CN106167808A - A kind of method eliminating mecA plasmid based on CRISPR/Cas9 technology - Google Patents
A kind of method eliminating mecA plasmid based on CRISPR/Cas9 technology Download PDFInfo
- Publication number
- CN106167808A CN106167808A CN201610426703.XA CN201610426703A CN106167808A CN 106167808 A CN106167808 A CN 106167808A CN 201610426703 A CN201610426703 A CN 201610426703A CN 106167808 A CN106167808 A CN 106167808A
- Authority
- CN
- China
- Prior art keywords
- meca
- plasmid
- pcas9
- pet
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of based on the elimination of CRISPR/Cas9 technologymecAThe method of plasmid, selects MRSA bacterial strain pairmecAThe DNA sequence of gene code transpeptidase C-terminal carries out PCR amplification；mecAGene gel reclaims；mecAGene and T pMD19(simple) carrier is connected: preparation DH5 α competent cell；T‑pMD19‑mecAPlasmid electricity turns DH5 α competent cell；T‑pMD19‑mecAThe extraction of plasmid and sequence verification；T‑pMD19‑mecAThe double digestion of plasmid process andmecAThe gel of gene reclaims；PET 21a (+) plasmid withmecAGene connects；The design of oligos, synthesis；pCas9∷mecAThe structure of plasmid；Electricity turn pET 21a (+)mecAPlasmid is to E. coli expression strains BL21(D3) in；Electricity turns pCas9 ∷ respectivelymecAPlasmid and pCas9 plasmid are to BL21(D3)+pET 21a (+)mecACompetence antibacterial and BL21(D3)+pET 21a (+) in competence antibacterial.The present invention is simple to operate, high specificity, can effectively blockmecAPropagation eliminate MRSA bacterial strain.
Description
Technical field
The present invention relates to technical field of molecular biology, especially relate to a kind of based on the elimination of CRISPR/Cas9 technologymecAThe method of plasmid.
Background technology
Staphylococcus aureus is one of main pathogens causing a series of infectious disease of the mankind, is called for short S. aureus L-forms,
Skin infection, serious pneumonia, endocarditis, Joint suppuration can be caused scorching, and alimentary toxicosis, severe patient can cause toxic
Shock syndrome, easily causes that patient is lethal to die.Wherein, methicillin-resistant staphylococcus aureus (methicillin-
resistant Staphylococcμ s aμ reμ s, MRSA) become inside and outside institute because of its even more serious drug resistance situation
Important pathogen body in infection and Monitoring of drug resistance.MRSA has the key reason of drug resistancemecAGene.mecAGene
Be present in staphylococcic mobility element boxlike chromosome (Staphyloccoccal Cassette Chromosomemec, SCCmecOn).This mobility element can also carry the special knots such as other multidrug resistant genes, transposon, intron
Structure carries out horizontal transfer between bacterial strain, thus causes the mutual propagation of drug resistant gene between bacterial strain, causes bacterial strain multiple resistance to
Medicine.Therefore,mecALaterally gene transfer (Horizontal Gene Transfer, HGT) is to make many sensitive S. aureus L-forms obtain
Drug resistant gene and be changed into the important channel of many drug resistances MRSA bacterium.
At present, the research for the new drug of MRSA mainly has following methods, and one is to transform on the basis of original antibiotic
Structure explores new antibiotic, and such as Te Lawan star (telavancin) is through vancomycin being transformed formation through the ages
Adm derivative, and MRSA is had good antibacterial activity, but owing to it is poor to VRSA effect and
Therefore significantly toxic and side effects is applied the most extensive；Two is to show based on medicine hydrolysis efficient to S. aureus L-forms cell wall
The antibacterial protein developed of good antibacterial action, the method effect is obvious, and specificity is high, but as macro-molecular protein its
Metabolic half life and immunogenic problem thereof in vivo limit its development.
Summary of the invention
In view of this, it is an object of the invention to for the deficiencies in the prior art, it is provided that a species specificity is high, effect is obvious,
Have no side effect eliminates based on CRISPR/Cas9 technologymecAThe method of plasmid.
