CN106086226B

CN106086226B - Plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof

Info

Publication number: CN106086226B
Application number: CN201610726380.6A
Authority: CN
Inventors: 朱伟; 周鑫; 单霞; 齐炼文; 黄泽波; 王同杉; 吴晶晶; 朱明霞; 王魏魏; 陈彦; 邢昌赢
Original assignee: Individual
Current assignee: Individual
Priority date: 2016-08-25
Filing date: 2016-08-25
Publication date: 2020-02-14
Anticipated expiration: 2036-08-25
Also published as: CN106086226A

Abstract

The invention discloses a plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof, wherein the marker is one or more of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3 p. The plasma miRNA is used as a novel biomarker and has the characteristics of good stability, easy minimally invasive acquisition, and high sensitivity and specificity. The development and utilization of the molecular markers can provide a new direction for the diagnosis and further treatment of various diseases including IgA nephropathy. The research can more specifically obtain the IgA nephropathy plasma miRNA marker with clinical diagnosis potential. The study demonstrated the reliability and reproducibility of this group of mirnas as noninvasive markers for the diagnosis of IgA nephropathy.

Description

Plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof

Technical Field

The invention belongs to the field of genetic engineering nephropathy, and relates to a plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof.

Background

IgA nephropathy (IgAN) is the most common primary glomerulonephritis characterized by mesangial cell proliferation, increased stroma, and extensive IgA deposition. IgA nephropathy is currently diagnosed by confirmation of renal biopsy. However, renal biopsy is an invasive examination procedure that cannot be repeated on the same patient. Early diagnosis of IgA nephropathy is well-predicted, but over 20 years of disease progression, more than 40% of patients enter irreversible end-stage renal failure. Therefore, the discovery of non-invasive biomarkers is of great significance for the clinical early diagnosis of IgA nephropathy.

micro-RNAs (mirnas) are a class of small non-coding RNA molecules of about 22 nucleotides in length that are widely involved in various life processes through post-transcriptional regulation. Researches show that the expression of miRNA has up-regulation and down-regulation of different degrees in IgA nephropathy, and the miRNA is easy to obtain and has relatively stable existing form, and can resist the dissolving action of nuclease in vivo, thereby laying the foundation for the miRNA to be used as a novel marker. However, the results of the study are not completely consistent due to differences in the study methods and the included population. At present, no consistent method suitable for clinical miRNA detection exists.

The research aims to find the plasma miRNA with potential diagnostic value for the IgA nephropathy by researching the IgA nephropathy plasma of a large sample by using an Exiqon miRNA qPCR panel chip and a qRT-PCR-based relative quantification method. If the miRNA is used for designing a diagnostic kit for IgA nephropathy, the diagnosis and treatment level of IgA nephropathy in China can be promoted, and a thought is provided for further research on IgA nephropathy in the future.

Disclosure of Invention

The invention aims to provide a plasma miRNA marker related to the auxiliary diagnosis of IgA nephropathy.

The invention also aims to provide the application of the plasma miRNA marker and the primer thereof in preparing an IgA nephropathy auxiliary diagnosis kit and preparing a medicament for treating IgA nephropathy.

It is still another object of the present invention to provide a kit and a medicament for use in the auxiliary diagnosis and treatment of IgA nephropathy.

The purpose of the invention can be realized by the following technical scheme:

a plasma miRNA marker related to IgA nephropathy aided diagnosis is one or more of miR-148a-3p (UCAGUGCACUUACAGAACUUGU), miR-150-5p (UCUCCCAACCCUUGUACCAGUGAGUGAGUG), miR-20a-5p (UAAAGUGCUUAAUAGUGCAGGUAG) and miR-425-3p (AUCGGGAAUGUCGUCCGCCC). The plasma miRNA marker is preferably a combination of two or more of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p, and is further preferably a combination consisting of four miRNAs of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3 p.

The application of the plasma miRNA marker in the auxiliary diagnosis of IgA nephropathy.

The plasma miRNA marker is applied to preparation of an IgA nephropathy auxiliary diagnosis kit or a medicine for treating IgA nephropathy.

A primer of a plasma miRNA marker related to the auxiliary diagnosis of IgA nephropathy, which comprises a primer of one or more miRNAs in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3 p; preferably primers containing two or more of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in plasma miRNA; further preferred are primers comprising four miRNAs of plasma miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3 p.

The primer is applied to the auxiliary diagnosis of IgA nephropathy or the preparation of an auxiliary diagnosis kit for IgA nephropathy.

An IgA nephropathy aided diagnosis kit is used for detecting one or more miRNAs in plasma miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3 p; preferably, the kit is used for detecting two or more miRNAs in plasma miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3 p; further preferably, the miRNA is used for detecting four miRNAs of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in plasma miRNAs.

