CN105950705B - One group of microRNAs is preparing the application in alzheimer's disease diagnostic reagent or diagnostic kit - Google Patents
One group of microRNAs is preparing the application in alzheimer's disease diagnostic reagent or diagnostic kit Download PDFInfo
- Publication number
- CN105950705B CN105950705B CN201510163639.6A CN201510163639A CN105950705B CN 105950705 B CN105950705 B CN 105950705B CN 201510163639 A CN201510163639 A CN 201510163639A CN 105950705 B CN105950705 B CN 105950705B
- Authority
- CN
- China
- Prior art keywords
- mir
- reagent
- alzheimer
- seq
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to medical biotechnology detections, nerve retrograde affection technical field, are miR-101-3p, miR-144-5p and let-7g-5p the present invention provides one group of Alzheimer disease early diagnosis or the molecular marked compound of screening, the molecular marked compound.The present invention also provides this group of microRNAs to prepare the application in alzheimer's disease diagnostic reagent or diagnostic kit, and a kind of non-invasive, specific, highly sensitive kit and detection method that early diagnosis and screening are carried out to alzheimer's disease.
Description
Technical field
The present invention relates to medical biotechnology detection, nerve retrograde affection technical field more particularly to one group of microRNAs to exist
Prepare the application in alzheimer's disease diagnostic reagent or diagnostic kit, this group of microRNAs be specially miR-101-3p,
MiR-144-5p and let-7g-5p, the invention further relates to a kind of non-invasive, specific, highly sensitive to alzheimer's
Disease carries out the kit and detection method of early diagnosis and screening.
Background technique
Alzheimer's disease (AD) is a kind of relevant disease of nerve retrograde affection, is accounted for about in elderly dementia's case
50-60%.The main clinical manifestation of AD is memory and the missing of other cognitive functions.In general, AD patient can by 10 years or more
The prolonged course of disease ultimately succumbs to helpless state.AD so long lasting sick time is to AD patient, and family, society brings
Economic and psychological burden.AD just took 604,000,000,000 dollars in 2010 according to statistics.Separately there are statistics display over-65s
There is 5% people to suffer from AD in crowd, it is more than 1/3 in 90 years old or more crowd that the people for having more than 20% for 80 years old or more in crowd, which suffers from AD,
People suffers from AD, and as the life expectancy of modern people is higher and higher, and AD will will become a kind of more popular old class disease
Disease, to the year two thousand fifty, the whole world will have more than 1.15 hundred million AD patient.One kind that AD is represented is main and gets worse
Public health problem so the very necessary pathomechanism for going discovery AD new provides new therapy target for AD patient, and is AD
Early diagnosis and disease course prediction determine a new Testing index (World Health Organization.Dementia:a
Public Health Priority World Health Organization,Geneva,2012)。
And currently, AD diagnoses the deposition that unique goldstandard is amyloid A β in brain tissue.But this process needs
Invasive biopsy of brain is wanted just to be able to achieve.
MicroRNA (miRNA) is the molecule being made of 21-25 nucleotide, and MicroRNA is by inhibiting its target molecule
The translation of mRNA promotes it to degrade and play the role of negativity gene expression regulation.With deepening continuously for research in recent years, people
Find in serum that most of microRNA molecules are present in excretion body and can be released into blood by excretion body approach, and
And can be stabilized, it is conducive to detection, this is possible to make the miRNA in serum excretion body to diagnose as a kind of Novel noninvasive
Molecule.Compared with traditional biopsy, minimally invasive (blood drawing) or noninvasive (using urine or saliva) diagnostic method reduces the pain of patient
It is bitter and inconvenient, also reduce analysis cost.Nearly 2 years, multiple research teams carried out the exosome in blood, urine and saliva
Research, it was found that the biomarker of a variety of diseases, be expected to instruct disease personalized treatment (Lorea Manterola,
Elizabeth Guruceaga,et al.A small noncoding RNA signature found in exosomes
of GBM patient serum as a diagnostic tool.Neuro-Oncology.2014；0,1–8).
MicroRNA and the research of alzheimer's disease are more and more, but there is no have been reported that outside research and utilization serum at present
One in body group of miRNAs (miR-101-3p, miR-144-5p, let-7g-5p) is secreted to substitute the goldstandard starch of AD diagnosis
The horizontal of sample albumin A β early diagnoses alzheimer's disease (AD) to realize.
Summary of the invention
It can be effective for one group of spy of Alzheimer disease early diagnosis and screening it is an object of the invention to search out
Opposite molecule marker.Another object of the present invention is to provide one group of microRNAs to prepare the diagnosis of alzheimer's disease
Application in reagent or diagnostic kit.The third object of the present invention is to provide a kind of early detection alzheimer's disease
Detection method.
The present invention can suffer to solve the bottleneck of the goldstandard of invasive alzheimer's disease diagnosis in normal person
Risk assessment and control strategy are made before disease, the present invention utilizes the microRNAs high specificity in serum excretion body, sensitivity
Height, and be stabilized in serum and be conducive to detection to the biomarker as the early diagnosis of alzheimer's disease.