For reaching above-mentioned purpose, the present invention by the following technical solutions:
A kind of based on the elimination of CRISPR/Cas9 technologymecAThe method of plasmid, comprises the following steps:
(1) MRSA bacterial strain pair is selectedmecAThe DNA sequence of gene code transpeptidase C-terminal carries out PCR amplification；
(2)mecAGene gel reclaims；
(3) by step (2) gainedmecAGene and T-pMD19(simple) carrier is connected:
(4) DH5 α competent cell is prepared；
(5) step (3) products therefrom electricity is turned DH5 α competent cell
Take DH5 α competent cell described in 100 μ l to be placed in and thaw on ice；Take 11 μ l step (3) products therefroms to be placed in centrifuge tube,
Centrifuge tube is placed in pre-cooling 10min on ice together with electricity revolving cup；The described DH5 α competent cell that 100 μ l thaw is transferred to
In above-mentioned centrifuge tube, on ice after mixing, continue ice bath 10min；
Open electroporation, said mixture is transferred in electricity revolving cup, under 2500V voltage, carries out electricity turn, and 1ml is contained
The BHI culture medium of resistance is rapidly added in electricity revolving cup, transfers in 10ml centrifuge tube after being mixed, 37 DEG C, 250r/min
Centrifugal 1.5h, carries out recovery process；Take 50 μ l said mixtures and 50 μ l BHI culture medium, mix homogeneously, be then coated in containing
On the TSA flat board of 100 μ g/ml ampicillins, it is placed in the couveuse of 37 DEG C, incubated overnight；
(6) T-pMD19-mecAThe extraction of plasmid and sequence verification；
(7) T-pMD19-mecAThe double digestion of plasmid process andmecAThe gel of gene reclaims
T-pMD19-mecAPlasmid after BamH I and Hind III double digestion, carry out gel electrophoresis checking andmecAGene gel returns
Receive；
(8) pET-21a (+) double digestion of plasmid processes and gel reclaims
PET-21a (+) to use plasmid DNA Mini Kit to carry out BamH I and Hind III restriction endonuclease after reclaiming double for plasmid
After enzyme action processes, carry out gel recovery；
(9) pET-21a (+) plasmid withmecAGene connects；
(10) design of oligos, synthesis, phosphorylation and annealing；
(11) pCas9 ∷mecAThe structure of plasmid
PCas9 gel reclaims the double-strand oligos linked system of product and annealing: pCas9 gel reclaims product 12 μ l, after dilution
Oligos 1.5 μ l, T4 ligase 1 μ l, T4 ligase buffer 2 μ l, distilled water 3.5 μ l；
Condition of contact: overnight connect at 16 DEG C, electricity turns 100 μ l DH5 α competent cells afterwards, selects monoclonal bacterium colony to extract
pCas9∷mecAPlasmid；
(12) electricity turn pET-21a (+)-mecAPlasmid is to E. coli expression strains BL21(D3) in；
(13) electricity turns pCas9 ∷mecAPlasmid and pCas9 plasmid are to BL21(D3)+pET-21a (+)-mecACompetence antibacterial
In；
(14) electricity turns pCas9 ∷mecAPlasmid and pCas9 plasmid are to BL21(D3)+pET-21a (+) in competence antibacterial.
Preferably, required in PCR amplification procedure described in step (1) amplimer is:
F:CGGGATCCACTATTGATGCTAAAGTTCAAAAG
R:CCCAAGCTTATTCATCTATATCGTATTTTTTATTA.
Preferably, the system of described PCR amplification includes: 2 × Taq PCR Master Mix 12.5 μ L, amplimer F 1
μ l, amplimer R 1 μ l, MRSA DNA 2 μ l, distilled water 8.5 μ l.
Preferably, the process of described PCR amplification is:
<1>denaturation: heat 5 minutes at 94 DEG C；
<2>degeneration: heat 30 seconds at 94 DEG C；
<3>annealing: heat 30 seconds at 50 DEG C；
<4>extend: heat 1 minute at 72 DEG C；
<5>circular treatment: circulation<2>~<4>process 35 times；
<6>re-extend: continue at 72 DEG C to extend 10 minutes.
Preferably, the condition of phosphorylation described in step (10): 37 DEG C of water-bath 1h, then 65 DEG C of water-bath 20min, enzyme loses
Live.
Preferably, the annealing described in step (10) is: add the Nacl oligos to phosphorylation of 2.5 μ l 1M
Centering, puts into system after then water-bath being heated to 95 DEG C, closes water-bath power supply so that it is slow cooling is extremely after 5 minutes
When 50 DEG C, in water-bath, slowly add frozen water be down to room temperature to temperature.
Preferably, the extraction process of described plasmid is: select monoclonal bacterium colony, is placed in containing 100 μ g/ml ammonia benzyl west
In the aseptic BHI fluid medium of woods, carry out increasing bacterium, then extract plasmid.
The bacterial isolates used in this process of the test and plasmid origin: select coming of in June, 2014 ~ 2014 year December collection
From Zhengzhou City's general hospital clinical samples, wherein select MRSA mel-stap-a2014124/zz bacterial strain pairmecAGene code
The DNA sequence of the C-terminal of transpeptidase carries out PCR amplification, and purpose fragment length is 1046bp；E.colistraindh5α is by this reality
Test room to preserve；E. coli bl21 (D3) is century company limited purchased from health；Carrier T (PMD-19 simple) is purchased from Dalian
Bao Bio-Engineering Company；PCas9 plasmid is purchased from Jiangsu Ji Rui company；PET-21a (+) it is that this laboratory preserves；BsaI inscribe
Enzyme is purchased from NEB company；T4 PNK is purchased from NEB company；BamH I and Hind III is purchased from NEB company；T4 DNA ligase is purchased from
NEB company.
In this process of the test use main agents source: Ethidum Eremide (Ethidium Bromide, EB), chloromycetin and
TAE is purchased from Shanghai Solarbio company, and agarose is purchased from BIOWEST company of Spain, and Loading buffer is purchased from the green skies
Bioisystech Co., Ltd, PH precision test paper reaches chemical reagent factory purchased from Tianjin gold, and yeast leaching powder, tryptone are purchased from Britain
Oxoid company, TSA culture medium is purchased from Qingdao Hai Bo Bioisystech Co., Ltd, and brain-heart infusion medium (BHI) is purchased from land, Beijing
Bridge technology Co., Ltd, the little extraction reagent kit of bacteria plasmid DNA, minim DNA reclaim test kit, polymerase chain reaction (PCR)
Related reagent, DL2000 DNA maker(DL2000 and DL15000) and ampicillin purchased from Shanghai Lay maple biotechnology limited
Company, sodium hydroxide, sodium chloride are purchased from Luoyang Hao Hua chemical reagent company limited, and agar powder is purchased from Sigma company, and glycerol is purchased
From Tianjin Kai Tong Chemical Co., Ltd., bacterial genomes DNA extracts test kit purchased from sky, Beijing limited public affairs of root biochemical technology
Department, staphylococcus lysozyme is purchased from SIGMA-ALDRICH.
