CN105969885A

CN105969885A - Genetic diagnosis kit of Alzheimer's disease

Info

Publication number: CN105969885A
Application number: CN201610473965.1A
Authority: CN
Inventors: 陈实; 黎寒
Original assignee: JIANGSU XIONGMING MEDICAL TECHNOLOGY Co Ltd
Current assignee: JIANGSU XIONGMING MEDICAL TECHNOLOGY Co Ltd
Priority date: 2016-06-24
Filing date: 2016-06-24
Publication date: 2016-09-28

Abstract

The invention discloses a genetic diagnosis kit of Alzheimer's disease. The kit can detect, research and report 10 virulence genes related to Alzheimer's disease, including APP, APOE, PSEN1, PSEN2, GSK3beta, DYRK1A, Tomm40, CLU, PICALM and TAU. A detecting method comprises the following steps: designing and synthesizing specific primers of all genes, collecting the sample of a individual to be detected, adopting the RT-PCR technology to carry out sequencing analysis on obtained specificity DNA products of all genes, comparing the sample sequence with the normal gene sequence, and analyzing whether pathogenic mutations exist to evaluate the morbidity risk of the individual. The genetic diagnosis kit of Alzheimer's disease can detect different pathogenic mutation sites of CDS at a time and has the advantages of high simpleness, convenience, rapidity and sensitivity, reliable preparation and excellent specificity.

Description

A kind of gene diagnosis kit of alzheimer's disease

Technical field

Invention relates to the gene diagnosis kit of a kind of hereditary, is a kind of Alzheimer's disease in particular The gene diagnosis kit of (being also called senile dementia), belongs to technical field of molecular biology.

Background technology

Alzheimer's disease (Alzheimer ' s disease, AD), it is also called senile dementia, is that one is mainly in old people The neurodegenerative diseases of group.First this disease was recorded by German doctor Alois Alzheimer in 1906 and describes, and showed as (1) its characteristic pathological changes into amyloid-beta deposition and Tau protein hyperphosphorylation forms neuron in neurocyte Fibre matting, neuron loss companion's glial cells hyperplasia, for nerve retrograde affection.This disease Early manifestation is for slightly remembering barrier Hindering, along with the development of the state of an illness, the cognitive competence (such as memory, computing power, thinking judgment etc.) of patient gradually fails, intelligence subtracts Moving back, emotion and aphasis occur, final nervous function is seriously damaged, and causes death；(2) at U.S. AD and Relevant disease becomes State Public Health problem, and its prevalence was at 65 years old and be 3～11% above, and the age was 25% more than 85 years old ～47%.Data statistics, current China 65 one full year of life above population is about 1.3 hundred million, accounts for the 10.1% of total population, ill multiple is born in Over-65s old man, accounts for 4%-5%, and with age, prevalence increases, and Alzheimer's disease later life can not be certainly Reason, has badly influenced physical and mental health and the quality of life of old people, to patient. and family and society bring heavy economy and bear Load.

Alzheimer's disease onset is hidden, and makes slow progress.In the stage in early days, it is owing to normal aging is cognitive that AD is difficult to qualification Dysfunction or mild cognition impairment (mild cognitive impairment), what the latter often imply that AD can Energy.Its cognitive dysfunction is comprehensive, is roughly divided into the early, middle and late phase, wherein mainly shows as hypomnesis, especially in early days It is based on nearly memory disorder, and patient can take care of oneself daily life in the meantime, therefore how out in the cold.Along with the development of the state of an illness, It is more longlasting that symptom often shows as aphasis, and personality aspect occurs that interest and initiating are lost, Blunting or be difficult to control to, Thinking of logic, sports coordination ability, memory function arrives total loss step by step, the most actively takes food because of dysphagia, lies in bed all the year round, Last because of asthenic body, many secondary infection pneumonia, pressure ulcer and cardiorenal function die of exhaustion and die.