The first aspect of the present invention provides the molecular marked compound of one group of Alzheimer disease early diagnosis or screening, institute
The molecular marked compound stated is miR-101-3p, miR-144-5p and let-7g-5p.
MiR-101-3p:uacaguacugugauaacugaa (SEQ ID NO:1)
MiR-144-5p:ggauaucaucauauacuguaag (SEQ ID NO:2)
Let-7g-5p:ugagguaguaguuuguacaguu (SEQ ID NO:3)
For the present invention by the pathogenesis of research alzheimer's disease, searching, which can substitute, diagnoses goldstandard amyloid egg
The miRNAs of white A β level, and demonstrate the miRNAs in brain tissue and discharged into peripheral blood by excretion body approach, finally
By the microRNAs (miR-101-3p, miR-144-5p, let-7g-5p) in detection serum excretion body to be to realize AD
Early diagnosis and early screening.
The present invention is related by searching for the microRNA chip of expression spectrum result of AD brain tissue, Bioinformatics Prediction AD
Disease-causing gene (APP, APOE etc.) is directly targeted two kinds of microRNA tactful comprehensive analysis, and it is relevant to screen a collection of AD patient
MicroRNA is as candidate research gene.
The present invention demonstrates the correlation between A β and miRNAs in vitro, to prove one group that we filter out
MiRNAs (miR-101-3p, miR-144-5p and let-7g-5p) can substitute the amyloid A β water in brain tissue really
It is flat.We select the cell strain in human's nervous system source to add A β stimulation as external model first, and the A β such as discovery APP generates base
The mRNA of cause is significantly raised.And obvious downward is presented in 3 candidate microRNA, there are good negative correlations for the two.But
Whom who on earth regulates and controls for microRNA and these target genes? then, we pass through first transiently transfect cell carried out miRNA's
Overexpression and the Study of Interference find the inverse change that three candidate microRNA can cause A β to generate gene.But when me
Be overexpressed A β generate 3 ' UTR of gene when, find APP, BACE1.Can also cause the significant downward of miRNAs, then we into
One step has carried out the half-life analysis of miRNAs, it was demonstrated that can promote the degradation of miRNAs really.This suggests that us, and A β is generated
Gene also can be reversed the gene expression abundance of regulation miRNAs.Therefore, we tentatively propose the negative sense tune between miRNAs and A β
Control mechanism.MiRNAs can generate the mRNA of gene in conjunction with A β, promote mRNA degradation, but if miRNAs is lowered.This
Kind inhibiting effect will disappear, and eventually lead to A β generation and increase with deposition.And A β is when increasing, and can promote BACE1, APP's turns
Record, they can combine microRNAs in turn again, and promote its degradation.MiRNAs in this way and A β have good negative correlation
Property therefore can substitute A β level it is possible to become alzheimer's disease early diagnosis biomarker.
The second aspect of the present invention provides one group of microRNAs and is preparing alzheimer's disease diagnostic reagent or examining
Application in disconnected kit, one group of microRNAs is miR-101-3p, miR-144-5p and let-7g-5p.
The diagnostic reagent, for detection biological sample in the content of miR-101-3p, the content of miR-144-5p and
The combination of the reagent of the content of let-7g-5p.
The diagnostic kit contains the content of miR-101-3p in detection biological sample, miR-144-5p contains
The reagent of amount and the content of let-7g-5p.
The content of miR-101-3p in the detection biological sample, the content of miR-144-5p and let-7g-5p contain
The reagent of amount, is selected from: having the PCR primer of detection specificity to miR-101-3p, miR-144-5p, let-7g-5p.
Preferably, miRNA reverse transcription and real-time quantitative PCR detection primer sequence are as follows:
MiRNA reverse transcriptase primer:
MiR-101-3p:AAATATGCGGCCGCTCATG (SEQ ID NO:4)
MiR-144-5p:AAATATGCGGCCGCCGAGA (SEQ ID NO:5)
Let-7g-5p:AAATATGCGGCCGCAATTT (SEQ ID NO:6)
Real-time quantitative PCR detection primer:
MiR-101-3p:AGTACTTACCGACGAT (SEQ ID NO:7)
MiR-144-5p:GCTCTAAGGCAACGA (SEQ ID NO:8)
Let-7g-5p:TTAAAGGCGAATCGGA (SEQ ID NO:9)
General real-time quantitative PCR primer: TTTATACGCCGGCGAAT (SEQ ID NO:10)
The biological sample is selected from: flesh tissue or cell, formalin obtained from object are fixed or paraffin embedding group
It knits or cell, blood or body fluid etc..It is preferably blood plasma or serum.
The third aspect of the present invention, provides a kind of diagnostic kit of alzheimer's disease, which contains
Detect the reagent, the reagent of the content of miR-144-5p and the content of let-7g-5p of the content of miR-101-3p in biological sample
Reagent.