The preparation of the main agents used in this process of the test:
Staphylococcus lysozyme buffer: 2mM EDTA and 20mM Tris-HCl is added in 1.2% Triton, regulates with NaOH
PH value to 8.0, sterilizing 20min at 121 DEG C, after being cooled to room temperature, adding staphylococcus lysozyme to concentration is 200 μ g/mL,
Then it is packed as the aliquot of 180 μ l, saves backup at being placed in-20 DEG C.
1.5 % agarose gel: weigh agarose 1.5g and join in 100mL 1 × TAE hydraulic fluid, after stirring
Being placed on electric furnace heating, until becoming transparent after liquid boiling, being cooled to 56 DEG C, adding 5 μ l EB, mix homogeneously is standby.
The chloromycetin solution of 25mg/ml: weigh 250mg chloromycetin powder, joins in 10ml dehydrated alcohol and mixes, make
With 22 μm membrane filtrations, obtaining chloromycetin solution, the aliquot being packed as 1ml saves backup at-20 DEG C；During use, by 100ml
LB, BHI or BSA culture medium is placed in sterilizing 20min at 121 DEG C, and is cooled to 60 DEG C, is subsequently adding 100 μ l above-mentioned gained chlorine
Mould cellulose solution, making final working concentration is 25 μ g/ml.
100mg/ml ampicillin aqueous solution: weigh 1000 mg chloromycetin powder, join in 10ml deionized water,
Mixing, uses 22 μm membrane filtrations, obtains ampicillin aqueous solution, and the aliquot being packed as 1ml saves backup at-20 DEG C；Make
Used time, 100ml LB, BHI or BSA culture medium is placed in sterilizing 20min at 121 DEG C, and is cooled to 60 DEG C, be subsequently adding 100
μ l above-mentioned gained ampicillin aqueous solution, making ultimate density is 100ug/ml.
LB fluid medium: weigh 1.0g tryptone, 0.5g yeast leaching powder and 1.0g sodium chloride and be dissolved in 100mL distilled water
In, with 10mol/L NaOH regulation pH value to 7.2, and sterilizing 20min at 121 DEG C, it is subsequently placed at 4 DEG C and saves backup；Make
Used time adds the good chloromycetin of the 100 above-mentioned configurations of μ l or ampicillin antibiotic according to cultivating the resistance of electricity Pignus pignoris grain contained by bacterial strain
Solution, uses after mix homogeneously.
LB solid medium: weigh 1.0g tryptone, 0.5g yeast leaching powder, 1.0g sodium chloride and 1.5g agar powder, molten
In 100mL distilled water, with 10mol/L NaOH regulation pH value to 7.2, and sterilizing 20min at 121 DEG C, be cooled to 50 DEG C ~
60 DEG C, the chloromycetin configured according to the resistance interpolation 100ul appeal cultivating electricity Pignus pignoris grain contained by bacterial strain during use or ammonia benzyl west
Woods antibiotic solution pour plate is standby.
TSA culture medium: the TSA culture medium claiming 4g to buy joins in 100mL deionized water, sterilizing at 121 DEG C
20min, and be cooled to 50 DEG C ~ 60 DEG C, during use resistance according to electricity Pignus pignoris grain add the good chloromycetin of the above-mentioned configuration of 100ul or
Ampicillin antibiotic solution, pours culture medium flat plate, every plate 15ml into after mix homogeneously, wait to dry be placed on preserve at 4 DEG C standby
With.
BHI culture medium: the BHI culture medium weighing 3.8g purchase joins in 100mL deionized water, sterilizing at 121 DEG C
20min, is cooled to 50 DEG C ~ 60 DEG C, and during use, the resistance according to electricity Pignus pignoris grain adds the good chloromycetin of the 100 above-mentioned configurations of μ l or ammonia
Benzyl XiLin antibiotic solution, standby after mix homogeneously.
The NaCl of 1M: weighing in 5.844g NaCl to 100mL deionized water, sterilizing 20min, standby at 21 DEG C.
The glycerol of 10%: take in the deionized water that 10mL glycerol joins 80mL, be settled to 100ml, sterilizing at 21 DEG C
20min, standby.
The key instrument equipment source used in this process of the test:
LabcyCler basic grads PCR instrument is purchased from SensoQuest company of Germany, and JW-2017H high speed centrifuge is purchased from peace
Hui Jiawen instrument and equipment company limited, HVE-50 type automatic electric heating pressure steam sterilizer is purchased from Hirayama company of Japan, sea
You are purchased from Qingdao HaiEr Co., Ltd by vertical ultra-low temp, and the quick vortex mixer of SK-1 type is purchased from Community of Jin Tan County medical treatment
Instrument plant, water isolation type electro-heating standing-temperature cultivator is purchased from Shanghai new talent medical apparatus and instruments Manufacturing Co., Ltd, DYC31B type horizontal strip electrophoresis
Groove is purchased from Beijing Liuyi Instrument Factory, and HH-42S digital display temperature constant magnetic stirring cyclic water tank is purchased from Changzhou China of state limited public affairs of electrical equipment
Department, ZD-85 gas bath constant temperature oscillator is purchased from Jing Da instrument manufacturing company limited of Jintan City, and Gene pulser XCell electricity converts
Instrument is purchased from Bio-Rad company, and trace scalable pipettor is purchased from Thermo company of the U.S., and 101-1B type electric drying oven with forced convection is purchased
From Shanghai City experimental apparatus head factory, WD 9403C ultraviolet device is purchased from Liuyi Instruments Plant, Beijing, Gene-Genius bioimaging
System is purchased from gene company limited, and DYY-6C type electrophresis apparatus is purchased from Beijing Liuyi Instrument Factory.