An IgA nephropathy aided diagnosis kit comprises primers of one or more miRNAs in miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in plasma miRNAs; preferably primers containing two or more of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in plasma miRNA; further preferably, the primer contains four miRNAs of miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p in plasma miRNAs.

The kit may also comprise reagents commonly used in PCR technology, such as reverse transcriptase, buffer, dNTPs, MgCl₂DEPC water and Taq enzyme, etc.; standards and/or controls may also be included.

The sequence of each miRNA in the plasma miRNA markers miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p related to the IgA nephropathy diagnosis is disclosed, but creative work is required for a person skilled in the art to combine the miRNA markers individually as the auxiliary diagnosis markers of the IgA nephropathy. Amplification primers of all miRNA markers can be obtained by market purchase, and the primers of the plasma miRNA markers used in the embodiment of the invention are specific miRNA stem-loop RT-PCR primers synthesized and produced by Sharpbo, Guangzhou.

Specifically, the technical solution of the present invention to solve the problem includes: (1) establishing a unified specimen library and a database: standard procedures (SOP) were used to collect blood samples meeting the standards and the system collected complete demographic and clinical data. (2) Differential expression profiling of plasma mirnas: differentially expressed plasma miRNAs in IgA nephropathy and normal control populations were analyzed and further large sample multi-stage validation of differentially expressed miRNAs was performed. (3) The ability of these mirnas to diagnose IgA nephropathy is clear by multi-stage validation. (4) Development of a plasma miRNA diagnosis kit: miRNAs diagnostic kit is developed according to the differential expression miRNA in the plasma of IgA nephropathy patients and normal people, and noninvasive auxiliary diagnosis of IgA nephropathy patients is realized. (4) Analyzing the expression condition of the miRNA in the plasma of the IgA nephropathy patient, revealing the relationship between the miRNA and the IgA nephropathy, and providing a basis for developing a medicament which is possibly related to the miRNA and is used for treating the IgA nephropathy in the future.

The inventor collects blood samples meeting the standard by a Standard Operation Program (SOP), systematically collects complete demographic data and clinical data, and adopts an Exiqon miRNA qPCR panel chip, a qRT-PCR method and the like.

The experimental method of research mainly includes the following parts:

1. study sample selection: pathologically confirmed IgA nephropathy patients. The normal control is a normal population for physical examination in a hospital.

2, initial screening of an Exiqon miRNA qPCR panel chip: and (3) carrying out RNA extraction on the plasma mixed sample by using a TRIZOL-LS reagent, and carrying out qRT-PCR operation to obtain a primary screening result.

3. Training set and verification set: RNA extraction was performed on each plasma sample using AM1556 kit (ABI), cDNA samples were obtained by reverse transcription reaction, and PCR reaction was performed by adding PCR primers and SYBR Green fluorescent dye. And (5) comparing the Ct values of the standard substance to obtain the miRNA content in the sample.

4. Statistical analysis: exercise chi²Tests, paired t tests, and non-parametric rank-sum tests compare the differences in miRNA expression levels among different study groups. The diagnostic value of plasma miRNA is confirmed by calculating ROC curve analysis.

At present, through carrying out systematic expression analysis on miRNA in peripheral plasma of IgA nephropathy patients, the research group of the invention has found a group of 4 IgA nephropathy plasma microRNA markers (miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p) with clinical diagnosis potential.

The invention has the beneficial effects that:

1. compared with the traditional IgAN marker, the plasma miRNA is used as a novel biomarker and has the characteristics of good stability, easy minimally invasive acquisition, high sensitivity and high specificity. The development and utilization of the molecular markers can provide new directions for the diagnosis and further treatment of various diseases including IgAN.

2. Researchers performed rigorous, multistage validation and evaluation of differentially expressed mirnas in plasma of IgAN and normal control populations by Exiqon miRNA qPCR panel chip and qRT-PCR-based relative quantitation. The reliability and reproducibility of this group of mirnas as noninvasive markers for diagnosing IgA nephropathy were confirmed.

3. Researchers found that miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p expressed in patients with grade I IgA nephropathy (graded by Lee) was significantly higher than in patients with grade II-V IgA nephropathy. The miRNA group is shown to have higher value in early IgA nephropathy diagnosis. These results will provide new ideas for future studies on the mechanism of these mirnas for IgA nephropathy and for the treatment of IgA nephropathy with these mirnas.

Drawings

FIG. 1: experimental flow chart.

FIG. 2: 4 miRNAs highly expressed in IgA nephropathy plasma.

FIG. 3: ROC curve analysis was performed on the obtained mirnas.

a: training a set; b: a verification set; c: and (4) a collection of a training set and a verification set.