The diagnostic kit of alzheimer's disease of the present invention is by reverse transcription system, primer system and amplification
System composition, the primer system include:
General real-time quantitative PCR primer is as shown in SEQ ID NO:10；
MiR-101-3p real-time quantitative PCR primer is as shown in SEQ ID NO:7；
MiR-144-5p real-time quantitative PCR primer is as shown in SEQ ID NO:8；
Let-7g-5p real-time quantitative PCR primer is as shown in SEQ ID NO:9.
The biological sample is selected from: flesh tissue or cell, formalin obtained from object are fixed or paraffin embedding group
It knits or cell, blood or body fluid etc..It is preferably blood plasma or serum.
The fourth aspect of the present invention provides a kind of detection that alzheimer's disease is carried out using above-mentioned diagnostic kit
Method, the detection method are as follows: routinely blood drawing takes serum or blood plasma, handles serum or blood plasma with total RNA extraction reagent, adds
Upper strata aqueous phase is taken after chloroform centrifugation, through the tiny RNA in isopropanol precipitating and alcohol precipitation enrichment serum or blood plasma；By reverse transcription system
Reverse transcription tiny RNA unite into cDNA；Real-time PCR amplification is carried out with amplification system, measures content, the miR- of miR-101-3p
The content of 144-5p and the content of let-7g-5p.
The present invention is detected by the normal human blood sample to 100 all ages and classes, it was demonstrated that our 3 microRNA
Have the tendency that gradually lowering with the age.
The present invention is verified on normal mouse again, by miRNA fluorescence in situ hybridization, our first discovery mouse
MiRNA in brain tissue is gradually lowered with the age.And at the same time, aβ protein level is raised with the age.But in normal mouse
In the heart, lung tissue, these microRNAs are unobvious with age change tendency, this, which prompts these microRNA to lower, has tissue
Specificity.
Then, the present invention has carried out the detection of microRNA in the excretion body of mouse peripheral blood again, finds itself and brain group
In miRNA have same variation tendency, so we can see that miRNA has in the peripheral blood of normal person and mouse
The trend gradually lowered with the age.
The present invention provides it is a kind of can non-invasive, high specificity, high sensitivity alzheimer's disease carried out
The method of early diagnosis.This method mainly carries out diagnosis different by the serum sample to 50 AD patients to prove by this
The diagnostic and clinical value for the kit that group miRNAs is constituted.
These three molecule joint-detection sensibility of miR-101-3p, miR-144-5p and let-7g-5p of the invention and spy
The opposite sex is above individual molecule and individually detects (Fig. 3).
The change that the present invention passes through detection blood plasma or miR-101-3p, miR-144-5p and let-7g-5p content in serum
Change, can carry out early diagnosis and screening to alzheimer's disease to carry out clinical intervention as early as possible prevents disease progression.
The present invention provides new hand for the risk that early diagnosis alzheimer's disease, assessment normal person suffer from alzheimer's disease
Section.
Detailed description of the invention
Fig. 1: screening miRNA in brain tissue and peripheral blood by high-flux sequence and bioinformatic analysis,
Middle A: to carry out bioinformatic analysis using the high-flux sequence data of AD patient's brain tissue of GEO database and peripheral blood,
15 miRNAs lowered jointly are screened；B: predict that targeting A β generates gene by bioinformatic analysis software miRanda
MiRNAs and the binding site between them；C: taking intersection by the two, filters out 3 miRNA and is used as candidate research object,
These miRNA are not only to lower, but also can target A β simultaneously and generate gene in AD.
Fig. 2: the correlation and mechanism analysis of A β and miRNAs are verified in vitro, wherein A: the cell in human's nervous system source
Strain addition A β 5uM stimulation is used as external model, and as control, the mRNA that the A β such as discovery APP generates gene is significantly raised HSA, and 3
Obvious downward is presented in item candidate microRNA, and there are good negative correlations for the two；B: it is carried out by transiently transfecting cell
The overexpression and the Study of Interference of miRNA finds the inverse change that three candidate microRNA can cause A β to generate gene；C:
By be overexpressed A β generate 3 ' UTR of gene when, find APP, BACE1, the significant downward of miRNAs can also be caused, then we
Further vivo transcription is inhibited to carry out the half-life analysis of miRNA by goose cream Tan alkali process, 3 ' UTR of these genes are confirmed
Really it can promote the degradation of miRNA；This suggests that us, and A β, which generates gene, also can be reversed the gene expression abundance of regulation miRNA.
Fig. 3: peripheral blood exo-miRNAs to the diagnostic value of AD, and 3 microRNA of quantitative fluorescent PCR are in AD patient's blood
It is lowered in clear；In ROC diagnostic model, when 3 miRNA Combining diagnosis, diagnostic can achieve 0.88.