The test material and the method that are not specifically noted are known technology, can include " molecular cloning at common tool school bag
Experiment guide " (J. Pehanorm Brooker, D.W Russell write, the third edition, Science Press, 2002) etc. searches.
The invention has the beneficial effects as follows:
The present invention is by building targetingmecAThe pCas9 ∷ of genemecAPlasmid and containingmecAThe escherichia coli matter of gene
Grain pET-21a (+)-mecAPlasmid, proceeds to the former electricity in the E. coli expression strains containing the latter, thus realizes removingmecAThe purpose of place plasmid.The method is simple to operate, high specificity, for being similar tomecAThe circulation way of gene, no
Only can eliminate MRSA bacterial strain, sensitive strain can be prevented to accept simultaneouslymecAMRSA bacterial strain it is changed into after gene；Relatively pass simultaneously
The gene editing means of system are the most flexible, and editorial efficiency is higher.
Detailed description of the invention
By the following examples feature of present invention and other correlated characteristic are described in further detail, in order to of the same trade
The understanding of technical staff:
What the present invention provided eliminates based on CRISPR/Cas9 technologymecAThe method of plasmid, comprises the following steps:
(1) prepared by DNA profiling
Bacterial genomes DNA extraction kit is used to extract DNA from MRSA mel-stap-a2014124/zz bacterial strain；
(2)mecAGene PCR expands
Select MRSA bacterial strain pairmecAThe DNA sequence of gene code transpeptidase C-terminal carries out PCR amplification；
Wherein, amplimer is:
F:CGGGATCCACTATTGATGCTAAAGTTCAAAAG
R:CCCAAGCTTATTCATCTATATCGTATTTTTTATTA；
The system of PCR amplification includes: 2 × Taq PCR Master Mix 12.5 μ l, amplimer F 1 μ l, amplimer R 1 μ
L, MRSA DNA 2 μ l, distilled water 8.5 μ l；
The process of PCR amplification includes:
<1>denaturation: heat 5 minutes at 94 DEG C；
<2>degeneration: heat 30 seconds at 94 DEG C；
<3>annealing: heat 30 seconds at 50 DEG C；
<4>extend: heat 1 minute at 72 DEG C；
<5>circular treatment: circulation<2>~<4>process 35 times；
<6>re-extend: continue at 72 DEG C to extend 10 minutes；
(3)mecAGene gel reclaims
40 μ L PCR system are joined in the well of gel electrophoresis, add DL2000 DNA marker, at 90V voltage
Lower process 40 minutes, is then placed in WD 9403C ultraviolet imager, by the bar of corresponding about the 1000bp of above-mentioned gains
Band cuts down rapidly, cuts unnecessary blob of viscose, uses minim DNA quickly to reclaim test kit and reclaims, and steams MILLI-Q water with double
Eluting, measures the DNA concentration reclaimed, in order to next step connects experimental calculation carrier and purpose fragment ratio；
(4) by step (3) gainedmecAGene and T-pMD19(simple) carrier is connected
Linked system comprises: T-pMD19(simple) carrier 1 μ l,mecAGene 5 μ l, connects Takara Buffer 5 μ l；
The carrying out that gained linked system is placed in water isolation type electro-heating standing-temperature cultivator at 16 DEG C is overnight connected；
(5) DH5 α competent cell is prepared
By in LB solid medium aseptic for DH5 α microbionation to non-resistant, at 37 DEG C, carry out incubated overnight；By 5ml nonreactive
The aseptic BHI culture medium of raw element is encased in 20ml sterilizing teat glass, selects the monoclonal bacterium colony of DH5 α antibacterial, is inoculated into
State in the aseptic BHI culture medium of antibiotic-free, at 37 DEG C, shake overnight with the speed of 250r/min, carry out increasing bacterium；
The DH5 α antibacterial of above-mentioned gained is joined in the BHI culture medium of new aseptic antibiotic-free with the ratio of 1:100,37
At DEG C, shake 2.5 hours with the speed of 250r/min, stop cultivating when the OD value of antibacterial reaches 0.3 ~ 0.4, be placed in and enter on ice
Row ice bath pre-cooling, is down to 3 DEG C ~ 4 DEG C to bacterium solution temperature；
By 50ml centrifuge tube and 10% glycerol in sterilization treatment 20min at 121 DEG C, and it is cooled to 3 DEG C ~ 4 DEG C, standby；By above-mentioned
Precooled bacterium solution is poured in centrifuge tube, is centrifuged processing 10min with the speed of 6000r/min, removes supernatant at 4 DEG C
Liquid；Add the MILLI-Q water of 45ml pre-cooling, through rifle head piping and druming mixing after, at 4 DEG C with the speed of 6000r/min carry out from
The heart processes 10min, removes supernatant；Repeat this step once；
Take the above-mentioned glycerol of 45ml again to be placed in centrifuge tube, be centrifuged 10 minutes at 4 DEG C with the speed of 6000r/min, abandon supernatant；
Operation on ice: add the 500 above-mentioned glycerol of μ l in centrifuge tube, mixing, obtain DH5 α competent cell, be placed in-80 DEG C
Save backup in refrigerator；
(6) step (4) products therefrom electricity is turned DH5 α competent cell
