CN105907777A - Cas9 endonuclease secretion type expression vector as well as construction method and application thereof - Google Patents
Cas9 endonuclease secretion type expression vector as well as construction method and application thereof Download PDFInfo
- Publication number
- CN105907777A CN105907777A CN201610494618.7A CN201610494618A CN105907777A CN 105907777 A CN105907777 A CN 105907777A CN 201610494618 A CN201610494618 A CN 201610494618A CN 105907777 A CN105907777 A CN 105907777A
- Authority
- CN
- China
- Prior art keywords
- cas9
- chisp6h
- pct7
- recombinant
- expression carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the technical field of gene recombination, in particular to construction of a Cas9 endonuclease secretion type expression vector and application thereof. The method comprises the steps of: according to the sequence information of the Cas9 endonuclease gene order and a secretion expression vector pCT7-CHISP6H, constructing a recombinant expression plasmid pCT7-CHISP6H-Cas9 by an In-fusion method, and transforming the recombinant expression plasmid into escherichia coli BL21(DE3) to carry out recombinant expression to obtain secretion expressed Cas9 endonuclease. A recombinant protein with biological activity is obtained by affinity chromatography purification, and the recombinant protein can cut a target plasmid in vitro under the guidance of gRNA. Successful preparation of the Cas9 endonuclease recombinant protein with biological activity has important theoretical meaning and practical meaning for developing genome editing based on the recombinant Cas9 endonuclease.
Description
Technical field
The invention belongs to gene engineering technology field, specifically a kind of Cas9 Cobra venom endonuclease
Secreted expression carrier and construction method thereof and application.
Background technology
CRISPR/Cas(clustered regularly interspaced short
Palindromic repeats/CRISPR-associated systems), full name be often between
Palindrome repetitive sequence gathers together/often between palindrome repetitive sequence gather together related protein system.2010,
Garneau etc. find, at the type of streptococcus thermophilus Streptococcus thermophilus
In II CRISPR system Cas9 be uniquely can mediated dna cutting Cas nuclease.
Deltcheva etc. are found that type II CRISPR in streptococcus pyogenes S.pyogenes
Another important component: tracrRNA in system；TracrRNA participates in tracrRNA and precursor
CrRNA is combined into dimerization RNA hybrid, and under Cas9 and S-RNase III effect,
Precursor crRNA is made to become ripe crRNA.These two researchs disclose type II CRISPR
Three key components of system: Cas9, crRNA and tracrRNA.Jinek and Gasiunas
Being found through experiments, the Cas9 albumen that purification obtains can exist at crRNA Yu tracrRNA
Time, targeting DNA can be cut in test tube.And the bases such as Jinek
The dimeric structure of tracrRNA:crRNA RNA, merges the targeting positioning sequence of crRNA
Chimeric RNA it has been built into, also known as single guide RNA (sgRNA) on tracrRNA.
In vitro digestion test result indicate that, sgRNA equally mediates Cas9 to be carried out targeting DNA
Cutting.
Research worker utilizes CRISPR/Cas9 gene editing system successfully to mammalian genes
Target site in group is cut, and excites NHEJ Yu the HDR repair machine of cell
System, completes gene editing at related locus.And subsequently, CRISPR/Cas9 mediation is many
Locus gene editor the most successfully realize.Have relative to TALEN and ZFN, CRISPR/Cas9
Significantly advantage, it is without designing the DNA binding structural domain of series of complex, and research worker is only
CrRNA or sgRNA corresponding with target site need to be designed.This advantage greatly simplify base
Because of editor's early-stage preparations process.CRISPR/Cas9 system is at the gene editing of mammalian cell
In successful Application, pulled open the CRISPR/Cas9 prelude as gene editing instrument.
The simplicity of CRISPR/Cas9 edit tool and high efficiency so that it is applied to rapidly a series of
In animal-plant gene group editor research.