Fig. 4: peripheral blood Exo-microRNA with the change at age, wherein A: by quantitative fluorescent PCR to 100 not the same years
The normal human blood sample in age is detected, it was demonstrated that our 3 microRNA have the tendency that lowering with the age really；B: by glimmering
Light in situ hybridization, normal mouse is divided into 5 age brackets according to the monthly age by us, the results showed that miRNAs in Mice brain tissues with
Age gradually lowers；C: the microRNA in the normal mouse heart, lung tissue is unobvious with age change tendency, this prompts these
MicroRNA, which is lowered, has tissue specificity.
Specific embodiment
Now in conjunction with embodiment and attached drawing, the present invention is described in detail, but implementation of the invention is not limited only to this.
The reagents and materials used in the present invention are commercially available or can prepare by literature method.Tool is not specified in the following example
The experimental method of concrete conditions in the establishment of a specific crime, usually according to normal condition such as Sambrook et al. " molecular cloning: lab guide " (New
York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to normal conditions, or
According to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are calculated by weight.
Embodiment 1:
By high-flux sequence and bioinformatic analysis to miRNA in brain tissue and peripheral blood carry out screening by pair
GEO database in PUBMED: GSE48552, GSE46579, GSE46131 high-flux sequence data carry out Analysis and Screening and go out in AD
15 miRNAs lowered jointly in patient's brain tissue and peripheral blood, as shown in Figure 1A.
Then it is be combined with each other by microRNA and RNA and analyzes software miRanda and can be downloaded from following network address:
http://www.microrna.org/microrna/getDownloads.do.It is used after downloading according to the software that website provides
Illustrate use, specifically, we will extensive AD Disease-causing gene (APP, PSEN1/2, APOE BACE1 etc.) at present mRNA sequence
Column import analysis software, analyze the situation that be combined with each other for the proprietary microRNA that it is included with software, we use
The condition Con trolling index of Score Threshold:140 has obtained all miRNA that may have combination with AD Disease-causing gene, such as
Shown in Figure 1B.
Intersection is taken by the two, filters out 3 miRNA as candidate research object, these miRNA are both to lower in AD
, and A β can be targeted simultaneously and generate gene, as shown in Figure 1 C.3 miRNA (miR-101-3p, miR- for finally screening out
144-5p, let-7g-5p) as the candidate detection marker for studying AD diagnosis.
Embodiment 2: the correlation and mechanism analysis of A β and miRNAs are verified in vitro
1, human's nervous system derived cell system SHSY-5Y cell culture
The neuroblastoma cell (SHSY-5Y is purchased from Chinese Academy of Sciences's cell institute) in human's nervous system source, which is incubated at, to be contained
In the DMEM in high glucose culture medium of 10% fetal calf serum, 37 DEG C are placed in, 5% carbon dioxide incubator stationary culture.
2, A β and miRNA show good negative correlation in the external model of AD
When cell density reaches about 70%, to addition A β peptide (Bachem, Torrance CA) the 5uM stimulation of SHSY-5Y cell
As external AD model, simulated in vivo environment, the human serum albumins (HAS) with concentration is as positive negative control.
QRT-PCR detection is carried out after the sincere cDNA of reverse transcription after collection Cell extraction RNA after 48h.As a result exist as shown in Figure 2 A
It transfected in the cell of A β peptide, the generation gene and miRNA of A β shows good negative correlation, and the generation gene expression of A β increases
Add, miRNA expression reduces.
3, when cell density reaches about 50%, using Lipofectamine2000 reagent, (U.S. Invitrogene is public
Department), according to the step of transfection reagent specification and ratio of reagents, the mimics of miRNA is transferred in SHSY-5Y cell, as a result
As shown in Figure 2 B, apparent lower occurs for the generation gene of A β.
4, when cell density reaches about 50%, using Lipofectamine2000 reagent, (U.S. Invitrogene is public
Department), according to the 3' for the generation gene for the step of transfection reagent specification and ratio of reagents, being transferred to A β in SHSY-5Y cell
UTR, as a result as shown in Figure 2 C, 3 miRNA occur significantly to lower.
The primer of U6:
P1:GTAACCCGTTGAACCCCATT(SEQ ID NO:11)
P2:CCATCCAATCGGTAGTAGCG(SEQ ID NO:12)
PCR product: 200bp.Annealing temperature: 55 DEG C
The primer of miRNA is as follows:
MiR-101-3p:AGTACTTACCGACGAT (SEQ ID NO:7)
MiR-144-5p:GCTCTAAGGCAACGA (SEQ ID NO:8)
Let-7g-5p:TTAAAGGCGAATCGGA (SEQ ID NO:9)
General real-time quantitative PCR primer: TTTATACGCCGGCGAAT (SEQ ID NO:10)
PCR product: 135bp.Annealing temperature: 55 DEG C
5, synthetic primer and building pcDNA3.1-APP 3'UTR carrier for expression of eukaryon
(1) design primer
APP 3'UTR XhoIF:
5'CCGCTCGAG GCCTGGTCGGCTCACCGCCTATC 3'(SEQ ID NO:13)APP 3'UTR NotIR:
5'ATAAGAATGCGGCCGCTAAAGAATTGGATATTTTTTAATGCAAATTG 3'(SEQ ID NO:14)
Restriction enzyme site is XhoI and NotI, is separately added into 5 ' ends of primer, and the protection base of restriction enzyme site is added.