Take 100 μ l DH5 α competent cells to be placed in and thaw on ice；Take 11 μ l step (4) products therefroms and be placed in the centrifuge tube of 1.5ml
In, centrifuge tube is placed in pre-cooling 10min on ice together with 0.2cm electricity revolving cup；The competent cell that 100 μ l thaw is transferred to
State in 1.5ml centrifuge tube, on ice after mixing, continue ice bath 10min；
Open electroporation, said mixture is transferred in electricity revolving cup, under 2500V voltage, carries out electricity turn, and 1ml is contained
The BHI culture medium of resistance is rapidly added in electricity revolving cup, transfers in 10ml centrifuge tube after being mixed, 37 DEG C, 250r/min
Centrifugal 1.5h, carries out recovery process；Take 50 μ l said mixtures and 50 μ l BHI culture medium, mix homogeneously, be then coated in containing
On the TSA flat board of 100 μ g/ml ampicillins, it is placed in the couveuse of 37 DEG C, incubated overnight；
(7) T-pMD19-mecAThe extraction of plasmid and sequence verification
Select the monoclonal bacterium colony in step (6) products therefrom, be placed in the aseptic BHI liquid containing 100 μ g/ml ampicillins
In body culture medium, carry out increasing bacterium, then extract T-pMD19-mecAPlasmid；
Use plasmid DNA Mini Kit, collect 1ml bacterium solution the most every time, be centrifuged each 1min respectively, abandon supernatant, rifle
Head sucking-off remnants bacterium solution, intermediate steps is carried out to specifications, and final step, through MILLI-Q water elution and dissolving, adds water volume
For every post 60 μ l, eluent again adds and carries out second time eluting in post, to improve plasmid DNA concentration for the first time；
(8) T-pMD19-that will extractmecAPlasmid delivers to Shanghai Sheng Gong biotechnology company sequence verification；
(9) T-pMD19-mecAThe double digestion of plasmid process andmecAThe gel of gene reclaims
T-pMD19-mecAPlasmid after BamH I and Hind III double digestion, carry out gel electrophoresis checking andmecAGene coagulates
Glue reclaims；
Enzyme action system 20 μ l: plasmid DNA 5 μ l, BamH I and Hind III restriction endonuclease each 1 μ l, Cutsmart buffer 2 μ l, double
Steam water 11 μ l；
By above-mentioned enzyme action system water-bath 4 hours at 37 DEG C, complete T-pMD19-mecAThe double digestion reaction of plasmid, places into
DYY-6C type electrophresis apparatus, electrophoresis 40min under 90V, wherein electrophoretic medium is 1.5% agarose gel；mecAGene gel reclaims
Process is consistent with step (3)；
(10) pET-21a (+) double digestion of plasmid processes and gel reclaims
PET-21a (+) to use plasmid DNA Mini Kit to carry out BamH I and Hind III restriction endonuclease after reclaiming double for plasmid
After enzyme action processes, carry out gel recovery；
Enzyme action system (20 μ l): pET-21a (+) plasmid DNA 15 μ l, BamH I and Hind III each 1.5 μ l of restriction endonuclease,
Cutsmart buffer 2μl ；
Enzyme action process is consistent with step (10), and the process that gel reclaims is consistent with step (3)；
(11) pET-21a (+) plasmid withmecAGene connects
PET-21a (+) gel reclaims fragment (10ng/ μ l) after plasmid double digestion, reclaim with gel in step (9)mecABase
Because (12ng/ μ l) connects；
Linked system (32 μ l): pET-21a (+) gel reclaims fragment 20 μ l after plasmid double digestion, gel returnsmecAGene sheet
Section 8 μ l, T4 ligase 1 μ l, T4 ligase buffer 3 μ l；
Coupled reaction condition: linked system overnight connected under 16 DEG C of water-baths, afterwards, electricity turns 300 μ l DH5 α competence
Cell, selection monoclonal bacterium colony extraction pET-21a (+)-mecAThe order-checking of Hai Shenggong biotechnology company is served after plasmid.
(12) design of oligos, synthesis, phosphorylation and annealing
Utilize sgRNAcas9 software design, pick out 6 kinds to the minimum oligos sequence of efficiency of missing the target, and in list of references
Two pairs of oligos sequences, and add after BsaI restriction enzyme site public by the raw work biotechnology in Shanghai with reference to oligos design principle
Department's synthesis.
Oligos phosphorylation system (50 μ l): oligo I (100 μMs) 1 μ l, oligo II (100 μMs) 1 μ l,
10X T4 Ligase buffer (NEB) 5 μ l, T4 PNK (NEB) 1 μ l, ddH2O 42 μl；
Dephosphorylation condition: 37 DEG C of water-bath 1h, then 65 DEG C of water-bath 20min, enzyme inactivates；
Oligos annealing steps:
Add the Nacl of 2.5 μ l 1M to the oligos centering of phosphorylation, after then water-bath being heated to 95 DEG C, system is put
Enter, close water-bath power supply after 5 minutes so that it is during slow cooling to 50 DEG C, in water-bath, slowly add frozen water drop to temperature
To room temperature；
Oligos sequence is shown in Table 1:
Table 1 Oligos sequence
Note: " F " represents positive-sense strand, " R " represents antisense strand.