It is currently based on CRISPR/Cas9 system and organism is carried out the work of genome editor, to the greatest extent
The Cas9 albumen of final function exercised in vivo by pipe, but use at present
CRISPR/Cas9 system carries out in the research of genome manipulation, and its Cas9 is mainly by external
The Cas9mRNA of synthesis or complete by the way of recombiant plasmid.Utilize external synthesis
Cas9mRNA or there is more defect and deficiency by the way of recombiant plasmid, mainly wraps
Include following several respects: Cas9mRNA unstable, rear easily degraded in being expelled to organism；Weight
After group plasmid injection organism, need to be transcribed into further Cas9mRNA, translate into the most again
Cas9 albumen could realize its editor to organism genome, for cell division cycle relatively
For fast species, its mutant being difficult to produce stable heredity.Utilize Cas9 albumen permissible
Solving above-mentioned problems, but Cas9 albumen application at present is less, its reason is mainly Cas9
Albumen is relatively big, and its predicted molecular weight is about 170kD, is not easy by the way of vitro recombination
Realize it recombinant expressed.Efficient secretion type expression vector is used to realize the high efficient expression of Cas9,
Simplify the purifying process of Cas9 albumen, for carrying out gene editing based on Cas9 recombiant protein
Work significant.
Summary of the invention
Present invention aim at the problem not enough for solving current Cas9 recombiant protein source, it is provided that one
Plant Cas9 Cobra venom endonuclease secreted expression carrier and construction method thereof and application.
The technical solution used in the present invention is for achieving the above object:
A kind of Cas9 Cobra venom endonuclease secreted expression carrier, secreted expression carrier is for containing
Cas9 endonuclease gene and secretion expression carrier sequence.
Specifically, described secreted expression carrier pCT7-CHISP6H-Cas9:
With pCT7-CHISP6H-Cas9F/pCT7-CHISP6H-Cas9R for primer pair, with
Cas9P-1EA is template, carries out PCR amplification, and electrophoresis rear cutout glue reclaims；
Utilizing PmaC I that plasmid pCT7-CHISP6H carries out enzyme action, electrophoresis rear cutout glue reclaims phase
Answer fragment, carry out in-fusion with the PCR primer of above-mentioned recovery and be connected, connect product and convert
Bacillus coli DH 5 alpha competent cell, screens monoclonal, obtains the recombinant vector of structure；
pCT7-CHISP6H-Cas9F:CATCACCATCACCACGACAAGAAGTACAGCATCGGC
CT；
pCT7-CHISP6H-Cas9R:AAGCTTCGAATTCACTCACACTTTGCGCTTTTTCTTGG。
A kind of construction method of Cas9 Cobra venom endonuclease secreted expression carrier, with
PCT7-CHISP6H-Cas9F/pCT7-CHISP6H-Cas9R is primer pair, with Cas9P-1EA
For template, reclaim after carrying out PCR amplification；
Utilize PmaC I that plasmid pCT7-CHISP6H carries out enzyme action, reclaim respective segments, and
Carry out in-fusion with the PCR primer of above-mentioned recovery to be connected, connect product and convert escherichia coli
DH5 α competent cell, screens monoclonal, obtains the recombinant vector of structure；
pCT7-CHISP6H-Cas9F:CATCACCATCACCACGACAAGAAGTACAGCATCGGC
CT；
pCT7-CHISP6H-Cas9R:AAGCTTCGAATTCACTCACACTTTGCGCTTTTTCTTGG。
A kind of application of Cas9 Cobra venom endonuclease secreted expression carrier, described secretion type expression
Carrier application in efficient secretory expression Cas9 Cobra venom endonuclease.
Described recombinant expression plasmid pCT7-CHISP6H-Cas9 is converted to escherichia coli
BL21 (DE3), carries out abduction delivering with IPTG, centrifugal collection supernatant, obtains containing restructuring
The solution of Cas9 Cobra venom endonuclease, then carries out one-step method purification with metal chelate chromatography post,
And then obtain the recombinant C as9 Cobra venom endonuclease of purification.
Advantage for present invention: present invention obtains a kind of Cas9 endonuclease enzyme secretion
Type expression vector, and in escherichia coli, realize its efficient secretory expression and one-step method purification weight
Group Cas9 Cobra venom endonuclease.Gained recombinant C as9 Cobra venom endonuclease can be in the guidance of gRNA
Under target gene is cut, for carry out gene editing based on Cas9 recombiant protein work
Provide the foundation.The acquisition of recombinant C as9 Cobra venom endonuclease the most of the present invention is to carrying out base
Organism genome editor in Cas9 recombiant protein has important theory significance and practice meaning
Justice.
Accompanying drawing explanation
The Western blot of the recombinant expressed Cas9 that Fig. 1 provides for the embodiment of the present invention analyzes
Figure；Wherein, M is protein standard molecular weight；1 is the supernatant before induction；2 is induction 6h
After fermented supernatant fluid.