The diagnosis of AD is according to US National neuropathy, communication obstacle and apoplexy institute-alzheimer and phase Related disorders association (National Institute of Neurological Communicative Disorders and Stroke-Alzheimer Disease and Related Disorders Association, NINCDS-ADRDA) mark Accurate.According to this criteria classification " make a definite diagnosis " (clinical diagnosis with pathology confirm), " being likely to " (typical clinical syndrome and without group Knit to confirm) or " possible " (atypia clinical characters does not has selectable diagnosis, do not has proved by pathology).According to NINCDS- The diagnostic criteria of ADRDA, an AD made a definite diagnosis is to have through clinical diagnosis ill illustration reality.The disease that clinical diagnosis " is likely to " Example 86%～90% obtains the support of postmortem.Along with the understanding growth to lysis, the clinical phenotypes of AD is no longer to have exclusiveness Clause.Making a definite diagnosis it must also be in conjunction with the extensive medial temporal lobe all brain structures Imageology of nuclear magnetic resonance, positron emission The molecular imaging exception of body layer scanning (positron emission tomography, PET) and cerebrospinal fluid (cerebrospinal fluid, CSF) analyzes, the biomarker etc. of amyloid-beta.

It is a clinical challenge that commitment before comprehensive AD occurs carries out diagnosing, and currently mainly uses in detail Cognition and function evaluating method screen.The mental sickness diagnostic & statistical manual of American Psychiatric Association is announced Ah The silent sick diagnostic criteria in Wurz sea includes 8 cognitive domains such as memory, language, perception, is widely used in Mini-Mental shape State checks and assessment.But owing to alzheimer disease symptoms has invisible and reversibility so that this syndrome of EARLY RECOGNITION becomes For difficulty.

Comprehensive assessment according to above-mentioned psychological test and formal diagnosis also combine coherent video change etc., and typical AD is also It is not difficult to judge, but for the strictest.Some disease (such as depression, hypothyroidism) and A Erzi sea Silent disease clinical manifestation is much like).Diagnosis AD must also consider and differentiate the internal medicine relevant with dysmnesia and related symptoms. neural Section or psychiatric condition, such as vascular dementia, progressive supranuclear plasy, cerebral amyloid angiopathy etc., to prevent mistaken diagnosis.This Outward, due to the delay of the doctor in charge and patient do not recognize the early stage disease of AD as, there is a certain degree of failing to pinpoint a disease in diagnosis.Early diagnosis AD suffers from Person can allow they friends and family formulate and participate in treatment plan, in order to the preferably neurodegenerative processes of reply appearance in future.Existing Some medicines likely provide useful help to patient in terms of improving disease condition development.Research evidence also indicates that, in early days Treatment can save economic benefit to patient and tender and entire society.In view of the challenge and the effect that timely and accurately diagnose AD Benefit, is badly in need of contributing to the appearance of alzheimer's disease early diagnosis instrument at present.

The cause of disease of alzheimer's disease is complicated, relates to the mutual synergism of the many factors such as genotypic environment.Along with molecule is raw Developing rapidly of thing, inherited genetic factors is increasingly paid close attention to.More and more Disease-causing gene quilts relevant to alzheimer's disease Find, including APP, PSEN1, PSEN2, GSK3 β etc..Particularly app gene and be positioned at No. 1, PSEN1 and PSEN2 on No. 14 Gene, in vitro and experiments in vivo, demonstrate gene mutation with fall ill closely related.Causing a disease of the Disease-causing gene having now been found that Sudden change also has multiple, as PSEN1 has reported more than 100 mutational site, and Gene A PP pathogenic mutation up to more than 60.These sudden changes Including base substitution, disappearance, frameshit, insertion mutation etc., it is distributed on each exon.

For alzheimer's disease, in early days the most invisible clinical symptoms is inconspicuous by force, owing to gene mutation is alzheimer One of disease morbidity key factor, utilizing gene diagnosis will be the effective means of early diagnosis.Under this technology helps, doctor can Just examination high-risk group can be gone out before patient does not falls ill.It directly detects structure or the function of a certain specific gene of examinee The most abnormal, relative to routine diagnosis, more focus on genes of individuals state, be possible not only to patient's illnesses is judged, also Can be normal but carry the susceptibility of certain specified disease gene or specified disease and judge to phenotype.Polymerase chain reaction Should (polymerase chain reaction is called for short round pcr) be the technology of amplification in vitro specific DNA fragment, have fast Speed, the feature such as sensitive and high specificity.

Traditional ApoE gene visual result is reliable, but once can only differentiate a mutational site.Due to Alzheimer's disease Disease-causing gene is many, can behave as again different mutational sites, and mostly occur in protein-coding region in each gene, Application RT-PCR technology combines the most fast-developing gene sequencing technology, by design of primers in protein-coding region (CDS) both sides Near, can disposably detect the different loci sudden change of all exons in mono-Disease-causing gene of AD, there is the higher suitability. Have not yet to see patent and report that AD disease molecules is diagnosed by this technology, this patent method be established as quickly examining of AD Disconnected and early screening provides technical support.