FIG. 4: ROC curve analysis was performed on IgA nephropathy with 4 miRNAs on different Lee grades.

a: IgAN I grade; b: IgAN II grade; c: IgAN III grade; d: IgAN IV-V grade.

Detailed Description

The inventor collects a large number of IgA nephropathy patients and venous plasma samples of normal physical examination people from the first subsidiary hospital of Nanjing medical university in 2013 to 2015, and finally selects 83 samples of IgA nephropathy and 82 samples of normal controls as experimental samples for initial screening and subsequent series of qRT-PCR verification of an Exiqon miRNA qPCR panel chip through sorting sample data. Selected patient plasma samples were pathologically confirmed as patients with IgA nephropathy. And the system collects the demographic data and clinical data of the samples.

Referring to the flowchart (FIG. 1), 20 IgA nephropathy samples and 10 normal controls were randomly selected from IgA nephropathy and normal control plasma samples, and 2 IgA nephropathy plasma mixed samples and 1 normal mixed sample (one mixed sample was a 2ml sample obtained by mixing 10 200ul plasma samples) were mixed, respectively. The 3 mixed samples were subjected to preliminary screening and analysis of the Exiqon miRNA qPCR panel chip, and the specific steps refer to the specifications of the Exiqon miRNA qPCR panel chip:

1. plasma extraction

Plasma samples were removed and centrifuged at 3000x g for 5min after thawing to remove some debris and some insoluble components. Transfer 250ul of supernatant to a new 1.5ml tube, add 750ul TRIZOL-LS, and shake vigorously for 5 s.

2. Two-phase separation

After homogenization the sample is incubated for 5 minutes at 15 to 30 ℃. 0.2ml of chloroform was added to 1ml of the sample homogenized with TRIZOL-LS reagent, and the cap was closed. After manually shaking the tube vigorously for 15 seconds, the tube is incubated at 15 to 30 ℃ for 2 to 3 minutes. Centrifuge at 13,000g for 15 minutes at 4 ℃.

RNA precipitation

The aqueous phase was transferred to a fresh centrifuge tube. The aqueous phase was mixed with isopropanol to precipitate the RNA therein, the amount of isopropanol added was: to 1ml of TRIZOL-LS reagent homogenate was added 0.5ml of isopropanol and 5ul of glycogen. Standing at 4 ℃ for half an hour to separate out RNA as much as possible. Centrifuge at 13,000g for 15 minutes at 4 ℃.

RNA washing

The supernatant was removed and at least 1ml of 75% (v/v) ethanol was added to each 1ml of the TRIZOL-LS reagent homogenate sample to wash the RNA pellet. The mixture was allowed to stand for 10 minutes and then centrifuged at 10000g at 4 ℃ for 5 minutes.

5. Re-solubilization of RNA pellets

The ethanol solution was removed, the RNA pellet was air-dried for 5-10 minutes, repeatedly blown several times with a gun by adding RNase-free water, and then incubated at 55 to 60 ℃ for 10 minutes.

6. And (3) measuring the concentration:

typically, 5. mu.g RNA/50ml plasma is obtained.

cDNA Synthesis

(1) Diluting template RNA: 20-25 ng template RNA was diluted to 14ul (final concentration 1.492-1.786 ng/. mu.l) using DEPC water.

(2) Preparing a reaction solution: the 5 × Reaction Buffer and DEPC water were dissolved on ice and shaken well. The Enzyme mix was placed in an ice box at-20 ℃ and gently mixed before use and then placed on ice. All reagents were used after centrifugation.

(3) Preparing a reaction solution: the reaction solution in the following table was prepared

(4) Mix and centrifuge reagents: and shaking or pumping the reaction solution uniformly and then centrifuging to ensure that all the solutions are thoroughly and uniformly mixed.

(5) Reverse transcription and heat inactivation: after incubating the reaction solution at 42 ℃ for 60 minutes, the reverse transcriptase was inactivated by incubating at 95 ℃ for 5 minutes.

8.Real-Time PCR

Reagent:

Nuclease free water(Exiqon)

SYBR^TMGreen master mix(Exiqon)

cDNA template

ROX(Invitrogen)

miRNA PCR ARRAY(Exiqon)

The instrument comprises the following steps:

ABI PRISM7900system(Applied Biosystems)

(1) preparation of Real-time PCR reagents: the prepared cDNA template, DEPC water and SYBR^TMGreen mastermix was dissolved on ice for 15-20 minutes.

(2) Diluting the cDNA template: the cDNA template obtained from the RT reaction was diluted 110-fold with nucleoease free water (for example, 2180. mu.l of nucleoease free water was added to 20. mu.l of the reaction solution).

