CN105624192B

CN105624192B - Preparation of breast cancer cell strain capable of stably secreting near-infrared fluorescence labeled exosomes

Info

Publication number: CN105624192B
Application number: CN201610055822.9A
Authority: CN
Inventors: 张宗德; 张春; 蓝文俊; 刘晓玫; 潘丽萍
Original assignee: Suzhou Institute of Biomedical Engineering and Technology of CAS; Beijing Tuberculosis and Thoracic Tumor Research Institute
Current assignee: Suzhou Institute of Biomedical Engineering and Technology of CAS; Beijing Tuberculosis and Thoracic Tumor Research Institute
Priority date: 2016-01-27
Filing date: 2016-01-27
Publication date: 2020-05-08
Anticipated expiration: 2036-01-27
Also published as: CN105624192A

Abstract

The invention discloses a preparation method of a breast cancer cell strain capable of stably secreting a near-infrared fluorescence labeled exosome, which comprises the steps of constructing a plasmid vector for fusion expression of near-infrared fluorescence iRFP682 protein and CD63 protein, co-infecting human breast cancer MDA-MB-231 cells with recombinant adeno-associated virus (rAAV) and auxiliary virus packaged by the plasmid according to a certain proportion, screening to obtain human breast cancer MDA-MB-231 cells capable of stably expressing the near-infrared fluorescence protein iRFP682 labeled exosome, and separating and purifying the near-infrared fluorescence protein iRFP682 labeled exosome by adopting a fractional centrifugation method for identification. The invention finally obtains a novel biomarker for in-vitro research of a breast cancer tumor microenvironment in vivo, provides a powerful tool for further researching an intercellular substance transfer mechanism, and simultaneously provides new support and opportunity for a cancer diagnosis and treatment scheme.

Description

Preparation of breast cancer cell strain capable of stably secreting near-infrared fluorescence labeled exosomes

Technical Field

The present invention relates to the field of biomarkers. More specifically, the invention relates to preparation of a breast cancer cell strain capable of stably secreting near-infrared fluorescence labeled exosomes.

Background

In 1986, scholars found a vesicle with a membrane structure in the supernatant of sheep red blood cells cultured in vitro, which is called exosome. By 1996, researchers discovered that some vesicle surfaces with membrane structures in EB virus-transformed human B cells expressed MHC class II molecules, activated T cells, and were similar to the formation and discharge pathways of exosomes in erythrocytes (see Van Niel G, Porto-Carreiro I, Simoes S, Raposo G. exosomes: a common pathway for activated function. J biochem2006,140: 13-21), after which extensive research on exosomes began. Exosomes are membrane vesicles of 30-120 nm diameter derived from late endosomes (also called multivesicular bodies) secreted by living cells (see Stoorvogel W, Kleijmeer MJ, Geuze HJ, Raposo g. theogenesis and functions of exosomes. traffic2002, 3: 321-330). The current research directions are mainly stem cells, immunity, microRNA and targeted drug delivery. The nobel prize in 2013 awarded three scientists who contributed remarkably to the cell vesicle, and promoted the research of exosomes to reach a brand new height.

Various Cell, tissue, organ and system coordinate with each other and maintain normal operation of our complex organism (see J.Skog, T.W ü rdinger, S.van Rijn, D.H.Meijer, L.Gainche, M.Sena-experiments, W.T.Curry Jr., B.S.Carter, A.M.Krichevsky, X.O.Breeakefield, Globlastomasum trafiltration RNA and proteins) and transfer of information between cells, which is closely related to transfer of information between cells, mainly related to certain chemical substances produced and released by cells, such as mRNA molecules produced and released in vitro, as a result of the development of Cancer cells, such as tumor protein release, protein release, protein.

Near-Infrared Fluorescent Proteins (iRFP) are a class of Fluorescent Proteins homologous to green Fluorescent Proteins and have the luminescent advantages of green Fluorescent Proteins (see Mikhail Baloban, DariaM. Shcherbakova, Vladislav V. Verkhusha, Two-Color Imaging using spectral variants of iRFP670 and iRFP682Near-Infrared Fluorescent Proteins, Biophysic journal,2015,108: 624-. However, compared with GFP, it has longer excitation light and emission light wavelength, is located In a Near Infrared light region (650-900 nm), has lower light absorption and light scattering In animal tissues, has higher penetrability, is more suitable for deep Imaging of animal living tissues, and is a more ideal fluorescent marker molecule for living Imaging (see Grigory S.Filonov, Vladislav V.Verkhusha, A New-induced BiFC Reporter for In Vivo Imaging of Protein-Protein Interactions organic Research Chemistry & Biology,2013,20: 1078-. The excitation light and emission light wavelengths of the near-infrared fluorescent protein iRFP682 are 663nm and 682nm respectively, the fluorescent protein is a monomer fluorescent protein molecule, the luminous property of the fluorescent protein is stable, and the longer spectral characteristic enables the fluorescent protein to have more potential in the application of living animal tissue imaging.

Therefore, if the unique function of the exosome and the superiority of the near-infrared fluorescent protein in-vivo and in-vitro tracing can be combined, a powerful tool can be provided for further researching the substance transfer mechanism between cells.

Disclosure of Invention

An object of the present invention is to solve at least the above problems and/or disadvantages and to provide at least the advantages described hereinafter.

The invention also aims to provide a preparation method of the breast cancer cell strain for stably secreting the near infrared fluorescence labeled exosomes, which integrates genes for encoding near infrared fluorescence protein iRFP682 and exosome CD63 protein fusion expression into a breast cancer cell genome, so that the breast cancer cell strain for stably secreting the near infrared fluorescence labeled exosomes can be obtained, and finally a novel biomarker for in-vitro research of a breast cancer tumor microenvironment in vivo is obtained, thereby providing a powerful tool for further researching an intercellular substance transfer mechanism and simultaneously providing a new support and opportunity for a cancer diagnosis and treatment scheme.