List of references:

(1) Berchtold NC, Cotman CW. Evolution in the conceptualization of dementia and Alzheimer’s disease: Greco-Roman period to the 1960s. Neurobiol Aging, 1998, 19(3): 173-89

(2) Selkoe DJ. Alzheimer ' s disease:genes, proteins, and therapy. Physiol Rev, 2001, 81(2): 741-66

Summary of the invention

In view of alzheimer's disease Disease-causing gene is many, and each Disease-causing gene can behave as different mutational sites, Duo Shuodou Being distributed in protein-coding region, application RT-PCR technology combines the most fast-developing gene sequencing technology, can conveniently detect Ah Write from memory multiple sudden changes of all exons in one Disease-causing gene of disease in Wurz sea.The sudden change of all Disease-causing genes listed by comprehensive reagent box Situation, it is possible to obtain test sample and the comprehensive information of alzheimer's disease related genes.Being established as of this patent method The quick diagnosis of alzheimer's disease and early screening provide technical support.

It is an object of the invention to provide gene diagnosis kit and the detection method of a kind of alzheimer's disease, this test kit Easy and simple to handle quickly, accurately and reliably, specificity good, can be applicable to patient, the normal carrier of phenotype and prenatal gene diagnosis, from And it is clinical diagnosis and the offer reference of prophylactic treatment in early days.

The present invention is according to the achievement of the domestic and international molecule genetics research to alzheimer's disease (AD), for multiple and AD Relevant Disease-causing gene, including APP, APOE, PSEN1, PSEN2, GSK3 β, DYRK1A, Tomm40, CLU, PICALM, TAU, Ah Wurz sea write from memory morbidity closely related with the protein-coding region of said gene (CDS) gene mutation.RT-PCR method is utilized to combine base Because of sequencing technologies, reach the purpose of this disease risk of complete detection.

Concrete technical scheme is:

According to an aspect of invention, the gene diagnosis kit of a kind of alzheimer's disease, include for expanding following base The primer sets of cause: APP, APOE, PSEN1, PSEN2, GSK3 β, DYRK1A, Tomm40, CLU, PICALM, TAU.

Described primer sets by following primer to being formed, each primer centering be respectively by a forward primer and Article one, reverse primer is formed, and its primer sequence is as follows:

For expanding the primer pair of app gene: SEQ ID NO.1～2；

For expanding the primer pair of APOE gene: SEQ ID NO.3～4；

For expanding the primer pair of PSEN1 gene: SEQ ID NO.5～6；

For expanding the primer pair of PSEN2 gene: SEQ ID NO.7～8；

For expanding the primer pair of GSK3 β gene: SEQ ID NO.9～10；

For expanding the primer pair of DYRK1A gene: SEQ ID NO.11～12；

For expanding the primer pair of Tomm40 gene: SEQ ID NO.13～14；

For expanding the primer pair of CLU gene: SEQ ID NO.15～16；

For expanding the primer pair of PICALM gene: SEQ ID NO.17～18；

For expanding the primer pair of TAU gene: SEQ ID NO.19～20.

According to another aspect of the present invention, the gene diagnosis reagent of the alzheimer's disease of above-mentioned primer sets is included Box.

Described gene diagnosis kit, the composition of the amplification system at place is by each primer: cDNA template 2.0 μ l, Reactant mixture 25.0 μ l, forward primer 2.0 μ l, reverse primer 2.0 μ l, dd H₂O complements to 50 μ l.

Described gene diagnosis kit, also includes RNA and extracts reagent and Reverse Transcription.

The using method of test kit, comprises the steps: the extraction of (1) sample tissue RNA；(2) by gained RNA reverse transcription Become cDNA；(3) by described primer sets, cDNA sample is carried out PCR reaction；(4) gained amplification of DNA fragments is checked order；(5) The CDS region base of sequencing result and each gene is compared, it is judged that with or without sudden change.