(2) PCR amplification target fragment
Following system is prepared in 0.2mL EP pipe, genomic DNA template stoste takes 0.5 μ L to expand after diluting 20 times
F11R:
5 μ lPCR products are taken, 1% agarose gel electrophoresis (the 0.5 μ g/ml containing EB is；Voltage: 80V) mirror
It is fixed；Remaining is for recycling, purifying target fragment.
(3) recovery purifying target fragment
PCR product is after 1% gel electrophoresis, in the UV lamp, cuts the gel strips containing target gene fragment with scalpel
Band is into clean 1.5mlOD pipe, and after weighing, solution is added into centrifuge tube in the ratio of the corresponding 100 μ L solution B D of 100mg gel
BD.60 DEG C of water-bath 10min dissolve completely to gel, oscillation mixing 3 times during water-bath.Solution is transferred in DNA purification column, it is quiet
2min is set, 12 000rpm of room temperature is centrifuged 1min, abandons filtrate.500 μ L solution PE, room temperature 12000rpm centrifugations are added on column
1min abandons filtrate.It is primary to repeat last action.It is remaining in purification column to completely remove that room temperature void column 12000rpm is centrifuged 1min
Liquid.Pillar is placed on new 1.5mL EP pipe, the sterile water of 60 DEG C of 30 μ L preheatings, 13400g centrifugation are added to column center
1min is to elute DNA.
(4) identification and preservation of recombinant plasmid
It is separately recovered, purifies carrier segments and target fragment after XhoI and NotI double digestion.Gained DNA is respectively dissolved in
30μl ddH2In O, 1% agarose gel electrophoresis (the 0.5 μ g/ml containing EB；Voltage: 80V) identification, -20 DEG C of preservations.
The carrier segments and target fragment after connection digestion are recombinated with T4DNA ligase, form pcDNA3.1-APP 3'
UTR recombinant plasmid.With above-mentioned recombinant plasmid transformed competence colibacillus bacillus coli DH 5 alpha, expands bacterium and be sequenced, sequencing is correct.
Step of converting is as follows:
200 μ l are taken to be transferred to sterile microcentrifugal tube from every kind of competent cell suspension with cooling sterile pipette tip
In, every pipe adds 10 μ l connection liquid, gently rotates to mix content, places 30 minutes in ice.Pipe is put into pre-heating to 42
DEG C circulator bath on the EP pipe support put well, exactly place 90 seconds, not shake EP pipe support.Pipe is quickly transferred to ice bath
In, keep cell l-2 minutes cooling.Every pipe adds 800 μ l LB culture mediums.Culture medium is heated up to 37 DEG C with water-bath, then turns pipe
It moves on on 37 DEG C of shaking tables, incubating 45 minutes makes bacteria resuscitation.The 150 μ l competent cell converted is transferred to ammonia benzyl resistance
On the LB agar medium of (100ug/ml).
Plate is placed in room temperature until liquid is absorbed.It is inverted plate, is cultivated in 37 DEG C, 16 hours.The clone grown into
The subsequent PCR identification of row.
6, pcDNA3.1-APP 3'UTR infects everybody nervous system derived cell system SHSY-5Y.
Guarantee the good growth conditions of cell, experiment the previous day inoculation 5 × 10 before experiment4A aim cell is cultivated in 12 holes
In plate, added culture volume is 0.5ml.Be ready for when cell grows to 60-70% pcDNA3.1-APP 3'UTR and
PcDNA3.1-NC transfection.
Transfection procedure is as follows:
It takes in 97ulDMEM to 1ml OD pipe, is added in 3ul fugen-6 to DMEM, mixed with sample loading gun or adept finger is light
It flicks dynamic, is placed at room temperature for 5 minutes later.In the DMEM for going 1 g plasmid to be added to 100 microlitres of total volume simultaneously, mix gently,
Stand 5 minutes.After five minutes, two kinds of liquid are mixed with rifle, is placed at room temperature for 30 minutes.Reaction is sucked out with 100ul rifle after 30 minutes
Liquid, it is uniform to instill in 12 orifice plates, it gently pats, is put into incubator.After overnight incubation, the next morning changes normal incubation medium,
Continue culture and with G418 screening positive clone.
Embodiment 3: diagnostic value of the peripheral blood exo-miRNAs to AD
The case-data of 50 AD patients is as shown in the table.
50 AD patients and age-matched Healthy People essential information
**P < 0.01compared to controls
50 AD patients and age-matched Healthy People essential information, by matched people of same age as control, control with
In addition to MMSE score (state of mind scoring) remaining index is all without statistical difference between patient.