The recombinant expressed Cas9 albumen that Fig. 2 provides for the embodiment of the present invention is through affinitive layer purification
Chromatogram；In figure, at square frame, the absworption peak of mark is the restructuring obtained by stepwise elution
Cas9。
Recombiant protein desalination result after the affinitive layer purification that Fig. 3 provides for inventive embodiments；
Recombinant C as9 that in figure, at square frame, the absworption peak of mark obtains after being desalination.
Fig. 4 detects analysis chart for the external activity that recombinant C as9 that the embodiment of the present invention provides is white；
Wherein 1 be 1 μ l 10 μ g/mL recombinant C as9 cutting purpose fragments result；2 is 1 μ l
500 μ g/mL recombinant C as9 cutting results；3 is that 1mg/mL recombinant C as9 of 1 μ l is cut
Cut result；4 be 1 μ l concentration be the BSA control experiment of 1mg/mL.
Detailed description of the invention
In example below, the invention will be further elaborated, but the invention is not restricted to this.
The construction and expression of embodiment 1:Cas9 Cobra venom endonuclease secreted expression carrier
According to the sequence information of Cas9 in support C as9P-1EA, efficiently divide in conjunction with escherichia coli
Secrete the carrier pCT7-CHISP6H sequence construct of expressing heterologous albumen containing Cas9 gene point
Secrete type expression vector pCT7-CHISP6H-Cas9.
(1) according to Cas9 nucleotide sequence information in Cas9P-1EA, carry in conjunction with secreting, expressing
Body pCT7-CHISP6H andHD Clontech kit operation instructions, design
Its mature peptide sequence of primer amplification, primer sequence is as follows:
pCT7-CHISP6H-Cas9F:CATCACCATCACCACGACAAGAAGTACAGCATCGGC
(underscore partial sequence is the 15bp sequence mated with linearized vector pCT7-CHISP6H to CT
Row)
pCT7-CHISP6H-Cas9R:AAGCTTCGAATTCACTCACACTTTGCGCTTTTTCTT
(underscore partial sequence is the 15bp sequence mated with linearized vector pCT7-CHISP6H to GG
Row)
With pCT7-CHISP6H-Cas9F/pCT7-CHISP6H-Cas9R for primer pair, with
Cas9P-1EA is template (1ng/ μ l), carries out PCR amplification, concrete PCR reaction system
As follows with amplification program:
PCR reaction system is 50 μ l, including:
PCR amplification program: 98 DEG C of denaturations 1min；98 DEG C of degeneration 10s, 55 DEG C of annealing 5s,
72 DEG C extend 2min, totally 32 circulations；Last 72 DEG C extend 10min.
The agarose gel electrophoresis utilizing 1% carries out electrophoretic analysis to pcr amplification product, cuts glue
Reclaiming and predict fragment of the same size, clip size is about 4.2kb, utilizes NanoDrop
Measure and reclaim fragment concentrations (75ng/ μ l).
(2) the linearisation enzyme action of pCT7-CHISP6H plasmid
Utilize PmaC I that plasmid pCT7-CHISP6H is carried out enzyme action, utilize 0.8% agarose
Gel electrophoresis analysis digestion products, reclaims the endonuclease bamhi of about 2.5kb, and utilizes
NanoDrop measures and reclaims fragment concentrations (35ng/ μ l).