Beneficial effect

The alzheimer's disease gene diagnosis kit of the present invention and detection method, be to alzheimer's disease according to both at home and abroad Molecular biology and the result of genetics research, detect a series of Disease-causing genes relevant to alzheimer's disease, including APP, APOE, PSEN1, PSEN2, GSK3 β, DYRK1A, Tomm40, CLU, PICALM, TAU, according to each gene conserved regions design primer, Utilize primer specificity to expand whole CDS districts of each gene, set up the RT-PCR reaction system optimized and combine sequencing technologies guarantor The rapidity of testing result, accuracy and susceptiveness are demonstrate,proved.Use the gene diagnosis kit of the present invention, can be disposable with single tube Pathogenic mutation site whole in being detected simultaneously by the CDS district of a gene for PCR, it is possible to cover Most patients and carrier Diagnosis, have simplicity, efficiently, the advantage such as accurately.The method can operate with patient, carrier and prenatal diagnosis, can be clinical disease Sick diagnosis provides important reference frame, is also beneficial to the treatment of the early prevention to this disease, has huge popularizing and promoting Using value.

Accompanying drawing explanation

It is that the test kit provided according to the present invention carries out RT-RCR detection normal cell strain ND29194 pathogenic mutation with figure below Site electrophoresis result.

Fig. 1 is CLU gene amplification product electrophoretogram, and swimming lane 1 is Marker, and swimming lane 2 is CLU；

Fig. 2 is APP gene amplification product electrophoretogram, and swimming lane 1 is Marker, and swimming lane 2 is APP；

Fig. 3 is APOE gene amplification product electrophoretogram, and swimming lane 1 is APOE, and swimming lane 2 is Marker；

Fig. 4 is PSEN1 gene amplification product electrophoretogram, and swimming lane 1 is PSEN1, and swimming lane 2 is Marker；

Fig. 5 is PSEN2 gene amplification product electrophoretogram, and swimming lane 1 is PSEN2, and swimming lane 2 is Marker；

Fig. 6 is GSK3 β gene amplification product electrophoretogram, and swimming lane 1 is GSK3 β, and swimming lane 2 is Marker；

Fig. 7 is DYRK1A gene amplification product electrophoretogram, and swimming lane 1 is Marker, and swimming lane 2 is DYRK1A；

Fig. 8 is Tomm40 gene amplification product electrophoretogram, and swimming lane 1 is Marker, and swimming lane 2 is Tomm40；

Fig. 9 is PICALM gene amplification product electrophoretogram, and swimming lane 1 is PICALM, and swimming lane 2 is Marker;

Figure 10 is TAU gene amplification product electrophoretogram, and swimming lane 1 is Marker, and swimming lane 2 is TAU；

Figure 11 is Marker each stripe size scattergram.

Detailed description of the invention

Combine accompanying drawing below by detailed description of the invention the present invention is described in further detail.Following example are at this Implement under premised on bright technical scheme, give detailed embodiment and specific operation process, but the protection of the present invention Scope is not limited to following embodiment.Unreceipted concrete technology or condition person in embodiment, described by the document in this area Technology or condition (such as write with reference to J. Pehanorm Brooker etc., " the Molecular Cloning: A Laboratory guide " that yellow training hall etc. is translated, the 3rd Version, Science Press) or carry out according to product description.Agents useful for same or instrument unreceipted production firm person, be permissible By city available from conventional products.

The determination of embodiment 1 gene, design of primers and test kit composition and amplification program

10 genes that the present invention relates to are relevant to AD disease, and existing document reports its dependency.The sequence of 10 genes can To be obtained by following approach.

Gene order can be retrieved according to following gene I/D at network address http://www.ncbi.nlm.nih.gov/.

Table 1 gene I/D

In design of primers process, mainly it is designed according to each gene conserved region, utilizes primer specificity to expand each gene All CDS districts.Forward and reverse primer separately design in 5'-UTR and 3'-UTR district, it is ensured that amplified production can cover whole CDS district, it is possible to make the mutational site in this test kit detection each Disease-causing gene whole CDS district.

As a example by CLU gene, its mRNA sequence is as follows, divides down design land corresponding to primer into, uses The part that bracket [] has included is CDS district.The amplified production of design primer can comprise whole CDS section length.