(13) pCas9 ∷mecAThe structure of plasmid
The enzyme action system of pCas9 plasmid Bsal restriction endonuclease: pCas9 plasmid 15 μ l, Bsal restriction endonuclease 1 μ l, cutsmart buffer
2 μ l, distilled water 2 μ l；
Enzyme action condition: 37 DEG C of water-bath 3h, after the agarose gel electrophoresis of 1.5%, gel reclaims；
PCas9 gel reclaims the double-strand oligos linked system of product and annealing: pCas9 gel reclaims product 12 μ l, after dilution
Oligos 1.5 μ l, T4 ligase 1 μ l, T4 ligase buffer 2 μ l, distilled water 3.5 μ l；
Condition of contact: overnight connect at 16 DEG C, afterwards, electricity turns 100 μ l DH5 α competent cells, selects monoclonal bacterium colony to extract
Plasmid also serves the order-checking of Hai Shenggong biotechnology company；
(14) electricity turn pET-21a (+)-mecAPlasmid is to E. coli expression strains BL21(D3) in
The method using step (7) obtains enrichment liquid, and enrichment liquid is divided into two parts, and a copy of it bacterium solution extracting directly plasmid is carried out
Single endonuclease digestion, through gel electrophoresis checking antibacterial in whether have plasmid pET-21a (+)-mecA, another part directly makes impression
State cell；
(15) electricity turns pCas9 ∷mecAPlasmid and pCas9 plasmid are to BL21(D3)+pET-21a (+)-mecACompetence antibacterial
In
Electricity Pignus pignoris grain pCas9 ∷mecA2 μ l to 100 μ l BL21(D3s each with control plasmid pCas9)+pET-21a (+)-mecAIn competence antibacterial；
Take the 100 above-mentioned bacterium solution of μ l and dilute 10 times, then it is flat to take the TSA containing 25 μ g/ml chloromycetin of the bacterium solution coating after 10 μ l dilutions
Plate, incubated overnight at 37 DEG C, and bacterium colonies all on flat board are carried out counting numbering；
Each flat board randomly selects 10 bacterium colonies and carries out liquid increasing bacterium, extract plasmid；
After the plasmid extracted utilizes hind III digestion, carry out agarose gel electrophoresis to judge that Cas9 plasmid is to pET-21a
(+)-mecAEffect；
(16) electricity turns pCas9 ∷mecAPlasmid and pCas9 plasmid are to BL21(D3)+pET-21a (+) in competence antibacterial
Take 100 μ l bacterium solution and dilute 10 times, then the TSA taking the chloromycetin containing 25 μ g/ml of the bacterium solution coating after 10 μ l dilutions puts down
Plate, incubated overnight at 37 DEG C, and bacterium colonies all on flat board are carried out counting numbering；
Each flat board randomly selects 10 bacterium colonies and carries out liquid increasing bacterium, extract plasmid；
After the plasmid extracted utilizes BamH I enzyme action, carry out agarose gel electrophoresis with judge Cas9 plasmid to pET-21a (+)
Effect.
9 kinds of different Cas9 plasmids to pET-21a (+)-mecAPlasmid and pET-21a (+) elimination efficiency of plasmid, such as table 2
With table 3:
From table 2,9 kinds of Cas9 plasmids to pET-21a (+)-mecAThe scavenging action of plasmid generally there are difference, each group
It is later discovered that compares every time with the contrast two-by-two that acts through of matched group plasmid pCas9PValue be 0.00 less than adjust after
Inspection level α=0.006, therefore in addition to matched group pCas9 plasmid, remains 8 groups of pCas9-mecAPlasmid is all to plasmid pET-
21a(+)-mecAThere is obvious scavenging action.Tied by the detection of 90 bacterium colonies including matched group pCas9 seen from table 3
Fruit all shows, PCas9-mecAPlasmid is not for comprisingmecAThe pET-21a of gene (+) plasmid the most do not eliminates effect.
29 kinds of Cas9 plasmids of table to pET-21a (+)-mecAPlasmids efficiency
Note: " * " is through Fisher exact method method two-sided test level α=0.05, " ^ " is because sample size is less than 40, therefore use 2 ×
2 four fold table Fisher exact method methods, inspection level α=0.006 after two-sided test, correction.
39 kinds of Cas9 plasmids of table to plasmid pET-21a (+) eliminate functioning efficiency
Above by embodiment, the present invention is described in detail, but described content has been only presently preferred embodiments of the present invention,
It is not to be regarded as the practical range for limiting the present invention.All impartial changes made according to the present patent application scope and improvement etc.,
Within all should still belonging to the patent covering scope of the present invention.
