect.Observe a G878A coding mutation previously not characterized, but should according to DST Separator is shown as sensitive (table 5).

Megabasse order-checking ion torrent gene chip checks order in the complete genome group of influenza A virus in five kinds of differences Under the conditions of implement, in fig .9 as route (Tracks) identify.By the totivirus nucleic acid (about 14.4 of influenza A strain H3N2 Kb total serum IgE) by preparation as discussed above, only reverse transcription or reverse transcription PCR amplification, as shown in Figure 9.Influenza virus gene Group carrys out quality amplification (mass amplified) by reverse transcription (RT) and some stands PCR through the cDNA group of amplification.Then Use the ion torrent order-checking each result of program analysis.Six aggressiveness of RT and/or RT-PCR analysis homogenizing, Uni 12 and/or 24 different influenza-specific primers (length and sequences are different) are carried out.Six aggressiveness of homogenizing include 6 nucleoside of each length The set of the primer of acid, this set includes that all sequences of six nucleotide repeats whereby.Uni 12 is for comprising and influenza H3N2 The primer of the sequence of 12 nucleotide complementary of 3 ' ends of each section of viral genome (5 '- ACGCGTGATCAGCAAAAGCAGG; SEQ ID NO 13).As shown in Figure 9, route 4 six mer primer and Uni 12 amplifications and order-checking are then with 24 influenzas-specific primer PCR amplification, the influenza base of ion torrent scheme order-checking qualification about 70% Because of group.

Carry out extra experiment with the pacing sequence realizing complete influenza gene group.Develop a series of influenza-special Property primer, reacts it for PCR and will allow to implement unified condition.The primer of exploitation is listed in Fig. 10.These primers are complete Portion's infected by influenza genome specific, primer with about every 800-1,000 base pair length interval to along genome (sees Figure 10, expands Increase sub-length and primer is placed and the initial and final position of sequence).All primer lengths are similar, about 18-23 nucleotide And containing similar G/C content, about 22.7%-38.9%, the most about 33% ± 6% and major part about 33% ± 3%.Pcr analysis The different sets using these primers is carried out, and amplified production uses ion torrent order-checking scheme to identify.

The order-checking of pncA gene uses to be used along a series of primers mensuration of pncA genetic interval or " tiling " according to the present invention In PZA resistance pncA gene order and with tradition Sanger order-checking obtain results contrast.Figure 11 A depicts pncA The coded sequence of gene, the primer of use is described with runic and underscore in Figure 11 B.Use these primers and ion torrent side The science of law is worked in coordination with, and determines the whole coding region (seeing the P1-P4 of Figure 11 B) of pncA.The primer extension extremely all bases that will use Cause or specific region allow a whole genome of pacing sequence.Acquired surprising result identifies 2 or 11 mixed vaccine Strain (heterogeneous) group's case, it comprises both wild type and mutant, and this will be omitted by tradition Sanger order-checking.By basis The summary of the amino acid mutation in the pncA of the MTB clinical isolates that the ion torrent of the inventive method are inferred illustrates in table 7 And can compare with the table 8 of the result that display Sanger order-checking obtains.

As table 7 is with shown in the comparison of table 8, and WC2601/2 display T135 sudden change, by Sanger order-checking without corresponding sudden change.Should Sporting heterogeneous, the cell of 61% comprises sudden change, and 29% is wild type.With ML1440/2, identify S59P sudden change, pass through Sanger order-checking is without corresponding sudden change.This sports heterogeneous, and 95% comprises sudden change, 5% wild type.

Drug resistance gene directly from patient's sputum sample product quickly characterize the inventive method be devoted to from available from, such as, The demand that the drug resistance gene of patient's sputum sample product of remote districts quickly characterizes.The method includes collecting to analyze respectively Give the MTB of the resistance to first-line drug, rifampicin and pyrazinamiderpoBWithpncAGene.The party's science of law uses Environment temperature transport expectorant in PrimeStore Molecular Transport Medium (MTM), directly from expectorant extract nucleic acid, Gene amplification and order-checking characterize for MTB drug resistance.

The a part of of large-scale prospective analysis diagnosed as MTB at rural area, South Africa sputum sample product collects (South Africa Mopani's Patient).Molecule is checked, flocking swab (Copan Diagnostics, Brescia, Italy) is immersed in apoplexy due to phlegm also Minimum 5 times of vortex, is then transferred to 1.5 mL molecular transport media, in PrimeStore MTM (PS-MTM).PS-MTM is For safety inactivate the microorganism including mycobacterium tuberculosis and preservation and the RNA/DNA of stable release, room temperature fortune Defeated clinical transport solution.By comprise expectorant PS-MTM pipe use business shelf (commercial carrier) room temperature all from South Africa is transported to the well-equipped mechanism of San Antonio, TX.