The excretion body in AD patients serum is carried out with the EXOQ5A-1 serum excretion body of SBI company purification kit pure
Change, after the miRNA in excretion body is extracted, by quantitative fluorescent PCR to 50 AD patients and age-matched Healthy People
3 microRNA are detected in serum excretion body
The specific method is as follows:
1) according to the standard specification of SBI company EXOQ5A-1 serum excretion body purification kit to the excretion body in serum
Purified, after miRNA therein is extracted.
2) 3 microRNA expression quantity in the serum excretion body for the AD patient and age-matched Healthy People that PCR is detected in real time.
(1) total serum IgE in different sample serum excretion bodies, reverse transcription cDNA are extracted.
(2) design primer detects 3 miRNA expressions.U6 is as detection internal reference.
Primer sequence is as follows:
The primer of U6:
P1:GTAACCCGTTGAACCCCATT(SEQ ID NO:11)
P2:CCATCCAATCGGTAGTAGCG(SEQ ID NO:12)
PCR product: 200bp.Annealing temperature: 55 DEG C
The primer of miRNA is as follows:
MiR-101-3p:AGTACTTACCGACGAT (SEQ ID NO:7)
MiR-144-5p:GCTCTAAGGCAACGA (SEQ ID NO:8)
Let-7g-5p:TTAAAGGCGAATCGGA (SEQ ID NO:9)
General real-time quantitative PCR primer: TTTATACGCCGGCGAAT (SEQ ID NO:10)
PCR product: 135bp.Annealing temperature: 55 DEG C
Quantitative fluorescent PCR system is as follows:
PCR reaction step:
PCR product content, which calculates to use, compares Ct value method progress relative quantification.Compare Ct value method this assumes that each following
The product amounts that ring doubles obtain Ct value in the exponential phase of PCR reaction to react the amount of starting template, a circulation (Ct
=1) difference is equivalent to 2 times of initial profiling number of difference.
Definition: Δ Ct=CtTarget gene-CtInternal standard
Δ Δ Ct=(CtTarget gene-CtInternal standard)It is processed-(CtTarget gene-CtInternal standard)It is untreated
RQ=2- Δ Δ Ct
Using the statistical and analytical tool inside EXCEL, the average and standard deviation of each group is calculated, is examined between two groups with T,
P < 0.05 thinks statistically significant, and significant difference is thought in P < 0.01.3rd day, 5 days and 7 days were compared with the 1st day respectively
Compared with progress T check analysis.As shown in Figure 3.
The experimental results showed that by matched normal person of same age as control, it can be seen that AD patients serum's excretion body
In miRNA occur obviously lower, found out by ROC model, when 3 miRNAs simultaneously as AD diagnosis marker when
Diagnostic highest.
Embodiment 4: peripheral blood Exo-microRNA with the age change
The miRNA in the serum excretion body of the normal person of 100 different age groups is detected according to the above method first,
As a result as shown in Figure 4 A, it can be found that miRNAs in normal human serum excretion body is gradually decreased with age expression quantity.
Then we have also carried out the detection of miRNA in the brain tissue and serum excretion body of mouse, and zoopery is close to face
Bed test, as a result as shown in Figure 4 B.We have also carried out the detection of miRNA to other organs of mouse simultaneously, as a result such as Fig. 4 C
It is shown, it can be seen that with the increase at mouse monthly age, as soon as miRNA does not show an apparent variation tendency, this is mentioned
Show that the miRNA in Mice brain tissues and serum excretion body has tissue specificity with the variation at age.
Mouse C57 strain used in testing, SPF grades.Weight about 15~45g, age Jan-Sept have, and are purchased from Shanghai experimental animal
Center.Totally 30 mouse divide 5 groups, every group 6.
The fluorescence in situ hybridization experiment of miRNA in Mice brain tissues, probe are that synthesis is transcribed in vitro in oneself.
The specific method is as follows:
1) probe is denaturalized
Probe is incubated into 5min in 75 DEG C of waters bath with thermostatic control, sets 0 DEG C immediately, 5~10min is denaturalized double chain DNA probe.
2) sample is denaturalized
1. the chromosome slide sample prepared is baked 2~3h of piece in 50 DEG C of incubators.(the sample dyed through Giemsa
It needs to bake piece again after fading in fixer in advance).
2. taking out slide sample, it is immersed in 70~75 DEG C of 70% formamide/2 of volume fraction × SSC denaturing liquid
It is denaturalized 2~3min.
3. immediately in order by sample through 100% ice ethyl alcohol system of volume fraction 70%, volume fraction 90% and volume fraction
Then column dehydration, each 5min are air-dried.
3) hybridize
It will be denaturalized or the 10 μ L drop of DNA probe of preannealing be on the slide sample for being denaturalized and being dehydrated, covered 18 × 18
Coverslip is placed in 37 DEG C of hybridized overnights (about 15~17h) in moist magazine with Parafilm mounting.Since hybridization solution is less, and
And hybridization temperature is higher, the duration is again long, therefore the moisture state in order to keep sample, this process carry out in wet box.
4) it elutes
This step helps to remove the probe of non-specific binding, to reduce background.