(3) structure of pCT7-CHISP6H-Cas9 carrier
According toHD Clontech kit operation instruction, produces the PCR reclaimed
The pCT7-CHISP6H linearization plasmid of thing and PmaC I enzyme action reacts, concrete reactant
System with reaction condition is: the PCR primer 1 μ l of recovery, the single endonuclease digestion carrier 2 μ l of recovery, 5
×HD 2 μ l, sterilized water 5 μ l, after mixing, react 15min at 50 DEG C
After be immediately placed on ice, then will connect product convert bacillus coli DH 5 alpha competent cell,
The coating LB solid plate containing 100 μ g/mL ampicillin, 37 DEG C of overnight incubation, with
T7-F/T7-ter (T7-F:5 '-TAATACGACTCACTATAGGG-3 '；T7-ter:
5 '-TGCTAGTTATTGCTCAGCG-3 ') it is primer pair, utilize PCR method that LB is put down
Monoclonal on plate detects, and PCR detects positive colony and carries out DNA sequencing after shaking bacterium,
Thus screen the recombinant vector of structure, named pCT7-CHISP6H-Cas9.(4) restructuring
The abduction delivering of Cas9
Extracting pCT7-CHISP6H-Cas9 plasmid, converts in e. coli bl21 (DE3), and 37
Under the conditions of DEG C, shake in the 5mL LB fluid medium containing 100 μ g/mL ampicillin
Bacterium, treating that cell concentration reaches OD600 is about 0.6, adds the IPTG of final concentration of 1mM
Carry out abduction delivering 6h.4 DEG C, after 10000g is centrifuged 10min, takes 30 μ l supernatant and add
Enter 6 × loading buffer of 6 μ l, after 100 DEG C are boiled 5min, carry out 10%
SDS-PAGE separates, and PAGE glue then carries out on GenScript eBlot transferring film, and 8
Take out pvdf membrane after dividing 20 seconds and be placed in the TBST solution containing 2-5% defatted milk powder closing 1h,
Then it is hatched 1h, TBST in the TBST solution of 1 ‰ mouse-anti anti-His antibody contents
Solution washes film, and HRP-DAB colour reagent box colour developing 5min, testing result is as shown in Figure 1.Figure
1 result shows, this recombiant plasmid is success after IPTG induces in e. coli bl21 (DE3)
Secreting, expressing.
Embodiment 2: the isolated and purified and Activity determination of recombinant C as9 Cobra venom endonuclease
Recombination engineering, after Western blot detects, is amplified experiment, is amplified to 400
ML volume.After fermentation liquid is centrifugal, on AKTA avant 25 protein purification system, by upper
Clear liquid directly utilizes His label protein purification prepacked column HisTrapTMFF Crude(5mL)
Carry out affinity chromatography purification.Specifically comprise the following steps that
HisTrapTMFF Crude (5mL) post after the ultrapure water of 10 times of column volumes,
With the combination buffer of 5 times of column volumes (in conjunction with the phosphoric acid hydrogen two that buffer is 50mM pH7.2
Sodium-phosphate sodium dihydrogen buffer solution, 300mM NaCl, 10mM imidazoles) balance；In fermentation liquid
Add 5M imidazoles mother solution, 3M NaCl mother solution and the phosphoric acid hydrogen two of 0.3M pH7.2 respectively
Sodium-phosphate sodium dihydrogen buffer solution to concentration of component each in fermentation liquid with combine in buffer consistent,
Mixing, 4 DEG C, 10000g is centrifuged 10min, takes HisTrap on supernatantTMFF Crude post,
Flow speed control is at 3mL/min；After end of the sample, in conjunction with 10 times of cylinders of wash buffer
Long-pending；Then utilize the eluent (disodium hydrogen phosphate of 50mM pH7.2-sodium dihydrogen phosphate buffering
Liquid, 300mM NaCl, 250mM imidazoles) carry out gradient elution, AKTA avant 25 is
System is collected automatically, eluting destination protein (box indicating destination protein in figure) as shown in Figure 2.
The component containing recombinant C as9 destination protein of affinitive layer purification, utilizes HiPrep 26/10
Desalting column carries out desalination on AKTA avant 25, and desalination result is as shown in Figure 3.By Fig. 3
It can be seen that destination protein is sufficiently separated (box indicating destination protein in figure).
Isolated and purified sample is carried out activity detection analysis: laboratory is built containing target
The plasmid (pMD19-T-EcChi4) of gene (EcChi4), T7 in vitro transcription synthesis target base
Because gRNA and isolated and purified recombinant C as9 of EcChi4 are mixed in buffer (20mM HEPES
PH 7.5,150mM KCl, 0.5mM DTT, 0.1mM EDTA, 10mM MgCl2In),
In 50 μ l reaction systems, under the conditions of 37 DEG C, react 90min, 1 μ l 100 under the conditions of 65 DEG C
Mg/mL E.C. 3.4.21.64 carries out digesting 5min, adds 10 μ l 6 × DNA loading buffer immediately
Liquid terminates endonuclease reaction, and the agarose gel checking of 1%, testing result is shown in Fig. 4.Result shows
Plasmid containing target gene can be cut by recombinant C as9 destination protein, has in vitro
There is digestion activity.