GCTTTCCGCGGCATTCTTTGGGCGTGAGTCATGCAGGTTTGCAGCCAGCCCCAAAGGGGGTGTGTGCGCGAGCAGAG CGCTATAAATACGGCGCCTCCCAGTGCCCACAACGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCGCTGA CCGAGGCGTGCAAAGACTCCAGAATTGGAGGC[ATGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTG GGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGT ACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAG CGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGA GACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGA AACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTC CTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCA GACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGACGAGCTCTTCCAGGACAGGT TCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCCTTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTT CCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCC CTTCCTTGAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAGCACCCGCCAA CAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATCCGCCACAACTCCACGGGCTGCCTGCGG ATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCT GCGGCGGGAGCTCGACGAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTACC AGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCCGGCTGGCAAAC CTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACGGTGGCTTCCCACACTTCTGACTCGGACGTTCCTTC CGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGA AGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAGGAGTGA] GATGTGGATGTTGCTTTTGCACCTACGGGGGCATCTGAGTCCAGCTCCCCCCAAGATGAGCTGCAGCCCCCCAGAGA GAGCTCTGCACGTCACCAAGTAACCAGGCCCCAGCCTCCAGGCCCCCAACTCCGCCCAGCCTCTCCCCGCTCTGGAT CCTGCACTCTAACACTCGACTCTGCTGCTCATGGGAAGAACAGAATTGCTCCTGCATGCAACTAATTCAATAAAACT GTCTTGTGAGCTGATCGCTTGGAGGGTCCTCTTTTTATGTTGAGTTGCTGCTTCCCGGCATGCCTTCATTTTGCTAT GGGGGGCAGGCAGGGGGGATGGAAAATAAGTAGAAACAAAAAAGCAGTGGCTAAGATGGTATAGGGACTGTCATACC AGTGAAGAATAAAAGGGTGAAGAATAAAAGGGATATGATGACAAGGTTGATCCACTTCAAGAATTGCTTGCTTTCAG GAAGAGAGATGTGTTTCAACAAGCCAACTAAAATATATTGCTGCAAATGGAAGCTTTTCTGTTCTATTATAAAACTG TCGATGTATTCTGACCAAGGTGCGACAATCTCCTAAAGGAATACACTGAAAGTTAAGGAGAAGAATCAGTAAGTGTA AGGTGTACTTGGTATTATAATGCATAATTGATGTTTTCGTTATGAAAACATTTGGTGCCCAGAAGTCCAAATTATCA GTTTTATTTGTAAGAGCTATTGCTTTTGCAGCGGTTTTATTTGTAAAAGCTGTTGATTTCGAGTTGTAAGAGCTCAG CATCCCAGGGGCATCTTCTTGACTGTGGCATTTCCTGTCCACCGCCGGTTTATATGATCTTCATACCTTTCCCTGGA CCACAGGCGTTTCTCGGCTTTTAGTCTGAACCATAGCTGGGCTGCAGTACCCTACGCTGCCAGCAGGTGGCCATGAC TACCCGTGGTACCAATCTCAGTCTTAAAGCTCAGGCTTTTCGTTCATTAACATTCTCTGATAGAATTCTGGTCATCA GATGTACTGCAATGGAACAAAACTCATCTGGCTGCATCCCAGGTGTGTAGCAAAGTCCACATGTAAATTTATAGCTT AGAATATTCTTAAGTCACTGTCCCTTGTCTCTCTTTGAAGTTATAAACAACAAACTTAAAGCTTAGCTTATGTCCAA GGTAAGTATTTTAGCATGGCTGTCAAGGAAATTCAGAGTAAAGTCAGTGTGATTCACTTAATGATATACATTAATTA GAATTATGGGGTCAGAGGTATTTGCTTAAGTGATCATAATTGTAAAGTATATGTCACATTGTCACATTAATGTCACA CTGTTTCAAAAGTTAAAAAAAAAAAAAAAAAA(SEQ ID NO.21)

Accepted standard sample is the application on human skin fibroblast bought from Coriell Institute for Medical Research Dimension cell, its details are as follows, and following information is through Coriell Institute for Medical Research's Identification.