Use PrimeXtract kit (Longhorn Vaccines and Diagnostics, San Antonio, TX, USA) according to the recommendation purification total genomic dna of manufacturer.The real time PCR amplification of MTB uses PrimeMix TB (PM-PCR), the MTB IS6110 region of a kind of targeting high conservative comprise all of reagent mixture, carry out.

Use is used forpncAWithrpoBMTB primer PCR amplification carry out as described earlier.ForrpoB (1, 625 bps) andpncAThe primer of (960 bps) expands respectively and comprises whole ropB and determine that district and promoter addpncAGene All parts for the gene of coding region.Prepared by NGS library, use Nextera XT Sample Prep Kit to preparepncAWithrpoBGene amplicon.MiSeq NGS (Illumina, San Diego, CA, USA) according to the manufacturer's instructions MiSeq Reagent Kit (V3) is used to carry out with 600 circulations.Bioinformatics use SeqMan NGen (V8) and LaserGene (V12) Core Suite (DNAStar, Inc, USA) and H37Rv reference strain heredity is compared and is carried out.

It is used in selectionrpoBWithpncAIn 22 samples of NGS, 17 (77.3%) produces complete DNA sequence (table 9).Due to portion gene order-checking, sequence quality is poor or low overburden depth (that is, less than 10X) omits 5 samples of total.Produce complete The sample of portion's sequence has the PCR instantaneous value in the range of 23.5-37.4, and majority has the CT value less than 30.Obtain from primary sample The concentration of the MTB reclaimed during extracting is depended in the success obtaining high-quality NGS.Before the terminal carrying out MTB resistant gene expands Qualitative real-time PCR is used to measure measurable NGS success.In three samples, NGS does not produces suitable data, be most likely to be because of For 1625 longer bprpoBThe invalid amplification (table 9) of PCR amplicon.

Table 9

From the MTB rpoB of the selected patient expectorant positive by Primemix MTB real-time PCR inspection and pncA gene Ion torrent order-checking * (N-22)

Relevant to those measured by XpertrpoBGene order finds resistant mutation.According torpoBGene NGS table Levy, at rpoB, three samples determine that 526 of district comprise classical resistant mutation.Enjoyably, two sample packages containing H-526-Y and One comprises H-526-D sudden change (table 9).In a sample (patient 89), observe that previously having been shown as non-resistance gives The V-194-I displacement of sudden change.At a samplerpoBIn have recorded synonym silent mutation, i.e. C-309-T.With H37RV reference Bacterial strain is compared, and finds from all bacterial strainspncAGene order is wild type (table 9), except there being one in a sample New R-2-P sudden change.It is unclear whether this sudden change gives the resistance to pyrazinamide, because it is trained by Xpert or MGIT Support and be not detected by, can use without drug resistance data for this sample.The patient of this sample derivative there is persistent cough and body weight subtracts Gently.Real-time PCR is used to check (follow up testing) to be the low positive (CT=36.1) but Xpert the follow-up of this patient Cultivate as feminine gender with MGIT.

Improving check order the most rapidly ability of resistant gene of MTB detection with sensitive real-time PCR is that scarcity of resources region carries Supply another chance.Kill rapidly MTB due to PS-MTM and at ambient temperature and above preservation DNA, can effectively transport sample This is for real-time PCR and checks order to improve the detection of drug resistant strain and optimizes patient treatment.Previous research has shown that Check order since the country with MDR and XDR comes the MDR bacterial strain of the patient of the U.S. to identify known and new resistant mutation Benefit.One extra advantage of NGS is that overburden depth provides and detects more than one group, i.e. heterogeneous in clinical samples The ability of resistance.It is important that heterogeneous resistance characterizes for patient care, particularly when tolerance is such as these crucial antibiotic MTB subgroup become dominant patient strains.The present embodiment also demonstrates and sputum sample is the most effectively transported to center and place reality Test room to provide the feasibility of the support to rural area clinic.Without extra training officer or infrastructure, from agriculture Patient's this Transshipment Permitted of sputum sample in region, village is to having the laboratory of well-trained personnel and state of the art equipment to support The supervision of MTB patient care and research.