Recombinant C as9 with endonuclease activity that the present invention provides is for carrying out based on Cas9
The organism genome editor of recombiant protein has important theory significance and practice significance.
Claims (5)
1. a Cas9 Cobra venom endonuclease secreted expression carrier, it is characterised in that: secreting type table
Reach carrier for containing Cas9 endonuclease gene and secretion expression carrier sequence.
2. the Cas9 Cobra venom endonuclease secreted expression carrier as described in claim 1, its feature
It is: described secreted expression carrier pCT7-CHISP6H-Cas9:
With pCT7-CHISP6H-Cas9F/pCT7-CHISP6H-Cas9R for primer pair, with
Cas9P-1EA is template, carries out PCR amplification, and electrophoresis rear cutout glue reclaims；
Utilizing PmaC I that plasmid pCT7-CHISP6H carries out enzyme action, electrophoresis rear cutout glue reclaims phase
Answer fragment, carry out in-fusion with the PCR primer of above-mentioned recovery and be connected, connect product and convert
Bacillus coli DH 5 alpha competent cell, screens monoclonal, obtains the recombinant vector of structure；
pCT7-CHISP6H-Cas9F:CATCACCATCACCACGACAAGAAGTACAGCATCGGC
CT；
pCT7-CHISP6H-Cas9R:AAGCTTCGAATTCACTCACACTTTGCGCTTTTTCTTGG。
3. the structure of the Cas9 Cobra venom endonuclease secreted expression carrier described in a claim 1
Construction method, it is characterised in that: with pCT7-CHISP6H-Cas9F/pCT7-CHISP6H-Cas9R
For primer pair, with Cas9P-1EA as template, reclaim after carrying out PCR amplification；
Utilize PmaC I that plasmid pCT7-CHISP6H carries out enzyme action, reclaim respective segments, and
Carry out in-fusion with the PCR primer of above-mentioned recovery to be connected, connect product and convert escherichia coli
DH5 α competent cell, screens monoclonal, obtains the recombinant vector of structure；
pCT7-CHISP6H-Cas9F:CATCACCATCACCACGACAAGAAGTACAGCATCGGC
CT；
pCT7-CHISP6H-Cas9R:AAGCTTCGAATTCACTCACACTTTGCGCTTTTTCTTGG。
4. the Cas9 Cobra venom endonuclease secreted expression carrier described in a claim 1 should
With, it is characterised in that: described secreted expression carrier is in efficient secretory expression Cas9 nucleic acid
Cut the application in enzyme.
5. the application of the Cas9 Cobra venom endonuclease secreted expression carrier as described in claim 4,
It is characterized in that: described recombinant expression plasmid pCT7-CHISP6H-Cas9 is converted to large intestine
Bacillus BL21 (DE3), carries out abduction delivering with IPTG, centrifugal collection supernatant, is contained
There is the solution of recombinant C as9 Cobra venom endonuclease, then carry out one-step method with metal chelate chromatography post
Purification, and then obtain the recombinant C as9 Cobra venom endonuclease of purification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610494618.7A CN105907777A (en) | 2016-06-28 | 2016-06-28 | Cas9 endonuclease secretion type expression vector as well as construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610494618.7A CN105907777A (en) | 2016-06-28 | 2016-06-28 | Cas9 endonuclease secretion type expression vector as well as construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105907777A true CN105907777A (en) | 2016-08-31 |
Family
ID=56759036
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610494618.7A Pending CN105907777A (en) | 2016-06-28 | 2016-06-28 | Cas9 endonuclease secretion type expression vector as well as construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105907777A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014204725A1 (en) * | 2013-06-17 | 2014-12-24 | The Broad Institute Inc. | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation |
| CN104342445A (en) * | 2013-07-24 | 2015-02-11 | 中国科学院海洋研究所 | Vector for efficiently secreting and expressing heterogenous protein, and its application |
| CN104805099A (en) * | 2015-03-02 | 2015-07-29 | 中国人民解放军第二军医大学 | Nucleic acid molecule for encoding Cas9 (CRISPR (clustered regularly interspaced short palindromic repeat)-associated endonuclease 9) protein securely and expression vector of nucleic acid molecule |
| CN105695485A (en) * | 2014-11-27 | 2016-06-22 | 中国科学院上海生命科学研究院 | Cas9 encoding gene used for mycelial fungus Crispr-Cas system, and application thereof |
-
2016
- 2016-06-28 CN CN201610494618.7A patent/CN105907777A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014204725A1 (en) * | 2013-06-17 | 2014-12-24 | The Broad Institute Inc. | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation |
| CN104342445A (en) * | 2013-07-24 | 2015-02-11 | 中国科学院海洋研究所 | Vector for efficiently secreting and expressing heterogenous protein, and its application |
| CN105695485A (en) * | 2014-11-27 | 2016-06-22 | 中国科学院上海生命科学研究院 | Cas9 encoding gene used for mycelial fungus Crispr-Cas system, and application thereof |
| CN104805099A (en) * | 2015-03-02 | 2015-07-29 | 中国人民解放军第二军医大学 | Nucleic acid molecule for encoding Cas9 (CRISPR (clustered regularly interspaced short palindromic repeat)-associated endonuclease 9) protein securely and expression vector of nucleic acid molecule |
Non-Patent Citations (1)
| Title |
|---|
| JIA LIU等: "Efficient delivery of nuclease proteins for genome editing in human stem cells and primary cells", 《NATRUE PROTOCOLS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106414713A (en) | Engineered escherichia coli for producing 1,5-pentanediamine by whole-cell catalysis and application thereof | |
| CN109679932A (en) | A kind of archaeal dna polymerase, recombinant vector and their preparation method and application | |
| CN111607613A (en) | Plasmid vector for expressing mRNA of cellular immune vaccine and construction method and application thereof | |
| CN112899253B (en) | Polypeptide with DNA polymerase activity, recombinant vector, preparation method and application thereof | |
| CN111448315A (en) | Method for separating DNA (deoxyribonucleic acid) by Cas (Cas) protein system | |
| CN105907777A (en) | Cas9 endonuclease secretion type expression vector as well as construction method and application thereof | |
| CN109022390A (en) | A method of isolating and purifying Escherichia coli recombination phospholipase D | |
| CN114645033B (en) | Nucleoside triphosphate hydrolase and purification method and application thereof | |
| CN104342445A (en) | Vector for efficiently secreting and expressing heterogenous protein, and its application | |
| CN114410608B (en) | Method for efficiently expressing and purifying Cas9 protein and application thereof | |
| CN114921436B (en) | Terminal deoxynucleotidyl transferase mutant, encoding gene, recombinant expression plasmid and genetically engineered bacterium thereof | |
| CN101892253A (en) | Method for preparing thrombolytic medicament Reteplase without inclusion-body renaturation in escherichia coli | |
| Shin et al. | Targeted genome editing using DNA-free RNA-guided Cas9 ribonucleoprotein for CHO cell engineering | |
| CN105802989A (en) | Vector, gene and method for expressing recombinant protein in pichia pastoris and application of recombinant protein | |
| CN105802935A (en) | Esterase PHE14 as well as encoding gene and application thereof | |
| CN116102663A (en) | Monkey poxvirus B6R antigen and preparation method and application thereof | |
| CN108265042A (en) | A kind of preparation method of recombinant enterokinase | |
| CN113430220A (en) | Synthesis method, construction method and application of genetic engineering bacteria for expressing soluble feline omega interferon | |
| CN105132394A (en) | LIPASE 6 as well as encoding gene and application thereof | |
| RU2816876C1 (en) | NUCLEASE Cpf1 FROM BACTERIUM RUMINOCOCCUS BROMII, DNA MOLECULE OR RNA CODING NUCLEASE, VECTOR CONTAINING SAID DNA MOLECULE, CRISPR/Cpf1 SYSTEM CONTAINING SAID NUCLEASE AND GUIDE RNA, HOST CELL FOR PRODUCING NUCLEASE Cpf1, METHOD OF PRODUCING NUCLEASE Cpf1 AND USE THEREOF | |
| CN105238769A (en) | Lipase LIPASE7 as well as coding gene and application thereof | |
| CN104911189B (en) | Human Annexin V gene optimization sequence and manufacturing method and application thereof | |
| CN106085985A (en) | A kind of esterase WDEst9 and encoding gene thereof and application | |
| CN108220257A (en) | The vivoexpression and purification process of PHD2 albumen | |
| CN114990078B (en) | Construction method and application of recombinant newcastle disease virus with His tag |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160831 |
|
| WD01 | Invention patent application deemed withdrawn after publication |