(1) hybridize next day, sample is taken out from 37 DEG C of incubators, is gently taken off coverslip with blade.(2) will hybridize
Slide sample be placed in warmed-up 42~50 DEG C of volume fraction, 50% formamide/2 × SSC and wash 3 times, each 5min.
(3) it is washed 3 times in warmed-up 42~50 DEG C of 1 × SSC, each 5min.
(4) at room temperature, slide sample is rinsed in 2 × SSC.
(5) slide is taken out, is spontaneously dried.
(6) 200 μ L counterstain solutions (PI/antifade or DAPI/antifade dye liquor) are taken to be added dropwise on slide sample, lid
Upper coverslip.
5) amplification of hybridization signal (suitable for using the probe of biotin labeling)
(1) add 150 μ L confining liquid I at the hybridization position of slide, covered with preservative film, 37 DEG C of incubation 20min.
(2) remove preservative film, then plus 150 μ L avidin-FITC on sample, covered with preservative film, 37 DEG C are continued to incubate
40min。
(3) sample is taken out, puts it into warmed-up 42~50 DEG C of eluent and washs 3 times, each 5min.
(4) add 150 μ L confining liquid II at the hybridization position of slide sample, cover preservative film, 37 DEG C of incubation 20min.
(5) remove preservative film, add 150 μ L antiavidin on sample, covering new preservative film, 37 DEG C incubate
40min。
(6) sample is taken out, is put it into warmed-up 42~50 DEG C of new eluent, is washed 3 times, each 5min.
(7) step (1), (2), (3) are repeated, room temperature is cleaned in 2 × SSC.
(8) slide is taken out, is spontaneously dried.
(9) take 200 μ L PI/antifade dye liquors that the covered on slide sample is added dropwise.
6) mounting
Different types of mounting liquid can be used.If (mounting liquid can be made to generate self-enclosed without containing Mowiol in mounting liquid
Effect), to prevent the solution evaporation between cover plate and slide glass, it can be used nail polish by cover plate periphery seal.The slide mark sealed
Originally it can be kept for the several months long in the magazine in -20~-70 DEG C of refrigerator.
7) fluorescence microscope FISH result
The visual field with cell division phase is first found under visible light source, then opens fluorescence excitation light source, and FITC's swashs
Hair wavelength is 490nm.Cell dyes red by PI, and the position where the probe through FITC label issues green fluorescence.As a result
As shown in Figure 4 B as the mouse monthly age increases, green fluorescence intensity is more and more weaker, and miRNA expression is prompted to lower.
The preferred embodiment of the present invention has been described in detail above, but the invention be not limited to it is described
Embodiment, those skilled in the art can also make various equivalent on the premise of not violating the inventive spirit of the present invention
Variation or replacement, these equivalent variation or replacement are all included in the scope defined by the claims of the present application.
Claims (9)
1. one group of Alzheimer disease early diagnosis or the molecular marked compound of screening, the molecular marked compound are miR-101-
3p, miR-144-5p and let-7g-5p.
2. one group of microRNAs detection reagent is preparing the application in alzheimer's disease diagnostic reagent or diagnostic kit,
One group of microRNAs is miR-101-3p, miR-144-5p and let-7g-5p.
3. one group of microRNAs detection reagent according to claim 2 prepare alzheimer's disease diagnostic reagent or
Application in diagnostic kit, which is characterized in that the diagnostic reagent be detect biological sample in miR-101-3p content,
The combination of the reagent of the content of the content and let-7g-5p of miR-144-5p.
4. one group of microRNAs detection reagent according to claim 2 prepare alzheimer's disease diagnostic reagent or
Application in diagnostic kit, which is characterized in that the diagnostic kit contains miR-101-3p in detection biological sample
Content, the content of the content of miR-144-5p and let-7g-5p reagent.
5. one group of microRNAs detection reagent according to claim 3 or 4 is preparing alzheimer's disease diagnostic reagent
Or the application in diagnostic kit, which is characterized in that the content of miR-101-3p, miR-144- in the detection biological sample
The reagent of the content of the content and let-7g-5p of 5p is to have detection special to miR-101-3p, miR-144-5p, let-7g-5p
Anisotropic PCR primer.
6. one group of microRNAs detection reagent according to claim 5 prepare alzheimer's disease diagnostic reagent or
Application in diagnostic kit, the primer sequence are as follows:
MiRNA reverse transcriptase primer:
MiR-101-3p:AAATATGCGGCCGCTCATG (SEQ ID NO:4)
MiR-144-5p:AAATATGCGGCCGCCGAGA (SEQ ID NO:5)
Let-7g-5p:AAATATGCGGCCGCAATTT (SEQ ID NO:6)
Real-time quantitative PCR detection primer:
MiR-101-3p:AGTACTTACCGACGAT (SEQ ID NO:7)
MiR-144-5p:GCTCTAAGGCAACGA (SEQ ID NO:8)
Let-7g-5p:TTAAAGGCGAATCGGA (SEQ ID NO:9)
General real-time quantitative PCR primer: TTTATACGCCGGCGAAT (SEQ ID NO:10).