Claims (7)
1. one kind eliminates based on CRISPR/Cas9 technologymecAThe method of plasmid, it is characterised in that comprise the following steps:
Select MRSA bacterial strain pairmecAThe DNA sequence of gene code transpeptidase C-terminal carries out PCR amplification；
mecAGene gel reclaims；
By step (2) gainedmecAGene and T-pMD19(simple) carrier is connected:
Preparation DH5 α competent cell；
Step (3) products therefrom electricity is turned DH5 α competent cell
Take DH5 α competent cell described in 100 μ l to be placed in and thaw on ice；Take 11 μ l step (3) products therefroms to be placed in centrifuge tube,
Centrifuge tube is placed in pre-cooling 10min on ice together with electricity revolving cup；The described DH5 α competent cell that 100 μ l thaw is transferred to
In above-mentioned centrifuge tube, on ice after mixing, continue ice bath 10min；
Open electroporation, said mixture is transferred in electricity revolving cup, under 2500V voltage, carries out electricity turn, and 1ml is contained
The BHI culture medium of resistance is rapidly added in electricity revolving cup, transfers in 10ml centrifuge tube after being mixed, 37 DEG C, 250r/min
Centrifugal 1.5h, carries out recovery process；Take 50 μ l said mixtures and 50 μ l BHI culture medium, mix homogeneously, be then coated in containing
On the TSA flat board of 100 μ g/ml ampicillins, it is placed in the couveuse of 37 DEG C, incubated overnight；
T-pMD19-mecAThe extraction of plasmid and sequence verification；
T-pMD19-mecAThe double digestion of plasmid process andmecAThe gel of gene reclaims
T-pMD19-mecAPlasmid after BamH I and Hind III double digestion, carry out gel electrophoresis checking andmecAGene gel returns
Receive；
PET-21a (+) double digestion of plasmid processes and gel reclaims
PET-21a(+) plasmid uses plasmid DNA Mini Kit to carry out BamH I and Hind III enzymes double zyme after reclaiming
After cutting process, carry out gel recovery；
PET-21a (+) plasmid withmecAGene connects；
The design of oligos, synthesis, phosphorylation and annealing；
pCas9∷mecAThe structure of plasmid
PCas9 gel reclaims the double-strand oligos linked system of product and annealing: pCas9 gel reclaims product 12 μ l, after dilution
Oligos 1.5 μ l, T4 ligase 1 μ l, T4 ligase buffer 2 μ l, distilled water 3.5 μ l；
Condition of contact: overnight connect at 16 DEG C, afterwards, electricity turns 100 μ l DH5 α competent cells, selects monoclonal bacterium colony to extract
pCas9∷mecAPlasmid；
Electricity turn pET-21a (+)-mecAPlasmid is to E. coli expression strains BL21(D3) in；
Electricity turns pCas9 ∷mecAPlasmid and pCas9 plasmid are to BL21(D3)+pET-21a (+)-mecAIn competence antibacterial；
Electricity turns pCas9 ∷mecAPlasmid and pCas9 plasmid are to BL21(D3)+pET-21a (+) in competence antibacterial.
One the most according to claim 1 eliminates based on CRISPR/Cas9 technologymecAThe method of plasmid, its feature exists
In, amplimer required in PCR amplification procedure described in step (1) is:
F:CGGGATCCACTATTGATGCTAAAGTTCAAAAG
R:CCCAAGCTTATTCATCTATATCGTATTTTTTATTA.
One the most according to claim 1 and 2 eliminates based on CRISPR/Cas9 technologymecAThe method of plasmid, its feature
Being, the system of described PCR amplification includes: 2 × Taq PCR Master Mix 12.5 μ L, amplimer F 1 μ l, amplification is drawn
Thing R 1 μ l, MRSA DNA 2 μ l, distilled water 8.5 μ l.
4. eliminate based on CRISPR/Cas9 technology according to the one described in any one of claim 1 ~ 3mecAThe method of plasmid, its
Being characterised by, the process of described PCR amplification is:
<1>denaturation: heat 5 minutes at 94 DEG C；
<2>degeneration: heat 30 seconds at 94 DEG C；
<3>annealing: heat 30 seconds at 50 DEG C；
<4>extend: heat 1 minute at 72 DEG C；
<5>circular treatment: circulation<2>~<4>process 35 times；
<6>re-extend: continue at 72 DEG C to extend 10 minutes.
5. eliminate based on CRISPR/Cas9 technology according to the one described in any one of claim 1mecAThe method of plasmid, it is special
Levying and be, the condition of phosphorylation described in step (10): 37 times water-bath 1h, then 65 DEG C of water-bath 20min, enzyme inactivates.
6. eliminate based on CRISPR/Cas9 technology according to the one described in any one of claim 1mecAThe method of plasmid, it is special
Levying and be, the annealing described in step (10) is: add the Nacl oligos centering to phosphorylation of 2.5 μ l 1M, so
After water-bath is heated to 95 DEG C after system is put into, after 5 minutes close water-bath power supply so that it is during slow cooling to 50 DEG C,
In water-bath, slowly add frozen water be down to room temperature to temperature.