The sign of mycobacterium tuberculosis (MTB) drug resistance is most important to the suitably treatment of tuberculosis (TB).Molecule is examined Survey the instrument providing rapidly new with next generation's order-checking (NGS) to diagnose and to improve the treatment of drug resistance TB.When we are devoted to When treatment and elimination TB, understand epidemiology and the effect of recurrent population in the resistance pattern changed rapidly, particularly non- In the rural environment of continent, for important.In this bulletin, use NGS characterize directly from collect from rural area, South Africa and PrimeStore^®In MTM (PS-MTM), room temperature is transported to the MTB of Texan expectorantrpoBWithpncADrug resistance gene. These genes give the resistance to first-line drug, rifampicin and pyrazinamide respectively.This work meaning is profound, because comprising high-quality The stable sample of amount DNA make it possible to directly from expectorant quickly, focus on.

Consider that description and the practice of invention disclosed herein, other embodiments of the present invention and purposes will be to abilities Field technique personnel are apparent.All references cited herein, including all of publication, the U.S. and foreign patent and patent Shen Please, by quoting specifically and fully combining.Use the most wherein, term " comprise " be intended to include term " consisting of " Or " consisting essentially of ".It is not intended to limit additionally, term comprises, includes and contains.Description and embodiments is intended to consider For merely exemplary, the true scope and spirit of the invention is indicated by appended claims.

Claims (37)

1. a method for the quick and sensitive nucleotide sequence motif identifying organism, including:

Thering is provided multiple nucleic acid samples, wherein each sample obtains from different strains or the serotype of organism；

The sequence of the plurality of nucleic acid samples is expanded by PCR；

Checked order by the next generation and obtain the sequence information of institute's extension increasing sequence；

The polymorphism the genome of at least one bacterial strain or serotype is determined from the sequence information obtained；With

By the polymorphism of described qualification and at least one bacterial strain described or the phenotype of serotype or genome positioning associated to identify This motif.

2. the process of claim 1 wherein that described motif indicates the existence situation of pathogen.

3. the method for claim 2, wherein said organism is one or more viruses, antibacterial, fungus or parasite.

4. the method for claim 3, wherein said virus be one or more DNA viruses, RNA viruses, plus or minus single-stranded viral, Double-stranded viruses, influenza virus, paramyxovirus, retrovirus, banzi virus, filamentous form virus, slow virus, influenza virus, people's immunity Defective virus, hepatitis virus or Ebola virus.

5. the method for claim 3, wherein said antibacterial is that mycobacterium tuberculosis, Plasmodium falciparum, soil draw hot Fu Langxisishi Bacterium, Yersinia pestis or vibrio cholera.

6. the process of claim 1 wherein that described biological sample is the body fluid and/or tissue obtained from patient.

7. the process of claim 1 wherein described motif not with other nucleotide sequence specific hybrid of organism.

8. the process of claim 1 wherein that described sample provides and described molecular transport medium bag in molecular transport medium Containing chaotropic agent, detergent, reducing agent, chelating agen, buffer agent and alcohol, together be enough to cell lysis, Denatured protein, inactivation nucleic acid Enzyme, the amount killing pathogen and non-degradable nucleic acid exists.

9. the process of claim 1 wherein that sample provides without freezing in room temperature.

10. the process of claim 1 wherein that described order-checking of future generation is checked order for ion torrent.

The method of 11. claim 10, the order-checking of wherein said ion torrent is carried out in single reaction.

The method of 12. claim 1, farther includes at least two motif, the existence of the motifs of wherein said two amplifications or The situation that do not exists measures together.

13. the process of claim 1 wherein that described motif comprises the region of coding antimicrobial gene order.

The method of 14. claim 13, wherein said antimicrobial gene order coding antibiotic.

15. the process of claim 1 wherein that described polymerase chain reaction is carried out in comprising following aqueous mixture: polymerization Enzyme and optional reverse transcription；Comprise the deoxynucleoside triphosphate mixture of about equivalent dATP, dCTP, dGTP and dTTP, chelating agen, Osmotic pressure agent, albumin, magnesium salt；And buffer agent.