Table 2 cell sample information

This test kit in use, first extracts the RNA of sample, then is cDNA by RNA reverse transcription, then pass through PCR to cDNA Expand, amplified production is checked order, know catastrophe.Each gene uses respectively in single amplification system Corresponding primer carries out PCR amplification.The lot of experiments that moves in circles design of primers and amplification program adjusts, and combine right After masterplate amount, Tm value corresponding of primer optimize, preferably primer and specifying information is as shown in table 3 below:

Table 3 primer sequence

When carrying out gene amplification, the primer corresponding to each gene expands respectively in an independent amplification system, relatively Excellently, the PCR amplification program groping to obtain through lot of experiments is:

Table 4 amplification program

The gene test of embodiment 2 alzheimer's disease

According to the test kit of embodiment 1, carry out the application of embodiment 2, sequentially include the following steps: the most respectively

The gene diagnosis kit of the alzheimer's disease that the present invention provides, the sample of its detection can be the blood of test individual Liquid, body fluid, hair, skeleton, cell or tissue specimen etc..In the present embodiment, use the standard cell lines strain with embodiment 1.

One, the extraction of test individual human desmocyte Skin Cell RNA:

1. take testing sample to add 1 ml Trizol liquid and mix on ice, smash homogenate to pieces；Stand 10 min on ice；

2. in homogenate, add 200 μ l chloroforms, firmly shake 15s, incubated at room 10 min

3. 4 DEG C, 12000 g/min, l are centrifuged 15 min

4. water intaking phase (upper strata), adds 500 μ l isopropanols, rocks gently, incubated at room 10 ~ 15 min

5. 4 DEG C, 12000 g/min, l are centrifuged 10 min

6. abandon supernatant, washed once with 1 ml 75% ethanol (v/v), 4 DEG C, 7500 ~ 10000g/min, centrifugal 5 min

7. air is dried at superclean bench and dries, with 20～30 μ l DEPC water dissolutioies (if can not be completely dissolved can in 55 ~ Hatch 5 ~ 10 min for 60 DEG C), obtain RNA extracting solution.

Two, sample RNA reverse transcription is cDNA

Take 2 μ l RNA extracting solution 95 DEG C preheating 5～10 min, add the reaction tube containing RT reactant liquor, at PCR instrument or constant temperature Water-bath carries out amplified reaction by following procedure: 25 DEG C, 5 min, hatch 60 min for 42 DEG C, last 70 DEG C, 15 min make instead Transcriptase inactivates.Finally give RT-PCR reaction template.

The composition of RT reactant liquor is:

Table 5 RT reactant liquor composition (20 μ l reaction system)

Three, cDNA is carried out PCR amplification

Take 2 μ l RT-PCR reaction template and join in 48 μ l amplification systems, often pipe adds for one gene of amplification Primer pair, 10 genes react respectively in 10 pipes, and primer is as shown in table 3, according in table 5 in PCR instrument after mixing Program react.

Amplification system in PCR amplification is as shown in table 6.

Table 6 PCR amplification system composition (50 μ l reaction system)

Heretofore described reactant mixture refers in PCR course of reaction, required archaeal dna polymerase, dNTPs, Mg²⁺Deng The mixture that must combine.

Four, electrophoresis, PCR primer judges and order-checking

After reaction terminates, product is separated by electrophoresis, is T-A clone after purpose product is cut glue, directly checks order, Entrust Nanjing Jin Sirui biotechnology company.Shown in Fig. 1 is the electrophoresis result of the amplified production of CLU gene, permissible from figure Finding out, amplified production is clear, single band, it is seen that its amplification efficiency is high, occurs without specific product, and open sequence is passed through After amplification, its product size is estimated at 1571 bp, and its actual size is 1571 bp, and its size is consistent with expection.Through order-checking, The sequencing result of this cell strain sample is consistent with its known array, it was demonstrated that the reliability of this primer sets.

The amplification of other gene is as shown in Fig. 2～10, it can be seen that for the amplified production of other gene Size is also in the same size with intended, and presents single, band clearly；Check order after each amplified production is cut glue, survey Sequence result is consistent with the known array of this sample, confirms that other above-mentioned gene can be carried out reliably by this test kit equally Amplification.

Result:

Application DNAMAN software carries out sequence alignment analysis.The standard sequence that sequence order-checking obtained and NCBI retrieve enters Row comparison, it is determined whether there is pathogenic mutation site.