(3) Mixing all reaction reagents:

A. after simple centrifugation of the PCR plate, the membrane was removed.

B. The 110-fold diluted cDNA template was mixed with 2 × SYBR Green master mix as described in 1: mixing at a volume ratio of 1.

C. Inverting and mixing the reaction solution and centrifuging

D. Adding the mixed reaction solution to each well in the plate

E. Resealing the PCR plate

(4) Subjecting the PCR plate to simple low-temperature centrifugation

(5) Real-time PCR amplification: real-time PCR amplification and dissolution curve analysis were performed according to the reaction conditions in the following table.

Real-time PCR cycling conditions are as follows:

and (3) data analysis: using the Delta Ct method

Preliminary data analysis was performed using software attached to the PCR instrument to obtain the original Cq value (Cp or Ct, which may vary from instrument to instrument).

We propose to use GenEx qPCR analysis software (www.exiqon.com/mirna-pcr-analysis) for standard and in-depth data analysis.

a. The Δ Ct for each pathway-associated gene in each treatment group was calculated.

ΔCt(group 1)＝average Ct–average of HK genes’Ct for group 1array

ΔCt(group 2)＝average Ct–average of HK genes’Ct for group 2array

b. The Δ Δ Ct for each gene in 2 PCR arrays (or two groups) was calculated.

Δ Δ Ct ═ Δ Ct (group 2) - Δ Ct (group 1)

Remarking: typically group 1 is the control and group 2 is the experimental group.

c. Through 2^-ΔΔCtThe difference in expression between the corresponding genes in group 2 and group 1 was calculated.

After the initial screening of the chip, 48 differentially expressed mirnas (all over 1.5-fold difference in 2 IgA nephropathy plasma pooled samples relative to normal samples) were obtained as shown in the following table.

Verifying 48 differential expression miRNAs obtained by primary screening by a relative quantitative method based on qRT-PCR through a training set and a verification set, wherein the method comprises the following specific steps:

1. plasma RNA extraction: the ABI plasma RNA extraction kit (AM1556) was selected, and 200ul of RNA was extracted from each sample according to the kit instructions, and finally dissolved in 100ul of DEPC water.

Preparation of cDNA:

1) reverse transcription experiment was performed using a 50. mu.L reaction system

The above reaction system was mixed well and after instantaneous centrifugation, the reaction was carried out according to the following procedure:

2) the following reactants are added into the reaction system after the reaction

3.qPCR

1) Using a 5. mu.L reaction system, the following ratio was used for the test

The reaction system is mixed evenly, placed in a real-time quantitative PCR instrument after instantaneous centrifugation, and reacted according to the following procedures:

the dissolution profile was added after the reaction was complete.

And (3) data analysis: statistical analysis was performed using SPSS 16.0 software to obtain a set of 4 mirnas that were consistent with high expression in IgA nephropathy plasma in both training and validation sets: miR-148a-3P, miR-150-5P, miR-20a-5P and miR-425-3P (the expression of 4 miRNAs in IgAN patients is obviously higher than that in a normal control group, P is less than 0.05, and the picture 2). ROC curve analysis is carried out on the obtained miRNA (P values in a training set, a verification set and a collection set of the training set and the verification set are all less than 0.05, and figure 3), and the molecular marker consisting of the 4 miRNA can well distinguish IgA nephropathy patients from normal people. And through subgroup analysis, the 4 mirnas were found to be significantly more expressed in the Lee grade I IgA nephropathy patients than in the II-V grade IgA nephropathy patients (fig. 4).

The kit comprises a batch of plasma miRNA qRT-PCR primers, and can also comprise common reagents required by corresponding PCR technologies, such as: reverse transcriptase, buffer, dNTPs, MgCl2, DEPC water, fluorescent probes, RNase inhibitors, Taq enzyme and the like can be selected according to the specific experimental method, the common reagents are well known to those skilled in the art, and in addition, standard substances and controls (such as quantitative standard normal human samples and the like) can be provided. The kit has the value that the possibility of diagnosing the IgA nephropathy of a patient from which a sample is derived is assisted by detecting the expression content of miRNA in a plasma sample through the simplest fluorescence method only by plasma without other tissue samples. The plasma miRNA is convenient to detect, accurate in quantification and capable of greatly improving the sensitivity and specificity of disease diagnosis, so that the kit can help to guide diagnosis and further individualized treatment when put into practice.

Claims

1. Application of primers for detecting four miRNAs (miR-148a-3p, miR-150-5p, miR-20a-5p and miR-425-3p) in plasma in preparation of IgA nephropathy auxiliary diagnosis kits.

2. The use of claim 1, wherein the kit further comprises reagents commonly used in PCR technology.