16. are used for the method quickly measuring the complete sequence of target gene or genome, including:

By comprising (i) polymerase；(ii) a large amount of dATP, dCTP, dGTP and/or dTTP deoxynucleoside triphosphate is comprised； (iii) chelating agen；(iv) salt；(viii) buffer agent；(ix) stabilizer；(x) heat of the mixture of multiple primers pair is steady The single polymerase chain reaction (PCR) determining to implement in aqueous mixture described target produces a series of amplicon, wherein said multiple Each primer of primer pair has similar annealing temperature；

By next generation's order-checking each in order-checking produced series amplicon in single reaction, and

By the serial correlation of described amplicon the complete sequence that builds described target gene or genome.

The method of 17. claim 16, wherein said target gene or genome are RNA and by described target before carrying out PCR Reverse transcription is DNA.

The method of 18. claim 16, each primer of wherein said multiple primers pair includes 15-25 nucleic acid length and has about The primer of the G/C content of 25%-50%.

The method of 19. claim 16, each of which primer is to being designed to PCR amplification amplicon and the amplification of PCR amplification The set of son comprises the overlap section of complete target sequence.

The method of 20. claim 16, wherein said multiple primers pair and described target hybridize, and wherein primer is to about every 500-2, 000 nucleotide is spaced apart along described target.

The method of 21. claim 16, wherein said target gene or genome are organism, and described organism is disease Poison, antibacterial, fungus, parasite or cell.

The method of 22. claim 21, wherein said virus is one or more DNA viruses, RNA viruses, plus or minus strand disease Poison, double-stranded viruses, influenza virus, paramyxovirus, retrovirus, banzi virus, filamentous form virus, slow virus, influenza virus, people exempt from Epidemic disease defective virus, hepatitis virus or Ebola virus.

The method of 23. claim 21, wherein said antibacterial is that one or more mycobacterium tuberculosis, Plasmodium falciparum, soil draw Hot Francisella, Yersinia pestis or vibrio cholera.

24. are used for the method measuring the sequence of nucleic acid target in the step of a circulation, including:

The sample comprising described nucleic acid target is provided；

The nucleic acid of described sample carries out polymerase chain reaction to produce a series of amplicons, wherein said reaction comprise containing Following thermostable composite:

Polymerase；Comprise the deoxynucleoside triphosphate mixture of about equivalent dATP, dCTP, dGTP and dTTP；Chelating agen；Salt；Slow Electuary；Stabilizer；With multiple primers pair, each primer of wherein said multiple primers pair has the annealing temperature within 5 DEG C；

Each by NGS order-checking produced series amplicon, and

By the serial correlation of described amplicon the sequence that builds described nucleic acid target.

The method of 25. claim 24, the nucleic acid of wherein said sample is RNA and by described RNA reverse transcription before PCR.

The method of 26. claim 24, wherein said nucleic acid target length is more than 1 Mb.

The method of 27. claim 24, each primer of wherein said multiple primers pair is that 16-24 nucleotide is long, has about The G/C content of 28-35%, and 3 DEG C of interior annealing temperatures of other primer each at the plurality of primer pair.

The method of 28. claim 24, the most each primer expands the one of the sequence representing described nucleic acid target to being designed to PCR The amplicon of part, and the set of amplicon of PCR amplification represents the lap of complete target sequence.

The method of 29. claim 24, wherein said multiple primers are to about 800-1, the interval of 500 nucleotide length and described target Hybridization.

30. mixture comprising multipair nucleic acid primer, wherein, stand the polymerase chain relevant to nucleic acid target when making described mixture Reaction, described nucleic acid primer hybridizes and produces the set of amplicon in about the same temperature and described nucleic acid target, wherein said Each amplicon about 500-2 of set, 000 nucleotide is long, so that presenting described target in the amplicon set of gained Whole sequence.

The mixture of 31. claim 30, it is long that wherein said primer is about 15-25 nucleotide to each primer of set, tool There are the G/C content of about 25%-45%, and 3 DEG C of interior annealing temperatures with described target of other primer each.

The mixture of 32. claim 30, wherein said target is gene or the genome of microorganism.

The mixture of 33. claim 32, wherein said gene is the gene giving microbial antibiotic resistance.

The mixture of 34. claim 32, wherein said microorganism is virus, antibacterial, parasite or fungus.

The mixture of 35. claim 30, it comprises containing following thermostable composite: polymerase；Comprise dATP, dCTP, The deoxynucleoside triphosphate mixture of dGTP and dTTP；Chelating agen；Salt；Buffer agent；Stabilizer and nuclease free water.

The mixture of 36. claim 30, wherein said nucleic acid primer is not from hybridization.

The method of 37. claim 30, wherein by the primer of two or more genes to multiplexing together.