SEQUENCE LISTING

<110>Jiangsu Xiong Ming Pharmaceutical Technology Co., Ltd

<120>gene diagnosis kit of a kind of alzheimer's disease

<130>nothing

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 16

<212> DNA

<213>artificial sequence

<400> 1

atgctgcccg gtttgg 16

<210> 2

<211> 18

<212> DNA

<213>artificial sequence

<400> 2

ctagttctgc atctgctc 18

<210> 3

<211> 20

<212> DNA

<213>artificial sequence

<400> 3

ccttgagtcc tactcagccc 20

<210> 4

<211> 21

<212> DNA

<213>artificial sequence

<400> 4

ttgatgcgtg aaacttggtg a 21

<210> 5

<211> 16

<212> DNA

<213>artificial sequence

<400> 5

gcggcgggga agcgta 16

<210> 6

<211> 20

<212> DNA

<213>artificial sequence

<400> 6

gtccagccgg gaatcttgac 20

<210> 7

<211> 20

<212> DNA

<213>artificial sequence

<400> 7

gtgtccggga ttcagacctc 20

<210> 8

<211> 20

<212> DNA

<213>artificial sequence

<400> 8

ccaaagagct ggttctgcct 20

<210> 9

<211> 20

<212> DNA

<213>artificial sequence

<400> 9

gtgaaaagcc aagaggacga 20

<210> 10

<211> 21

<212> DNA

<213>artificial sequence

<400> 10

ctttccaaac gtgaccagtg t 21

<210> 11

<211> 20

<212> DNA

<213>artificial sequence

<400> 11

gctggactct tccctccctt 20

<210> 12

<211> 20

<212> DNA

<213>artificial sequence

<400> 12

agctttgccc tcttgtagcg 20

<210> 13

<211> 22

<212> DNA

<213>artificial sequence

<400> 13

cctctgacct ctcccctagc ag 22

<210> 14

<211> 21

<212> DNA

<213>artificial sequence

<400> 14

gaagcgccat tcagttccag a 21

<210> 15

<211> 20

<212> DNA

<213>artificial sequence

<400> 15

gaggcgtgca aagactccag 20

<210> 16

<211> 20

<212> DNA

<213>artificial sequence

<400> 16

ttcccatgag cagcagagtc 20

<210> 17

<211> 19

<212> DNA

<213>artificial sequence

<400> 17

ggtggaggag ctgcagaga 19

<210> 18

<211> 21

<212> DNA

<213>artificial sequence

<400> 18

gtcccaattt ccttcatggg c 21

<210> 19

<211> 20

<212> DNA

<213>artificial sequence

<400> 19

atggctgagc cccgccagga 20

<210> 20

<211> 20

<212> DNA

<213>artificial sequence

<400> 20

agccaaagcc gagtgacaaa 20

Claims

1. the gene diagnosis kit of an alzheimer's disease, it is characterised in that include for expanding drawing of following gene Thing group: APP, APOE, PSEN1, PSEN2, GSK3 β, DYRK1A, Tomm40, CLU, PICALM, TAU.

The gene diagnosis kit of alzheimer's disease the most according to claim 1, it is characterised in that: described primer sets By following primer to being formed, each primer centering is made up of a forward primer and a reverse primer respectively, Its primer sequence is as follows: for expanding the primer pair of app gene: SEQ ID NO.1～2；For expanding APOE gene Primer pair: SEQ ID NO.3～4；For expanding the primer pair of PSEN1 gene: SEQ ID NO.5～6；For expanding PSEN2 The primer pair of gene: SEQ ID NO.7～8；For expanding the primer pair of GSK3 β gene: SEQ ID NO.9～10；For expanding The primer pair of increasing DYRK1A gene: SEQ ID NO.11～12；For expanding the primer pair of Tomm40 gene: SEQ ID NO.13 ～14；For expanding the primer pair of CLU gene: SEQ ID NO.15 ~ 16；For expanding the primer pair of PICALM gene: SEQ ID NO.17～18；For expanding the primer pair of TAU gene: SEQ ID NO.19～20.

Test kit the most according to claim 2, it is characterised in that: described gene diagnosis kit, each primer is to institute The composition of amplification system be: cDNA template 2.0 μ l, reactant mixture 25.0 μ l, forward primer 2.0 μ l, reverse primer 2.0 μl、dd H₂O complements to 50 μ l.

Test kit the most according to claim 3, it is characterised in that: also include RNA and extract reagent and Reverse Transcription.

5. the using method of the test kit described in claim 3, it is characterised in that: comprise the steps: (1) sample tissue RNA Extraction；(2) gained RNA reverse transcription is become cDNA；(3) by described primer sets, cDNA sample is carried out PCR reaction；(4) Gained amplification of DNA fragments is checked order；(5) sequencing result is compared with the CDS region base of each gene, it is judged that with or without sudden change.