7. eliminate based on CRISPR/Cas9 technology according to the one described in any one of claim 1mecAThe method of plasmid, it is special
Levying and be, the extraction process of described plasmid is: select monoclonal bacterium colony, and be placed in containing 100 μ g/ml ampicillins is aseptic
In BHI fluid medium, carry out increasing bacterium, then extract plasmid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610426703.XA CN106167808A (en) | 2016-06-16 | 2016-06-16 | A kind of method eliminating mecA plasmid based on CRISPR/Cas9 technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610426703.XA CN106167808A (en) | 2016-06-16 | 2016-06-16 | A kind of method eliminating mecA plasmid based on CRISPR/Cas9 technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106167808A true CN106167808A (en) | 2016-11-30 |
Family
ID=57359265
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610426703.XA Pending CN106167808A (en) | 2016-06-16 | 2016-06-16 | A kind of method eliminating mecA plasmid based on CRISPR/Cas9 technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106167808A (en) |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834330A (en) * | 2016-12-30 | 2017-06-13 | 上海科技大学 | A kind of pCasSA plasmids and its application |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| CN108707620A (en) * | 2018-05-22 | 2018-10-26 | 西北农林科技大学 | A kind of Gene drive carriers and construction method |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| CN114634945A (en) * | 2022-04-27 | 2022-06-17 | 华南农业大学 | MccY recombinant integration engineering bacterium and construction method and application thereof |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104109687A (en) * | 2014-07-14 | 2014-10-22 | 四川大学 | Construction and application of Zymomonas mobilis CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-association proteins)9 system |
-
2016
- 2016-06-16 CN CN201610426703.XA patent/CN106167808A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104109687A (en) * | 2014-07-14 | 2014-10-22 | 四川大学 | Construction and application of Zymomonas mobilis CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-association proteins)9 system |
Non-Patent Citations (3)
| Title |
|---|
| 何玉婷等: "靶向HIF-1α基因的CRISPR/Cas9基因敲除质粒的构建与鉴定", 《郑州大学学报（医学版）》 * |
| 俞珺瑶等: "Cas9-sgRNA共质粒系统提高在AAVS1位点的打靶效率", 《生物技术通讯》 * |
| 刘静等: "金黄色葡萄球菌耐药相关基因及SCCmec 分型研究", 《现代预防医学》 * |
Cited By (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| CN106834330A (en) * | 2016-12-30 | 2017-06-13 | 上海科技大学 | A kind of pCasSA plasmids and its application |
| CN106834330B (en) * | 2016-12-30 | 2020-07-31 | 上海科技大学 | pCasSA plasmid and application thereof |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CN108707620A (en) * | 2018-05-22 | 2018-10-26 | 西北农林科技大学 | A kind of Gene drive carriers and construction method |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN114634945B (en) * | 2022-04-27 | 2023-08-04 | 华南农业大学 | McY recombinant integration engineering bacterium, construction method and application thereof |
| CN114634945A (en) * | 2022-04-27 | 2022-06-17 | 华南农业大学 | MccY recombinant integration engineering bacterium and construction method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106167808A (en) | A kind of method eliminating mecA plasmid based on CRISPR/Cas9 technology | |
| Ye et al. | Identification and molecular typing of Streptococcus agalactiae isolated from pond-cultured tilapia in China | |
| Lortal et al. | Tina wooden vat biofilm: a safe and highly efficient lactic acid bacteria delivering system in PDO Ragusano cheese making | |
| CN105176932B (en) | There is the method that the bacteriophage of extensive antibacterial activity prevented and handled coli-infection using to Escherichia coli | |
| CN103509729B (en) | A kind of produce the construction method of coenzyme Q10 engineering bacteria, engineering bacteria and application thereof | |
| CN104450629A (en) | Chinese soft-shell turtle aeromonas phage and application thereof | |
| CN106318940A (en) | High-temperature-resistant SOD protein, and cloning and purifying method thereof | |
| CN102329877A (en) | Multi-PCR (polymerase chain reaction) rapid detection method for pathogenic bacteria in water | |
| Bufe et al. | Differential transcriptome analysis of enterohemorrhagic Escherichia coli strains reveals differences in response to plant-derived compounds | |
| CN105969765A (en) | Quick extraction kit for staphylococcus aureus genome DNA and extraction method | |
| CN105255861B (en) | Directly extract the method and kit of 3 kinds of DNA of pathogenic in milk | |
| Makhado et al. | Detection of virulence gene of Shiga toxin-producing Escherichia coli (STEC) strains from animals with diarrhoea and water samples in the North-West Province, South Africa | |
| Alonso et al. | Increased excision of the Salmonella prophage ST64B caused by a deficiency in Dam methylase | |
| CN113234839B (en) | Drying-resistant genotyping method for cronobacter sakazakii | |
| WO2022141936A1 (en) | Standard reference strains of staphylococcus argenteus containing specific molecular target and detection and use thereof | |
| AU2020103778A4 (en) | Primer Set for Detection of Streptococcus agalactiae, Detection Kit and Multiplex PCR Detection Method | |
| WO2022141939A1 (en) | Vibrio parahaemolyticus standard strains containing specific molecular target, and detection and use thereof | |
| CN105087814B (en) | A kind of the multiplex PCR detection primer and detection method of detection four kinds of pathogens of sheep | |
| Hu et al. | Isolation and characterization of Shiga toxin–producing Escherichia coli from retail beef samples from eight provinces in China | |
| CN111676160A (en) | Application of beautiful millettia root endophyte RH5 in promoting strong growth of cows | |
| Redweik et al. | Evaluation of live bacterial prophylactics to decrease IncF plasmid transfer and association with intestinal small RNAs | |
| Montso et al. | Genetic diversity and whole genome sequence analysis data of multidrug resistant atypical enteropathogenic Escherichia coli O177 strains: An assessment of food safety and public health implications | |
| CN109652409A (en) | A method of extracting aureus plasmid | |
| CN117551589B (en) | Use of lysate of bifidobacterium longum subspecies infantis | |
| CN110499374B (en) | Triple PCR primer group for detecting Klebsiella pneumoniae, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20161130 |
|
| WD01 | Invention patent application deemed withdrawn after publication |