7. one group of microRNAs detection reagent according to claim 3 or 4 is preparing alzheimer's disease diagnostic reagent
Or the application in diagnostic kit, which is characterized in that the biological sample is selected from: obtained from object flesh tissue or cell,
Formalin is fixed or paraffin-embedded tissue or cell, blood or body fluid.
8. a kind of diagnostic kit of alzheimer's disease, which contains miR-101-3p in detection biological sample
The reagent of the content of the reagent of content, the reagent of the content of miR-144-5p and let-7g-5p.
9. a kind of diagnostic kit of alzheimer's disease according to claim 8, which is characterized in that the kit is
It is made of reverse transcription system, primer system and amplification system, the primer system includes:
General real-time quantitative PCR primer is as shown in SEQ ID NO:10；
MiR-101-3p real-time quantitative PCR primer is as shown in SEQ ID NO:7；
MiR-144-5p real-time quantitative PCR primer is as shown in SEQ ID NO:8；
Let-7g-5p real-time quantitative PCR primer is as shown in SEQ ID NO:9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510163639.6A CN105950705B (en) | 2015-04-08 | 2015-04-08 | One group of microRNAs is preparing the application in alzheimer's disease diagnostic reagent or diagnostic kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510163639.6A CN105950705B (en) | 2015-04-08 | 2015-04-08 | One group of microRNAs is preparing the application in alzheimer's disease diagnostic reagent or diagnostic kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950705A CN105950705A (en) | 2016-09-21 |
| CN105950705B true CN105950705B (en) | 2019-10-22 |
Family
ID=56917061
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510163639.6A Active CN105950705B (en) | 2015-04-08 | 2015-04-08 | One group of microRNAs is preparing the application in alzheimer's disease diagnostic reagent or diagnostic kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950705B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3679157A1 (en) * | 2017-09-05 | 2020-07-15 | Amoneta Diagnostics | Non-coding rnas (ncrna) for the diagnosis of cognitive disorders |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
| US10011873B2 (en) * | 2012-11-16 | 2018-07-03 | Universitat Des Saarlandes | Diagnostic miRNA markers for Parkinson disease |
-
2015
- 2015-04-08 CN CN201510163639.6A patent/CN105950705B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105950705A (en) | 2016-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sergi et al. | Hirschsprung’s disease: clinical dysmorphology, genes, micro-RNAs, and future perspectives | |
| JP2019150043A (en) | Personalized anti-cancer agent screening system | |
| Liutkeviciene et al. | The role of matrix metalloproteinases polymorphisms in age-related macular degeneration | |
| Farsangi et al. | Modulation of the expression of long non-coding RNAs H19, GAS5, and MIAT by endurance exercise in the hearts of rats with myocardial infarction | |
| CN106555004B (en) | The lncRNA markers of cerebral arterial thrombosis | |
| CN108374043A (en) | The relevant biomarker of Parkinson and its application | |
| CN110257499A (en) | A kind of diagnostic system or product and its application for predicting susceptibility of stroke or prognostic risk | |
| CN105950705B (en) | One group of microRNAs is preparing the application in alzheimer's disease diagnostic reagent or diagnostic kit | |
| CN107937532B (en) | Glioma diagnosis marker hsa _ circ _0021827 and application | |
| JP5721150B2 (en) | Prediction risk of age-related macular degeneration | |
| CN107881228A (en) | A kind of molecular marked compound related to adolescent idiopathic scoliosis and its application | |
| Mezzavilla et al. | Insight into genetic determinants of resting heart rate | |
| CN109793749A (en) | MiR-145-3p is preparing the application in Apoptosis and autophagy reinforcing agent | |
| CN110511996A (en) | A kind of biomarker relevant to Parkinson's occurrence and development | |
| Kawarai et al. | Late-onset spastic paraplegia: Aberrant SPG11 transcripts generated by a novel splice site donor mutation | |
| CN109652529A (en) | Osteoporosis specificity miRNA, composition and its diagnostic use | |
| US20180113133A1 (en) | Gene relevant to papillary thyroid tumors | |
| CN105803085B (en) | A kind of molecular marked compound and application thereof detecting osteoarthritis | |
| JP5226256B2 (en) | Prediction risk of age-related macular degeneration | |
| JP2003515318A (en) | Methods for identifying novel genes involved in the regulation of angiogenesis, testing of such genes and their use for therapeutic purposes | |
| CN107574241B (en) | Method for detecting depression family gene SKA1-3 | |
| CN106544430A (en) | A kind of molecular marked compound of detection carcinoma of prostate and its application | |
| Moric et al. | Expression of genes KCNQ1 and HERG encoding potassium ion channels Ik r, Ik s in long QT syndrome | |
| CN107937538B (en) | Glioma diagnosis marker circ1:201817088|201817285 and application | |
| Komarova et al. | “Finnish” mutations in LDL Receptor gene: A rare cause of familial hypercholesterolemia in St. Petersburg and Petrozavodsk |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |