CN105821072A - CRISPR-Cas9 system used for assembling DNA and DNA assembly method - Google Patents

Abstract

The invention discloses a CRISPR-Cas9 system used for assembling DNA and a DNA assembly method. The CRISPR-Cas9 system includes the following parts: a plasmid used for expressing Cas9 gene, a first guide RNA, and/or a plasmid used for expressing the first guide RNA, wherein the first guide RNA has a CRISPR site. The CRISPR site is combined with a first reporter gene carried by a semisynthetic chromosome used for assembling according to base complementation pairing rule. The CRISPR-Cas9 system has advantages of high replacement success rate of homologous recombination, less species of guide RNA which needs to design and use, less harmful effect subjected by the genomic sequence, and low off-target rate.

Description

The CRISPR-Cas9 system assembled for DNA and DNA assemble method

Technical field

The present invention relates to the synthetic gene group technology in synthetic biology field, particularly relate to a kind of CRISPR-Cas9 system assembled for DNA and DNA assemble method.

Background technology

CRISPR-Cas9 is the IRCM Self-Defence System IRCM of antibacterial and Archimycetes, it is possible to by the external double-stranded DNA of single stranded RNA identification, and produces double bond fracture thereon by Cas9 nuclease, eliminates foreign DNA and infects.CRISPR-Cas9 system has portability, can travel DNA identification and excision function, be the most transformed into outstanding genome edit tool after transformation in the cell including the eukaryote such as including saccharomyces cerevisiae.Compared to Zinc-Finger and TALE technology, CRISPR-Cas9 because of its simple DNA recognition principle (utilize RNA to combine to identify, and unlike the above two utilize can be in conjunction with the albumen of DNA) and become one of the most popular research field.One research direction of CRISPR-Cas9 is to utilize it identify specific DNA and produce the characteristic of double bond fracture thereon, the efficiency of foreign DNA restructuring when strengthening homologous recombination.

The synthetic gene group in synthetic biology field needs the cooperation of multiple DNA package technique at present, synthetic gene group just can be made gradually to assemble from oligo, and these technology the most important thing is, replacement based on homologous recombination assembles (will synthesize and replace wild part on fragment replacement ingrain colour solid out of office, gradually form synthesis chromosome).But homologous recombination incidence rate in its natural state is the lowest so that causing the success rate replaced relatively low, the screening rate of correct clone tends not to reach the requirement of experimenter.As far back as 1997^[1]With 2011^[2]Zinc-Finger and TALE just has been used to produce double bond fracture and increase the efficiency of homologous recombination, but owing to the inferior position of himself is (as any DNA can not be identified by Zinc-Finger, Zinc-Finger and TALE preparation and use loaded down with trivial details etc.), often make experimenter consume too much resource in the middle of experiment material prepares.By contrast, CRISPR (ClusteredRegularlyInterspacedShortPalindromicRepeats, regular intervals cluster short palindrome repetitive sequence) it is capable of identify that all of DNA, prepared by material, it is the simplest to use so that it is become outstanding succedaneum.

But, due to CRISPR system only by the shortest RNA (referred to as guideRNA, it is called for short guide RNA, gRNA, it is made up of the PAM site+RNA structural arm of the RNA-DNA binding site+3bp of 20bp, wherein the binding site of 20bp is also referred to as CRISPR site) target fragment is identified, situation about missing the target is serious compared with Zinc-Finger and TALE technology.Therefore, CRISPR site is carried out strict design, thus reducing its efficiency of missing the target is the most important thing, the most existing many documents^[3]Effect of missing the target CRISPR is studied, and occurs in that the instrument that multiple CRISPR designs^[4-7]。

Patented technology relevant for the most domestic CRISPR concentrates on gene knockout, structure knocks out on library, such as " utilizing the method that CRISPR/Cas9 system constructing eukaryotic gene knocks out library " (CN103668472A, 2014.03.26), the most do not utilize CRISPR technology to strengthen homologous recombination rate thus improve the patented technology report that synthetic gene group packaging efficiency is relevant.

Patented technology relevant for the CRISPR of Great Britain and USA is mainly by a cutting edge of a knife or a sword application of MIT, the distribution of its patent subassembly each to CRISPR system, transform, optimize and limit the tightest, such as DELIVERY, ENGINEERINGANDOPTIMIZATIONOFSYSTEMS, METHODSANDCOMPOSITIONSFORSEQUENCEMANIPULATIONANDTHERAPEU TICAPPLICATIONS (US2014242699 (A1), 2014-08-28).

Summary of the invention

The present invention provides a kind of CRISPR-Cas9 system assembled for DNA and DNA assemble method, it is possible to increase carries out homologous recombination rate when DNA assembles by homologous recombination, meets the requirement increasing positive colony rate.

According to the first aspect of the invention, the present invention provides a kind of CRISPR-Cas9 system assembled for DNA, including following ingredient:

For expressing the plasmid of Cas9 gene；With

First guide RNA and/or for expressing the plasmid of described first guide RNA, wherein said first guide RNA has CRISPR site, and this CRISPR site combines the first reporter gene entrained by semi-synthetic chromosome for assembling according to base pair complementarity principle.

As the preferred version of the present invention, described CRISPR-Cas9 system also includes following ingredient:

Host cell, described host cell carries described semi-synthetic chromosome, and described semi-synthetic chromosome comprises synthesis chromosome sequence and wild chromosome sequence and described first reporter gene therebetween；

Fragment to be assembled, there is one section of sequence homology of one section of sequence and close described first reporter gene of described synthesis chromosome sequence one end of described fragment to be assembled, and the inner side of the other end has the second reporter gene and outside to have one section of sequence and described wild chromosome sequence homology.

As the preferred version of the present invention, described CRISPR-Cas9 system also includes following ingredient:

Second guide RNA and/or for expressing the plasmid of described second guide RNA, wherein said second guide RNA has CRISPR site, and this CRISPR site combines described second reporter gene according to base pair complementarity principle.

As the preferred version of the present invention, described first reporter gene and the second reporter gene are two kinds in the reporter gene in yeast, preferably LEU2, URA3, HIS3, TRP1, MET17 and LYS2, more preferably LEU2 and URA3.

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene LEU2 is:

GAAAGGTGAGAGGCCGGAAC (SEQIDNO:1)；

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene URA3 is:

GTGGGCCCAGGTATTGTTA (SEQIDNO:2).

As the preferred version of the present invention, described fragment to be assembled is the genomic fragment of synthesis, and described CRISPR site has the highest reliability mark in all potential site of the reporter gene of its correspondence.

As the preferred version of the present invention, described reliability mark is calculated by equation below (1):

$S_{guide}=\frac{100}{100+{\mathrm{\Σ}}_{i=1}^{n_{off}}{S}_{hit}\left(i\right)}---\left(1\right);$

Wherein, i represents each site of missing the target on described genome, S_hitRepresent the probability mark that misses the target in each site of missing the target, n_offRepresent the site sum that misses the target, S_guideRepresent the reliability mark in each CRISPR site；

The probability mark S that misses the target in described each site of missing the target_hitIt is calculated by equation below (2):

$S_{hit}=\underset{e\∈M}{\Π}(1-W\[e\])\×\frac{1}{(\frac{(19-\stackrel{\‾}{d)}}{19}\×4+1)}\×\frac{1}{n_{mm}^2}---\left(2\right);$

Wherein, e represents the actual mismatch site in described CRISPR site and corresponding site of missing the target, and M refers to the set of theoretical mismatch site, and W [e] represents the different mismatch site contribution margin to missing the target, and d represents mismatch site average distance between any two, n_mmRepresent the sum of mismatch site；Wherein, W [e], according to mismatch site order, meets as follows: $\begin{array}{c}W\[e\]=\[0,0,0.014,0,0,0.395,0.317,0,0.389,0.079,0.445,\\ 0.508,0.613,0.851,0.732,0.828,0.615,0.804,0.685,0.583\]\end{array}.$

According to the second aspect of the invention, the present invention provides a kind of DNA assemble method, and described method includes:

To be used for expressing the plasmid of Cas9 gene, plasmid and fragment to be assembled for expressing the first guide RNA proceed in host cell, described host cell carries semi-synthetic chromosome, described semi-synthetic chromosome comprises synthesis chromosome sequence and wild chromosome sequence and the first reporter gene therebetween, described first guide RNA has CRISPR site, this CRISPR site combines described first reporter gene according to base pair complementarity principle, there is one section of sequence homology of one section of sequence and close described first reporter gene of described synthesis chromosome sequence one end of described fragment to be assembled, the inner side of the other end of described fragment to be assembled has the second reporter gene and outside to have one section of sequence and described wild chromosome sequence homology；

Described Cas9 gene and described first guide rna expression, produce Cas9 nuclease and described first guide RNA, so that described first guide RNA is attached on described first reporter gene, and mediate described Cas9 nuclease make described semi-synthetic chromosome produce double bond fracture, the semi-synthetic chromosome making fracture is more likely to and described fragment homologous recombination to be assembled, thus described fragment to be assembled is assembled on described semi-synthetic chromosome.

According to the second aspect of the invention, the present invention also provides for a kind of DNA assemble method, and described method includes:

To be used for expressing the plasmid of Cas9 gene, the product and the fragment to be assembled that comprise the first guide RNA proceed in host cell, described host cell carries semi-synthetic chromosome, described semi-synthetic chromosome comprises synthesis chromosome sequence and wild chromosome sequence and the first reporter gene therebetween, described first guide RNA has CRISPR site, this CRISPR site combines described first reporter gene according to base pair complementarity principle, there is one section of sequence homology of one section of sequence and close described first reporter gene of described synthesis chromosome sequence one end of described fragment to be assembled, the inner side of the other end of described fragment to be assembled has the second reporter gene and outside to have one section of sequence and described wild chromosome sequence homology；

Described Cas9 gene expression, produce Cas9 nuclease, so that described first guide RNA is attached on described first reporter gene, and mediate described Cas9 nuclease make described semi-synthetic chromosome produce double bond fracture, the semi-synthetic chromosome making fracture is more likely to and described fragment homologous recombination to be assembled, thus described fragment to be assembled is assembled on described semi-synthetic chromosome.

Preferably, the product comprising the first guide RNA described in is produced by PCR method.

As the preferred version of the present invention, be respectively selected from LEU2 and URA3 one of described first reporter gene and the second reporter gene；

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene LEU2 is:

GAAAGGTGAGAGGCCGGAAC (SEQIDNO:1)；

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene URA3 is:

GTGGGCCCAGGTATTGTTA (SEQIDNO:2).

As the preferred version of the present invention, described CRISPR site has the highest reliability mark in all potential site of the reporter gene of its correspondence；

Preferably, described reliability mark is calculated by equation below (1):

$S_{guide}=\frac{100}{100+{\mathrm{\Σ}}_{i=1}^{n_{off}}{S}_{hit}\left(i\right)}---\left(1\right);$

Wherein, i represents each site of missing the target on described genome, S_hitRepresent the probability mark that misses the target in each site of missing the target, n_offRepresent the site sum that misses the target, S_guideRepresent the reliability mark in each CRISPR site；

The probability mark S that misses the target in described each site of missing the target_hitIt is calculated by equation below (2):

$S_{hit}=\underset{e\∈M}{\Π}(1-W\[e\])\×\frac{1}{(\frac{(19-\stackrel{\‾}{d)}}{19}\×4+1)}\×\frac{1}{n_{mm}^2}---\left(2\right);$

Wherein, e represents the actual mismatch site in described CRISPR site and corresponding site of missing the target, and M refers to the set of theoretical mismatch site, and W [e] represents the different mismatch site contribution margin to missing the target, and d represents mismatch site average distance between any two, n_mmRepresent the sum of mismatch site；Wherein, W [e], according to mismatch site order, meets as follows: $\begin{array}{c}W\[e\]=\[0,0,0.014,0,0,0.395,0.317,0,0.389,0.079,0.445,\\ 0.508,0.613,0.851,0.732,0.828,0.615,0.804,0.685,0.583\]\end{array}.$

According to the third aspect of the invention we, the present invention provides the built-up synthetic chromosome of the DNA assemble method described in a kind of second aspect or synthetic gene group.

According to the fourth aspect of the invention, the present invention provides a kind of synthetic microorganism, the chromosome of described synthetic microorganism or genome built-up by the DNA assemble method described in second aspect.

Preferably, described microorganism is eukaryotic microorganisms, more preferably yeast.

The DNA assemble method of the present invention has repeatable operability, and the pervasive chromosome in all microorganisms or the synthetic of genome, therefore necessarily can obtain containing synthetic chromosome or the microorganism of synthetic gene group according to the DNA assemble method of the present invention.Synthetic chromosome or synthetic gene group can be extracted as required further；And the method extracting chromosome or genome from microorganism is that those skilled in the art are capable of.One embodiment of the invention has successfully synthesized artificial yeast.

The present invention utilizes CRISPR-Cas9 system to replace homologous recombination and is optimized, and it has the beneficial effect that: the adverse effect that the guide RNA kind based on homologous recombination replace to that power is high, needing design and use is few, genome sequence is subject to is few, miss rate is low.

(1) in theory, saccharomyces cerevisiae produces double bond fracture and enable to homologous recombination rate increase by 4000 times^[11].Separately having document to prove, use CRISPR system that double-stranded DNA produces double bond fracture, breakaway poing closes on homologous recombination district, it is possible to make the homologous recombination efficiency of double-stranded DNA at least increase 130 times^[10], so that the screening rate of positive colony is greatly promoted；

(2) there is specific number due to reporter gene, as the present invention used 2 reporter genes, so having only to two kinds of guide RNA of design and use；

(3) few due to the design number of guide RNA so that the test of effect of missing the target in CRISPR site is the simplest, thus its harmfulness is had preferably control.Additionally, the binding site in CRISPR site is designed in reporter gene (comprising promoter, CDS and terminator three part), it it not the content of genome synthesis zone due to reporter gene, can replace in an assembling process, so even surprisingly introduce harmful sudden change in homologous recombination, (double bond is broken in cell and is mainly repaired by homologous recombination and non-homologous end joining two ways, and non-homologous end joining can introduce sudden change), do not interfere with yet and obtain final synthetic gene group；

(4) in addition, owing to the design consideration in CRISPR site is comprehensive, to within the certain number of mismatch site in all CRISPR sites (within 5, containing 5) all mismatch site mark, the final reliability mark obtaining each CRISPR position, the site reliability relying on this reliability mark to choose is high, and effect of missing the target is little, thus reduces the probability that synthetic gene group is made mistakes.

Accompanying drawing explanation

Fig. 1 is that the present invention uses CRISPR-Cas9 system to increase the principle schematic of homologous recombination rate in the homologous recombination that DNA assembles is replaced.

Fig. 2 is that pYP003 plasmid enzyme restriction verifies electrophoretogram.

Fig. 3 is pRS413_Cas9 plasmid NotI digestion verification electrophoretogram.

Fig. 4 is pRS413_ADH1_Cas9 plasmid BsrGI digestion verification electrophoretogram.

Fig. 5 is pRS411_gRNA series plasmids NheI and BsaI digestion verification electrophoretogram；Wherein, band " * " is labeled as mistake monoclonal.

Fig. 6 is CRISPR active testing colony growth lithograph；Wherein, circle marks bacterium colony for pink bacterium colony.

Fig. 7 is that CRISPR system 1K-40 fragment replaces efficiency test colony growth lithograph.

Fig. 8 is the schematic diagram that homologous recombination replaces H fragment in BY4741_synchr07G bacterial strain.

Fig. 9 is the schematic diagram that homologous recombination replaces I fragment in BY4741_synchr07H bacterial strain.

Detailed description of the invention

Below by detailed description of the invention, the present invention is described in further detail.Unless stated otherwise, the technology used in example below is routine techniques known to those skilled in the art；The instrument and equipment used and reagent etc., being those skilled in the art can be obtained as being purchased etc. by public approach.

In the present invention, the concept such as " first ", " second " that use in any case shall not be interpreted as the implication with order and technology, and its effect is only that and it is distinguished with other object.

Refer to Fig. 1, use CRISPR-Cas9 system to increase the principle schematic of homologous recombination rate in homologous recombination is replaced.During synthetic gene group, when the homologous recombination carrying out megachunk fragment B (referred to as " fragment to be assembled ") is replaced, Cas9 nuclease is by the guide RNA that designs (i.e. anti-LEU2 is referred to as " the first guide RNA ") to the reporter gene LEU2 introduced when carrying out megachunk fragment A homologous recombination (referred to as " the first reporter gene "；Can also be URA3, corresponding guide RNA be anti-URA3) it is identified, produce double bond fracture, owing to the position of generation double bond fracture is near the homology region that megachunk fragment B homologous recombination is replaced, thus strengthen homologous recombination efficiency.In Fig. 1, semi-synthetic chromosome refers to the wild chromosome through once or repeatedly megachunk fragment homologous recombination^[8], containing synthesis chromosome sequence and wild chromosome sequence on semi-synthetic chromosome.Each megachunk refers to the DNA unit of a homologous recombination replacement, about 50kb length, it can be specifically the complete fragment of total length, can also be divided into multiple having the subfragrnent of homology region each other (in one embodiment of the invention, megachunk fragment B refers to 5 subfragrnents having about 1kb homology region each other), each megachunk is all with the reporter gene being used alternatingly, such as LEU2 and URA3 being used alternatingly.In homologous recombination is replaced, megachunk carries out introducing reporter gene when a homologous recombination is replaced and, to help screening positive clone, is replaced again when upper once homologous recombination is replaced.

In the present invention, homologous recombination alternative includes two parts content: one is to design strict CRISPR site to reduce potential effect of missing the target；Two is that the CRISPR site according to design carries out homologous recombination based on CRISPR system replacement.

One .CRISPR site design:

First, by can allow for the short sequence alignment program of fixing mispairing number (such as Batmis^[9]) obtain each potential site (20nt+NGG) on reporter gene and all potential sites site of missing the target (i.e. compared with potential site, on genomic DNA mispairing number less than or equal to 5 coupling site).Then, is marked in its site of missing the target, and select the little site of effect of missing the target as optimal candidate site.

There is following several character in possible site of missing the target^[3](possess one of them and be i.e. probably site of missing the target):

(1) identical 20nt adds NGG or NAG；

(2) have less than equal to 3 mispairing with potential site；

(3) have less than occurring near PAM in the range of 8-12bp equal to 2 mispairing with potential site；

(4) mispairing is discontinuous and is spaced more than or equal to 4bp.

In order to carry out quantitatively to effect of missing the target, introduce marking system.Consider because of have: the mispairing of the CIRPSR site of design and the site sequence that misses the target is total, the absolute position of mispairing, mispairing average distance between any two^[3].The probability mark S that misses the target in each site of missing the target_hitIt is calculated by equation below:

$S_{hit}=\underset{e\∈M}{\Π}(1-W\[e\])\×\frac{1}{(\frac{(19-\stackrel{\‾}{d)}}{19}\×4+1)}\×\frac{1}{n_{mm}^2};$ Wherein, e represents the actual mismatch site in CRISPR site and corresponding site of missing the target, and M refers to the set of theoretical mismatch site, and W [e] represents the different mismatch site contribution margin to missing the target, and d represents mismatch site average distance between any two, n_mmRepresent the sum of mismatch site；Wherein, W [e], according to mismatch site order, meets as follows: $\begin{array}{c}W\[e\]=\[0,0,0.014,0,0,0.395,0.317,0,0.389,0.079,0.445,\\ 0.508,0.613,0.851,0.732,0.828,0.615,0.804,0.685,0.583\]\end{array}.$ Thus, probability of missing the target mark is the highest, and the probability that this site becomes site of missing the target is the highest.

It addition, the reliability mark in each CRISPR site designed is calculated by equation below:

$S_{guide}=\frac{100}{100+{\mathrm{\Σ}}_{i=1}^{n_{off}}{S}_{hit}\left(i\right)};$ Wherein, i represents each site of missing the target on described genome, S_hitRepresent the probability mark that misses the target in each site of missing the target, n_offRepresent the site sum that misses the target, S_guideRepresent the reliability mark in each CRISPR site.Thus, the probability mark in CRISPR site is the highest, and this site is the best.

The CRISPR site of reliability mark front three of LEU2 and URA3 is obtained the most as shown in Table 1 and Table 2 by said method.

The CRISPR site of table 1LEU2 reliability mark front three

The CRISPR site of table 2URA3 reliability mark front three

Note:

1. title is by design object name, design sequence number, design attitude, design place chain and the PAM information structure of design.Being LEU2 as LEU2_15_140_+_CGG represents design object, this is the 15th the potential site searched out, position 140 on LEU2, the potential site, potential site normal chain on LEU2+, PAM site is CGG；

2. reliability mark is up to 1, minimum 0；

3. can substantially estimate, by the information such as gene coding region, place, site of missing the target, the impact that the sudden change that this CRISPR site introduces is likely to result in；

4. mispairing situation is made up of the distance between base mismatch and base mismatch, is respectively A, T, A, C, A as 5A0T1A4C1A4 represents the 6th, 7,9,14,16 base mismatch；

5. for other reporter gene in addition to LEU2 and URA3, as HIS3, TRP1, MET17, LYS2 can also design CRISPR site by said method.

Two. homologous recombination is replaced

CRISPR site according to design carries out homologous recombination replacement^[10], after utilizing CRISPR-Cas9 system that target location (reporter gene) is carried out double bond fracture so that the homologous fragment of importing is easier to restructuring.

The following two kinds can be used for the CRISPR-Cas9 system of the present invention:

1., by Cas9 gene and two plasmid cotransformations at guide RNA place, make it express the most respectively.

2. by Cas9 gene place Plastid transformation so that it is express；The expression cassette comprising promoter, guide RNA sequence and terminator on the plasmid of guide RNA place is used PCR amplification, needs when, PCR primer is converted, in order to guide RNA can be expressed in cyton momently.

Describing the present invention below by way of specific embodiment, following example are only exemplary, in order to the feasibility of the present invention to be described, should not be interpreted as limiting the scope of the invention.It will be appreciated by those of skill in the art that the assembling that in various microbial bodies, especially can realize various DNA fragmentation according to method disclosed by the invention in eukaryotic microorganisms.

Embodiment 1

1. couple reporter gene LEU2 and URA3, fragment replacement test gene YBR157C design CRISPR site (concrete grammar is shown in above-mentioned " design of CRISPR site " part) (table 3).

Table 3

The acquisition of 2.Cas9 gene expression plasmid and transformation

The most original Cas9 gene expression plasmid pYP003 is gifted by teacher Dai Junbiao of Tsing-Hua University, it is possible to by commercially available, it is possible to by gene chemical synthesis, company synthesizes.Cas9 sequence is as shown in SEQ ID NO:12.

B. it is labeled as LEU2 due to the deficiency of original Cas9 gene expression plasmid, conflicts with the reporter gene replacing fragment, therefore utilize and limit enzyme NheI and SpeI (NEB) enzyme action pYP003 plasmid acquisition Cas9 genetic fragment.(table 4) enzyme action system below preparation in 200 μ LPCR pipes, the optimum temperature at enzyme reacts 3 hours.

Table 4

Component	Consumption
		Limit enzyme NheI	1μL
Limit enzyme SpeI	1μL
		10X CutSmart buffer	2μL
PYP003 plasmid	2μg
		ddH2O	Supply 20 μ L

C., digestion products carries out sepharose electrophoresis, and agarose gel concentration is 1.2%, uses 6 μ L λ-HindIIIdigestMarker, and voltage is 120V, and electrophoresis time is 45min.Fig. 2 is pYP003 plasmid enzyme restriction result electrophoretogram.Carrying out cutting glue purification again, purification step is with reference to gel purification kit description.

D. to pRS413 plasmid (being provided by New York University professor JefBoeke, it is possible to by commercially available), the profile information of plasmid can be found in snapgene website.Using SpeI to limit enzyme and carry out enzyme action, enzyme action system and reaction condition see step 2-b, wherein limit enzyme and change SpeI into, thus obtain linearizing pRS413.

E. being purified digestion products, purification step is with reference to PCR purification kit description.

F. two kinds of purified products of step 2-c, step 2-e being utilized T4 ligase, prepare coupled reaction system according to table 5,16 DEG C overnight connect.

Table 5

Component	Consumption
		Cas9 fragment	80ng
Linearisation pRS413 plasmid vector	20ng
		10X ligase buffer	1μL
ddH2O	Supply 10 μ L

Take 10 μ L and connect product conversion DH5 α competent escherichia coli cell.Finally obtain growth and have the flat board of monoclonal bacterium colony.

G. picking monoclonal bacterium colony put into 3mL added ampicillin Ampicilin antibiotic (type of antibiotic is corresponding with the resistance of pRS413) LB fluid medium shake in tube, 37 DEG C of 200rpm incubated overnight.

H. being centrifuged 1min with 1.5mL centrifuge tube 12000rpm and collect thalline, extract plasmid, plasmid extraction step is with reference to the description of plasmid extraction kit.

I. taking 2 μ L plasmid DNA and carry out sepharose electrophoresis, agarose gel concentration is 1%, and 3 μ L λ-HindIIIdigestMarker, voltage is 130V, and electrophoresis time is 45min.

J. using NotI restriction endonuclease to carry out enzyme action the plasmid that 2～3 banding patterns are correct, the step again carrying out electrophoresis, enzyme action and electrophoresis sees step 2-b and step 2-c respectively.Fig. 3 is pRS413_Cas9 plasmid NotI digestion verification result figure.

The bacterium at k. correct to banding pattern plasmid place carries out protecting bacterium work.Take sterilized 1.5mL centrifuge tube, add 500 μ L and identify the bacterium solution of correct bacterial strain, the glycerol of 500 μ L50% ,-80 DEG C of Refrigerator stores after mixing, thus obtain pRS413_Cas9.

L. gene chemical synthesis company is utilized to synthesize 2 primers (sequence is shown in ADH1 promoter primer (table 6), SEQIDNO:13～14).

Table 6

M. with above-mentioned two primers, pYP003 plasmid is carried out PCR:98 DEG C (1min), 98 DEG C of (10s)-> 55 DEG C (30s)-> 72 DEG C (1min) are circulated 30 and are taken turns, 72 DEG C (5min), 12 DEG C (maintenance).PCR system sees below (table 7).

Table 7

Component	Consumption
		PrimerSTAR exo+ polymerase	0.4μL
5X PS buffer	8μL
		Template DNA (plasmid pYP003)	10ng 10 -->
Primer	4μL
		dNTP	3.2μL
ddH2O	Supply 40 μ L

N., pcr amplification product is cut glue purification, and step sees 2-c.

O. utilizing SalI to limit enzyme and by pRS413_Cas9 plasmid linearization and cut glue recovery, step sees 2-b and 2-c.

P. the purified product that 2-n and 2-o two step obtains being carried out Gibson assembling, number of assembling steps sees document " EnzymaticassemblyofDNAmolec μ Lesuptoseveralhundredkilobases "^[12], assembly system required during assembling can be by buying the Gibson that NEB company providesMasterMix obtains.Taking 10 μ L and assemble product conversion DH5 α competent escherichia coli cell, finally obtaining growth has the flat board of monoclonal bacterium colony.

Q. picking monoclonal bacterium colony put into add ampicillin Ampicilin antibiotic (type of antibiotic is corresponding with the resistance of pRS413) 3mLLB fluid medium shake in tube, 37 DEG C of 200rpm incubated overnight.

R. being centrifuged 1min with 1.5mL centrifuge tube 12000rpm and collect thalline, extract plasmid, plasmid extraction step is with reference to the description of plasmid extraction kit.

S. taking 2 μ L plasmid DNA and carry out sepharose electrophoresis, agarose gel concentration is 1%, and 3 μ L λ-HindIIIdigestMarker, voltage is 130V, and electrophoresis time is 45min.

T. using BsrGI restriction endonuclease to carry out enzyme action the plasmid that 2～3 banding patterns are correct, the step again carrying out electrophoresis, enzyme action and electrophoresis sees step 2-b and step 2-c respectively.Fig. 4 is pRS413_ADH1_Cas9 plasmid BsrGI digestion verification result figure.

The bacterium at u. correct to banding pattern plasmid place carries out protecting bacterium work.Take sterilized 1.5mL centrifuge tube, add 500 μ L and identify the bacterium solution of correct bacterial strain, the glycerol of 500 μ L50% ,-80 DEG C of Refrigerator stores after mixing, thus obtain pRS413_ADH1_Cas9 plasmid.

3. build gRNA expression plasmid

A. gRNA expression cassette is divided into two fragments: fragment 1 SNR52 promoter adds CRISPR site sequence, fragment 2 CRISPR site sequence, gRNA skeleton add SUP4 terminator, CRISPR site sequence is wherein used for as two-part coincidence district follow-up Gibson and assembles.CRISPR site sequence referred to herein as the CRISPR site of anti-LEU2, anti-URA3 and anti-YBR157C in table 3.The oligonucleotide chain (see gRNA_oligo information, table 8, SEQIDNO:15～28) built for gRNA expression plasmid by the synthesis of gene chemical synthesis company.

Table 8

The pRS411 plasmid that gRNA expression vector selects nutrient defect type mark to be MET.This plasmid is provided (also can be by commercially available) by the JefBoeke of New York University, and its sequence information can pass through the gb formatted file acquisition on NCBI about this plasmid.

B. using oligonucleotide chain SNR52p-F and SNR52p-R (SEQIDNO:15～21) is primer, wild-type yeast BY4741 genome (extracted by phenol chloroform method and obtain) is that template carries out PCR acquisition fragment 1:98 DEG C (1min), 98 DEG C of (10s)-> 48 DEG C (30s)-> 72 DEG C (35s) are circulated 30 and are taken turns, 72 DEG C (5min), 12 DEG C (maintenance).PCR system sees below (table 9).

Table 9

C. using oligonucleotide chain gRNA-F (SEQIDNO:22～27) and gRNA-SUP4-R is primer, with plasmid pSB1C3-sgRNA_aroK (construction method: pSB1C3 plasmid relevant information can be obtained by the inquiry of iGEM official website；nullAfter cutting pSB1C3 plasmid by XbaI and SpeI restriction enzyme,Sequence TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCGCGCCCAATAGTGCTTTTTCg TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAA AGTGGCACCGAGTCGGTGGTGCTTTTTTTGTTTTTTATGTCT (SEQIDNO:35) is connected into linearizing pSB1C3 carrier，I.e. obtain pSB1C3-sgRNA_aroK plasmid) it is that template carries out PCR acquisition fragment 2:98 DEG C (1min)，98 DEG C of (10s)-> 48 DEG C (30s)-> 72 DEG C (20s) are circulated 30 and are taken turns，72℃(5min)，12 DEG C (maintenance).PCR system sees below (table 10).

Table 10

D. the PCR primer that 3-b and 3-c obtains being carried out PCR primer purification, step sees 2-e.

E. utilizing SpeI enzyme action to obtain linearisation pRS411 carrier, and cut glue recovery, step sees 2-b and 2-c.

F. the purified product that 3-d and 3-e two step obtains being carried out Gibson assembling, number of assembling steps sees document " EnzymaticassemblyofDNAmolec μ Lesuptoseveralhundredkilobases "^[12], assembly system required during assembling can be by buying the Gibson that NEB company providesMasterMix obtains.Taking 10 μ L and assemble product conversion DH5 α competent escherichia coli cell, finally obtaining growth has the flat board of monoclonal bacterium colony.

G. picking 6～8 monoclonal bacterium colony put into 3mL added ampicillin Ampicilin antibiotic (type of antibiotic is corresponding with the resistance of pRS411) LB fluid medium shake in tube, 37 DEG C of 200rpm incubated overnight.

H. being centrifuged 1min with 1.5mL centrifuge tube 12000rpm and collect thalline, extract plasmid, plasmid extraction step is with reference to the description of plasmid extraction kit.

I. the plasmid extracted previous step uses NheI and BsaI restriction enzyme to carry out enzyme action, and the step again carrying out electrophoresis, enzyme action and electrophoresis sees step 2-b and step 2-c respectively.Fig. 5 is pRS411_gRNA plasmid NheI and the BsaI digestion verification result figure containing different CRISPR sites.

The bacterium at j. correct to banding pattern plasmid place carries out protecting bacterium work.Take sterilized 1.5mL centrifuge tube, add 500 μ L and identify the bacterium solution of correct bacterial strain, the glycerol of 500 μ L50% ,-80 DEG C of Refrigerator stores after mixing, thus obtain the pRS411_gRNA plasmid (table 11, only selected part are shown) containing different CRISPR sites.

Table 11

GRNA expression plasmid title	Corresponding CRISER site title
		pRS411_gRNA18	YBR157C_18_226_-_AGG
pRS411_gRNA22	YBR157C_22_303_-_GGG
		pRS411_gRNA24	YBR157C_24_305_+_AGG
pRS411_gRNA25	YBR157C_25_314_+_TGG
		pRS411_gRNA_LEU15	LEU2_15_140_+_CGG
pRS411_gRNA_URA45	URA3_45_594_+_CGG

K. alternatively, it is also possible to need not build gRNA expression plasmid, the product comprising gRNA is directly used.The construction method of this product is as follows: using oligonucleotide chain SNR52p-F and gRNA-SUP4-R is primer, with the pRS411_gRNA plasmid containing different CRISPR sites of above-mentioned structure as template, carry out PCR (reaction system reference table 9/ table 10), the PCR primer comprising gRNA can be obtained.Hereafter the place of gRNA expression plasmid is used all to substitute by the PCR primer of gRNA.

4.CRISPR active testing

For confirming pRS413_ADH1_Cas9 and the pRS411_gRNA plasmid of above-mentioned structure, whether i.e. CRISPR system has genome editor activity in brewing yeast cell, saccharomyces cerevisiae endogenous ADE2 gene is selected to carry out CRISPR active testing as reporter gene, URA3 as Insert Fragment.

A. according to the CRISPR site sequence of anti-ADE2: ACTTGAAGATTCTTTAGTGT, it is designed for obtaining the primer of the assembling fragment of gRNA expression vector, and obtains the primer (table 12) of Insert Fragment URA3_ade2.

Table 12

B. obtaining the gRNA expression plasmid pRS411_gRNA-ade of target practice ADE2 gene, step sees 3-b to 3-j.

C. with pRS416 plasmid, (being provided (also can be by commercially available) by the JefBoeke of New York University, its sequence information can pass through the gb formatted file acquisition on NCBI about this plasmid.) it is template, URA3_ade2_40-F and URA3_ade2_40-R is primer, carries out PCR and obtains Insert Fragment URA3_ade2.Response procedures is 98 DEG C (1min), and 98 DEG C of (10s)-> 55 DEG C (30s)-> 72 DEG C (1min25s) are circulated 30 and taken turns, 72 DEG C (5min), 12 DEG C (maintenance).PCR system sees below (table 13).

Table 13

Component	Consumption
		PrimerSTAR exo+ polymerase	0.4μL
5X PS buffer	8μL 14 -->
		Template DNA (pRS416 plasmid)	5ng
Primer	4μL
		dNTP	3.2μL
ddH2O	Supply 40 μ L

D. the PCR primer that 4-c obtains being carried out PCR primer purification, step sees 2-e.

E. competent yeast cells preparation and conversion

E-1. taking out 12ml round bottom culture tube, add 4mLYPD fluid medium and 10 μ L bacterium solution, at 30 DEG C, 200rpm shakes to train and overnight carries out recovery cultivation.

E-2. adding 50mlYPD fluid medium, the bacterium solution of inoculation incubated overnight in conical flask, at 30 DEG C, 200rpm shakes and trains to OD value between 0.6-1.0.

E-3. 50mL bacterium solution being poured in 50mL centrifuge tube, 3000rpm is centrifuged 5min.Removing supernatant, unsettled addition 50mL aquesterilisa, reverse mixing, 3000rpm is centrifuged 5min.Removing supernatant, the lithium acetate solution of unsettled addition 20mL0.1mol/L, reverse mixing, 3000rpm is centrifuged 5min.Removing supernatant, add the lithium acetate solution of the 0.1mol/L of about 1ml, by thalline piping and druming mixing, so far, prepared by competent yeast cells.

E-4. taking in 4 1.5mL centrifuge tubes, labelling 1,2,3,4, adds fragment to be transformed in each pipe respectively.The Insert Fragment URA3_ade2 reclaimed in 1000ng step 4-d is added in No. 1 pipe, No. 2 pipes add the Insert Fragment each 500ng of URA3_ade2, pRS415 and pRS411 plasmid reclaimed in 1000ng step 4-d, No. 3 pipes add the Insert Fragment each 500ng of URA3_ade2, pRS415_ADH1_Cas9 and pRS411_gRNA-ade plasmid reclaimed in 1000ng step 4-d, No. 4 pipes add each 500ng of pRS415, pRS411, pRS416 plasmid.

E-5. each competent yeast cells adding 100 μ L in 1,2, No. 3 pipes, is then sequentially added into 25 μ LssDNA, the lithium acetate solution of 41 μ L1mol/L, 312 μ L50%PEG3350, by thalline piping and druming mixing or vibration mixing, it is placed in 30 DEG C of incubators and places 30min, add 50 μ LDMSO, somewhat after vibration mixing, centrifuge tube being placed on the metal bath of 42 DEG C placement 15min, takes out centrifuge tube, 3000rpm is centrifuged 2min, carefully suck supernatant, add the CaCl of 1mL5mM₂Solution piping and druming mixing, 3000rpm is centrifuged 1min, carefully removes supernatant, adds the CaCl of 100 μ L5mM₂Solution, by thalline piping and druming mixing.

E-6. on corresponding SC auxotroph flat board, go up the bead of sterilizing, drip the CaCl of 100 μ L5mM in flat board central authorities₂Solution, then at the CaCl of flat board₂Solution central authorities are separately added into 5 μ L and 10 μ L sample, with bead, liquid spreading is uniform, after drying slightly, flat board is placed into 30 DEG C of incubators and is inverted cultivation 2-3 days.

F. the clump count (the results are shown in Table 14) grown on statistics e-6 flat board and colony growth situation (result is shown in Fig. 6).

Table 14

From the CRISPR active testing result of table 14, the CRISPR-Cas9 system that the present invention builds has normal shear active in brewing yeast cell, effectively can edit host genome.

5.CRISPR system 1K-40 fragment replaces efficiency test

For determining that can CRISPR system improve the homologous recombination efficiency in yeast, selecting the YBR157C gene in wild type Saccharomyces cerevisiae BY4741 as target gene, URA3 carries out CRISPR fragment as Insert Fragment and replaces efficiency test.

A. design the CRISPR site (specific design method is shown in that part is designed in above-mentioned " CRISPR " site) of anti-YBR157C, obtain 4 preferred CRISPR sites (being shown in Table 3).

B. Oligo7 software design primer (table 15) is utilized, to obtain Insert Fragment 1K-40 (1K represents that this Insert Fragment size is about 1Kbp, and 40 represent a length of 40bp in homology region of this Insert Fragment and integration site) by PCR.

Table 15

C. obtaining the gRNA expression plasmid of target practice YBR157C gene, step sees 3-b to 3-j.

D. obtaining 1K-40 Insert Fragment by PCR, step sees 4-c, and wherein primer is changed to FT-URA3-40-F and FT-URA3-40-R.

E. the PCR primer that 5-d obtains being carried out PCR primer purification, step sees 2-e.

F. competent yeast cells preparation and conversion, step sees 4-e, wherein needs to prepare 7 1.5ml centrifuge tubes, adds and converts fragment.No. 1 pipe adds the 1K-40 fragment reclaimed in 1000ng step 5-e；No. 2 pipes add the 1K-40 fragment of 1000ng, each 500ng of pRS415 and pRS411 plasmid；No. 3 pipes add the 1K-40 fragment of 1000ng, each 500ng of pRS415_ADH1_Cas9 and pRS411_gRNA18 plasmid；No. 4 pipes add the 1K-40 fragment of 1000ng, each 500ng of pRS415_ADH1_Cas9 and pRS411_gRNA22 plasmid；No. 5 pipes add the 1K-40 fragment of 1000ng, each 500ng of pRS415_ADH1_Cas9 and pRS411_gRNA24 plasmid；No. 6 pipes add the 1K-40 fragment of 1000ng, each 500ng of pRS415_ADH1_Cas9 and pRS411_gRNA25 plasmid；No. 7 pipes add each 500ng of pRS415, pRS411, pRS416 plasmid.(above-mentioned pRS411_gRNA18/22/24/25 plasmid used is all replaced by comprising the PCR primer of corresponding guide RNA.)

G., statistic procedure 5-f converts the clump count (the results are shown in Table 16, Fig. 7) grown on flat board.

Table 16

Efficiency test result is replaced from the CRISPR system 1K-40 fragment of table 16, the CRISPR-Cas9 system that the present invention builds can host genome be sheared in brewing yeast cell effectively, making genomic DNA double-strand break, when strengthening homologous recombination, foreign DNA is integrated into the efficiency of genome by homologous recombination.

6.CRISPR system is used for synthetic yeast artificial chromosome DNA assembling test

1) for the test of reporter gene URA3

A. the saccharomyces cerevisiae BY4741_synchr07G getting out carry megachunk fragment G (has carried out the bacterial strain after megachunk fragment A-G replaces it, megachunk fragment H is obtained by the synthesis of gene chemical synthesis company after can be found in document [8] design, saccharomyces cerevisiae BY4741 is provided by New York University professor JefBoeke, also can be by commercially available, the replacement method of megachunk fragment G may refer to document^[8])。

B. (megachunk fragment H is about 45kb, is made up of 5 subfragrnents each other with about 1kb homology region, and megachunk fragment H and subfragrnent thereof can be found in document to take out 5 bacterial strains carrying megachunk fragment H subfragrnent^[8]Being obtained by the synthesis of gene chemical synthesis company after design, the bacterial strain deposited is provided by gene chemical synthesis company.5 subfragrnents are respectively designated as H1, H2, H3, H4, H5 fragment, and specifying information is shown in Table 17, and the intersegmental mutual relation of sheet is shown in Fig. 8), to shake bacterium, extract plasmid, step sees 2-g, 2-h.

Table 17

The title of megachunk fragment H subfragrnent	Enzyme	Purpose fragment length (bp)
			yeast_chr07_3_56.H1	SalI	8620
yeast_chr07_3_56.H2	BstEII	8437
			yeast_chr07_3_56.H3	BssHII	9751 17 -->
yeast_chr07_3_56.H4	Acc65I	9761
			yeast_chr07_3_56.H5	SalI	6238

C., 5 plasmids carrying out enzyme action (see table 17 and use the enzyme of correspondence) respectively, carries out glue recovery, step sees 2-b, 2-c.

D. competent yeast cells preparation and conversion, step sees 4-e.Wherein need to prepare 2 1.5ml centrifuge tubes, add and convert fragment.No. 1 pipe adds the megachunk fragment H subfragrnent that enzyme action reclaims；No. 2 pipes add the megachunk fragment H subfragrnent that enzyme action reclaims, pRS415_ADH1_Cas9 and pRS411_gRNA_LEU15 plasmid (PCR primer containing gRNA_LEU15 that can use correspondence replaces this plasmid) each 500ng.

E. taking out cultured flat board in upper step, by the bacterium photocopy on main flat board to the velvet of sterilizing, then transfer on the selection flat board of SD-Ura and SD-Leu culture medium by flannelette respectively by the bacterium colony of copy, 30 DEG C of incubators are inverted overnight incubation.

F. take out cultured selection flat board, mark that bacterium colony on SD-Ura flat board is full and that bacterium colony is flat on SD-Leu flat board bacterium, be designated as true positives bacterium colony, and carry out clump count and screening rate statistics (statistical result is shown in Table 18).

Table 18

Convert fragment (painting plate bulk)	Positive bacteria number/whole bacterium numbers	Screening rate
			H(10μL)	2/217	0.92%
cas9+gRNA_LEU15+H(20μL)	8/234	3.42%

From above CRISPR system for the test result of reporter gene URA3, host genome can be sheared in the yeast cells carrying semi-synthetic chromosome by CRISPR-Cas9 system that the present invention builds effectively, make genomic DNA double-strand break, significantly improve and carry out homologous recombination rate when DNA assembles by homologous recombination, meet the requirement increasing positive colony screening rate.

2) for the test of reporter gene LEU2

A. the saccharomyces cerevisiae BY4741_synchr07H getting out carry megachunk fragment H (has carried out the bacterial strain after megachunk fragment A-H replaces it, megachunk fragment I is obtained by the synthesis of gene chemical synthesis company after can be found in document [8] design, saccharomyces cerevisiae BY4741 is provided (also can be by commercially available) by New York University professor JefBoeke, and the replacement method of megachunk fragment H may refer to document [8]).

B. (megachunk fragment I is about 60kb, is made up of 6 subfragrnents each other with about 1kb homology region, and megachunk fragment I and subfragrnent thereof can be found in document to take out 6 bacterial strains carrying megachunk fragment I subfragrnent^[8]Being obtained by the synthesis of gene chemical synthesis company after design, the bacterial strain deposited is provided by gene chemical synthesis company.6 subfragrnents are respectively designated as I1, I2, I3, I4, I5, I6 fragment, and specifying information is shown in Table 19, and the intersegmental mutual relation of sheet is shown in Fig. 9), to shake bacterium, extract plasmid, step sees 2-g, 2-h.

Table 19

The title of megachunk fragment I subfragrnent	Enzyme	Purpose fragment length (bp)
			yeast_chr07_3_56.I1	MluI	8738
yeast_chr07_3_56.I2	PspOMI	8390
			yeast_chr07_3_56.I3	XbaI	9773
yeast_chr07_3_56.I4	PspOMI	9774 18 -->
			yeast_chr07_3_56.I5	SalI	9738
yeast_chr07_3_56.I6	MluI	11337

C., 6 plasmids carrying out enzyme action (see table 19 and use the enzyme of correspondence) respectively, carries out glue recovery, step sees 2-b, 2-c.

D. competent yeast cells preparation and conversion, step sees 4-e.Wherein need to prepare 2 1.5ml centrifuge tubes, add and convert fragment.No. 1 pipe adds the megachunk fragment I subfragrnent that enzyme action reclaims；No. 2 pipes add the megachunk fragment I subfragrnent that enzyme action reclaims, pRS415_ADH1_Cas9 and pRS411_gRNA_URA45 plasmid (PCR primer containing gRNA_URA45 that can use correspondence replaces this plasmid) each 500ng.

E. taking out and upper walk cultured flat board, by the bacterium photocopy on main flat board to the velvet of sterilizing, then transfer on the selection flat board of SD-Ura and SD-Leu culture medium by flannelette respectively by the bacterium colony of copy, 30 DEG C of incubators are inverted overnight incubation.

F. take out cultured selection flat board, mark that bacterium colony on SD-Leu flat board is full and that bacterium colony is flat on SD-Ura flat board bacterium, be designated as true positives bacterium colony, and carry out clump count and screening rate statistics (statistical result is shown in Table 20).

Table 20

Convert fragment (painting plate bulk)	Positive bacteria number/whole bacterium numbers	Screening rate
			I(10μL)	5/211	2.37%
cas9+gRNA_URA45+I(20μL)	6/104	5.77%

From the CRISPR system of table 20 for the test result of reporter gene URA3, host genome can be sheared in the yeast cells carrying semi-synthetic chromosome by CRISPR-Cas9 system that the present invention builds effectively, make genomic DNA double-strand break, significantly improve and carry out homologous recombination rate when DNA assembles by homologous recombination, meet the requirement increasing positive colony screening rate.

Embodiment 2

Use chromosome well known in the art or genome extractive technique, from the saccharomyces cerevisiae containing synthetic chromosome or synthetic gene group that embodiment 1 obtains, extract synthetic chromosome or synthetic gene group.

Above content is to combine specific embodiment further description made for the present invention, it is impossible to assert the present invention be embodied as be confined to these explanations.For general technical staff of the technical field of the invention, without departing from the inventive concept of the premise, it is also possible to make some simple deduction or replace.

List of references

1.Yang,X.W.,P.Model,andN.Heintz,HomologousrecombinationbasedmodificationinEscherichiacoliandgermlinetransmissionintransgenicmiceofabacterialartificialchromosome.NatBiotechnol,1997.15(9):p.859-65.

2.Li,T.,etal.,TALnucleases(TALNs):hybridproteinscomposedofTALeffectorsandFokIDNA-cleavagedomain.NucleicAcidsRes,2011.39(1):p.359-72.

3.Hsu,P.D.,etal.,DNAtargetingspecificityofRNA-guidedCas9nucleases.NatBiotechnol,2013.31(9):p.827-32.

4.Xie,S.,etal.,sgRNAcas9:asoftwarepackagefordesigningCRISPRsgRNAandevaluatingpotentialoff-targetcleavagesites.PLoSOne,2014.9(6):p.e100448.

5.Kasap,C.,O.Elemento,andT.M.Kapoor,DrugTargetSeqR:agenomics-andCRISPR-Cas9-basedmethodtoanalyzedrugtargets.NatChemBiol,2014.10(8):p.626-8.

6.Heigwer,F.,G.Kerr,andM.Boutros,E-CRISP:fastCRISPRtargetsiteidentification.NatMethods,2014.11(2):p.122-3.

7.Guell,M.,L.Yang,andG.M.Church,GenomeeditingassessmentusingCRISPRGenomeAnalyzer(CRISPR-GA).Bioinformatics,2014.

8.Annaluru,N.,etal.,Totalsynthesisofafunctionaldesignereukaryoticchromosome.Science,2014.344(6179):p.55-8.

9.Tennakoon,C.,R.W.Purbojati,andW.K.Sung,BatMis:afastalgorithmfork-mismatchmapping.Bioinformatics,2012.28(16):p.2122-8.

10.DiCarlo,J.E.,etal.,GenomeengineeringinSaccharomycescerevisiaeusingCRISPR-Cassystems.NucleicAcidsRes,2013.41(7):p.4336-43.

11.Storici,F.,etal.,Chromosomalsite-specificdouble-strandbreaksareefficientlytargetedforrepairbyoligonucleotidesinyeast.ProcNatlAcadSciUSA,2003.100(25):p.14994-9.

12.Gibson,D.G.,etal.,EnzymaticassemblyofDNAmoleculesuptoseveralhundredkilobases.NatMethods,2009.6(5):p.343-5.

13.Kabadi,A.M.,etal.,MultiplexCRISPR/Cas9-basedgenomeengineeringfromasinglelentiviralvector.NucleicAcidsRes,2014.

Claims (12)

1. the CRISPR-Cas9 system assembled for DNA, it is characterised in that include following ingredient:

For expressing the plasmid of Cas9 gene；With

First guide RNA and/or for expressing the plasmid of described first guide RNA, wherein said first guide RNA has CRISPR site, and this CRISPR site combines the first reporter gene entrained by semi-synthetic chromosome for assembling according to base pair complementarity principle.

The CRISPR-Cas9 system assembled for DNA the most according to claim 1, it is characterised in that also include following ingredient:

Host cell, described host cell carries described semi-synthetic chromosome, and described semi-synthetic chromosome comprises synthesis chromosome sequence and wild chromosome sequence and described first reporter gene therebetween；

Fragment to be assembled, there is one section of sequence homology of one section of sequence and close described first reporter gene of described synthesis chromosome sequence one end of described fragment to be assembled, and the inner side of the other end has the second reporter gene and outside to have one section of sequence and described wild chromosome sequence homology.

The CRISPR-Cas9 system assembled for DNA the most according to claim 2, it is characterised in that also include following ingredient:

Second guide RNA and/or for expressing the plasmid of described second guide RNA, wherein said second guide RNA has CRISPR site, and this CRISPR site combines described second reporter gene according to base pair complementarity principle.

4. according to the CRISPR-Cas9 system assembled for DNA described in Claims 2 or 3, it is characterized in that, described first reporter gene and the second reporter gene are the reporter gene in yeast, it is preferably two kinds in LEU2, URA3, HIS3, TRP1, MET17 and LYS2, more preferably LEU2 and URA3；

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene LEU2 is:

GAAAGGTGAGAGGCCGGAAC (SEQIDNO:1)；

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene URA3 is:

GTGGGCCCAGGTATTGTTAG (SEQIDNO:2).

5. according to the CRISPR-Cas9 system assembled for DNA described in Claims 2 or 3, it is characterized in that, described fragment to be assembled is the genomic fragment of synthesis, and described CRISPR site has the highest reliability mark in all potential site of the reporter gene of its correspondence.

The CRISPR-Cas9 system assembled for DNA the most according to claim 5, it is characterised in that described reliability mark is calculated by equation below (1):

$S_{guide}=\frac{100}{100+{\mathrm{\Σ}}_{i=1}^{n_{off}}{S}_{hit}\left(i\right)}---\left(1\right);$

Wherein, i represents each site of missing the target on described genome, S_hitRepresent the probability mark that misses the target in each site of missing the target, n_offRepresent the site sum that misses the target, S_guideRepresent the reliability mark in each CRISPR site；

The probability mark S that misses the target in described each site of missing the target_hitIt is calculated by equation below (2):

$S_{hit}=\underset{e\∈M}{\Π}(1-W\[e\])\×\frac{1}{(\frac{(19-\stackrel{\‾}{d})}{19}\×4+1)}\×\frac{1}{n_{mm}^2}---\left(2\right);$

Wherein, e represents the actual mismatch site in described CRISPR site and corresponding site of missing the target, and M refers to the set of theoretical mismatch site, and W [e] represents the different mismatch site contribution margin to missing the target, and d represents mismatch site average distance between any two, n_mmRepresent the sum of mismatch site；Wherein, W [e], according to mismatch site order, meets as follows: $\begin{array}{c}W\[e\]=\[0,0,0.014,0,0,0.395,0.317,0,0.389,0.079,0.445,\\ 0.508,0.613,0.851,0.732,0.828,0.615,0.804,0.685,0.583\]\end{array}.$

7. a DNA assemble method, it is characterised in that described method includes:

To be used for expressing the plasmid of Cas9 gene, plasmid and fragment to be assembled for expressing the first guide RNA proceed in host cell, described host cell carries semi-synthetic chromosome, described semi-synthetic chromosome comprises synthesis chromosome sequence and wild chromosome sequence and the first reporter gene therebetween, described first guide RNA has CRISPR site, this CRISPR site combines described first reporter gene according to base pair complementarity principle, there is one section of sequence homology of one section of sequence and close described first reporter gene of described synthesis chromosome sequence one end of described fragment to be assembled, the inner side of the other end of described fragment to be assembled has the second reporter gene and outside to have one section of sequence and described wild chromosome sequence homology；

Described Cas9 gene and described first guide rna expression, produce Cas9 nuclease and described first guide RNA, so that described first guide RNA is attached on described first reporter gene, and mediate described Cas9 nuclease make described semi-synthetic chromosome produce double bond fracture, the semi-synthetic chromosome making fracture is more likely to and described fragment homologous recombination to be assembled, thus described fragment to be assembled is assembled on described semi-synthetic chromosome.

8. a DNA assemble method, it is characterised in that described method includes:

To be used for expressing the plasmid of Cas9 gene, the product and the fragment to be assembled that comprise the first guide RNA proceed in host cell, described host cell carries semi-synthetic chromosome, described semi-synthetic chromosome comprises synthesis chromosome sequence and wild chromosome sequence and the first reporter gene therebetween, described first guide RNA has CRISPR site, this CRISPR site combines described first reporter gene according to base pair complementarity principle, there is one section of sequence homology of one section of sequence and close described first reporter gene of described synthesis chromosome sequence one end of described fragment to be assembled, the inner side of the other end of described fragment to be assembled has the second reporter gene and outside to have one section of sequence and described wild chromosome sequence homology；

Described Cas9 gene expression, produce Cas9 nuclease, so that described first guide RNA is attached on described first reporter gene, and mediate described Cas9 nuclease make described semi-synthetic chromosome produce double bond fracture, the semi-synthetic chromosome making fracture is more likely to and described fragment homologous recombination to be assembled, thus described fragment to be assembled is assembled on described semi-synthetic chromosome；

Preferably, the product comprising the first guide RNA described in is produced by PCR method.

9. according to the DNA assemble method described in claim 7 or 8, it is characterized in that, described first reporter gene and the second reporter gene are two kinds in the reporter gene in yeast, preferably LEU2, URA3, HIS3, TRP1, MET17 and LYS2, more preferably LEU2 and URA3；

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene LEU2 is:

GAAAGGTGAGAGGCCGGAAC (SEQIDNO:1)；

Preferably, the CRISPR site sequence in conjunction with the guide RNA of reporter gene URA3 is:

GTGGGCCCAGGTATTGTTA (SEQIDNO:2).

10. according to the DNA assemble method described in claim 7 or 8, it is characterised in that described CRISPR site has the highest reliability mark in all potential site of the reporter gene of its correspondence；

Preferably, described reliability mark is calculated by equation below (1):

$S_{guide}=\frac{100}{100+{\mathrm{\Σ}}_{i=1}^{n_{off}}{S}_{hit}\left(i\right)}---\left(1\right);$

Wherein, i represents each site of missing the target on described genome, S_hitRepresent the probability mark that misses the target in each site of missing the target, n_offRepresent the site sum that misses the target, S_guideRepresent the reliability mark in each CRISPR site；

The probability mark S that misses the target in described each site of missing the target_hitIt is calculated by equation below (2):

$S_{hit}=\underset{e\∈M}{\Π}(1-W\[e\])\×\frac{1}{(\frac{(19-\stackrel{\‾}{d})}{19}\×4+1)}\×\frac{1}{n_{mm}^2}---\left(2\right);$

Wherein, e represents the actual mismatch site in described CRISPR site and corresponding site of missing the target, and M refers to the set of theoretical mismatch site, and W [e] represents the different mismatch site contribution margin to missing the target, and d represents mismatch site average distance between any two, n_mmRepresent the sum of mismatch site；Wherein, W [e], according to mismatch site order, meets as follows: $\begin{array}{c}W\[e\]=\[0,0,0.014,0,0,0.395,0.317,0,0.389,0.079,0.445,\\ 0.508,0.613,0.851,0.732,0.828,0.615,0.804,0.685,0.583\]\end{array}.$

11. 1 kinds by the built-up synthetic chromosome of DNA assemble method described in any one of claim 7-10 or synthetic gene group.

12. 1 kinds of synthetic microorganisms, it is characterised in that the chromosome of described synthetic microorganism or genome are built-up by the DNA assemble method described in any one of claim 7-10；

Preferably, described microorganism is eukaryotic microorganisms, more preferably yeast.