To achieve these objects and other advantages in accordance with the present invention, there is provided a method for preparing a breast cancer cell line stably secreting a near infrared fluorescence-labeled exosome, comprising the steps of:

1) acquisition of the gene encoding the exosome marker protein CD 63:

extracting total RNA from human breast cancer MDA-MB-231 cells, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification by using primers with XbaI and ClaI enzyme cutting sites and a Linker sequence to obtain a target gene fragment CD 63-Linker;

2) construction of recombinant plasmid vector:

the CD63-Linker and the plasmid skeleton pAAV-iRFP682 obtained in the step 1) are acted by T4DNA ligase to obtain a recombinant plasmid vector pAAV-CD63-Linker-iRFP 682;

3) preparation of recombinant adeno-associated virus:

in vitro co-transfecting AAV-293 cells by using the recombinant plasmid vector pAAV-CD63-Linker-iRFP682 and helper plasmids, and packaging the recombinant adeno-associated virus rAAV-CD63-Linker-iRFP 682;

4) preparing a breast cancer cell strain capable of stably secreting near-infrared fluorescent protein labeled exosomes:

co-infecting human breast cancer MDA-MB-231 cells by using the recombinant adeno-associated virus rAAV-CD63-Linker-iRFP682 and the auxiliary adeno-associated virus, and obtaining a human breast cancer MDA-MB-231 cell strain which stably secretes a near-infrared fluorescent protein labeled exosome through fluorescence screening;

5) exosome extraction and identification of near-infrared fluorescence labeled human breast cancer MDA-MB-231 cells

Extracting and identifying the iRFP 682-labeled exosome from the successfully labeled MDA-MB-231 cell culture supernatant in the step 4) by adopting a fractional centrifugation method.

Preferably, the step-by-step centrifugation method in the step 5) comprises the following steps:

firstly, centrifuging the cell culture supernatant for 15min at 2000g, 15min at 5000g and 30min at 12000g in sequence at 4 ℃ to remove cell debris to obtain a first supernatant;

secondly, filtering the first supernatant by using a membrane with the aperture not more than 0.2 mu m, and centrifuging for 120min at 4 ℃ and 12000g to obtain crude exosome precipitate;

and finally, resuspending the crude exosome precipitate by using a PBS solution, uniformly mixing, centrifuging for 90min at 4 ℃ and 12000g to obtain a purified exosome, and resuspending the purified exosome by using the PBS solution and then storing at-80 ℃ for later use.

In the purification process of the exosome, the exosome is a 30-100 nm cup-shaped membrane structure vesicle and is easily influenced by external pressure and temperature, so that the temperature is required to be controlled to be about 4 ℃ in the extraction process or the unfreezing use process. Thawing needs to be done on ice. In addition, in order to avoid the interference of protease to exosome, a protease inhibitor is added before freezing storage, and the mixture can be stored for 3 weeks at 4 ℃ and for 2-3 years at-80 ℃.

Preferably, the method for identifying the iRFP 682-labeled exosomes in the step 5) comprises the following steps: and identifying the membrane surface protein of the exosome by using western blot, observing the structure of the exosome structure by using a transmission electron microscope, and observing the fluorescent marker of the exosome by using an SIM (subscriber identity module) structured light illumination super-resolution fluorescence microscope.

Preferably, wherein the Linker sequence is: ggtggaggcggttcaggcggaggtggctctggcggtggcggatcg, the near infrared fluorescent protein iRFP682 and the exosome surface marker CD63 can be stably fused and expressed, and the respective biological activities of the near infrared fluorescent protein iRFP682 and the exosome surface marker CD63 can not be influenced.

Preferably, the helper plasmid in step 3) is a pDG plasmid, wherein the recombinant plasmid vector pAAV-CD63-Linker-iRFP682 can provide ITR sequences necessary for AAV-293 virus, and the helper plasmid pDG can provide Rep and Cap genes necessary for AAV-293 recombinant replication, virus coat packaging and the like, so as to package and carry recombinant adeno-associated virus rAAV-CD63-Linker-iRFP 682.

Preferably, wherein the helper adeno-associated virus is rAAVSVAV2, to improve the integration efficiency of the foreign gene.

Preferably, the molar ratio of the CD63-Linker and the plasmid skeleton pAAV-iRFP682 in the step 2) is 2-5, so as to facilitate the formation of the recombinant plasmid vector.

Preferably, the ratio of the number of the recombinant adeno-associated virus in the step 4) to the number of the human breast cancer MDA-MB-231 cells is 3000-6000, so as to ensure the infection efficiency.

The invention at least comprises the following beneficial effects:

the gene engineering breast cancer cell strain prepared by the invention can stably secrete the exosome marked by the near-infrared fluorescent protein iRFP682, effectively purify the near-infrared marked exosome by a step-by-step centrifugation method, can be used as a novel biomarker for in-vivo and in-vitro research of a breast cancer microenvironment in vivo and in vitro by utilizing the unique function of the exosome and the superiority of the near-infrared fluorescent protein in-vivo and in-vitro tracing, provides a powerful tool for further researching an intercellular substance transfer mechanism, and has important application value in diagnosis and treatment schemes of cancer.

Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.

Drawings

FIG. 1 is a SIM structured light illumination super-resolution fluorescence microscopic imaging of a breast cancer cell strain stably secreting near-infrared fluorescence labeled exosomes prepared by the invention;

FIG. 2 is a Western blot detection map of the exosome membrane surface marker protein purified according to the present invention;

FIG. 3 is a TEM high resolution transmission electron micrograph of the purified exosomes of the present invention;

FIG. 4 is a SIM structured light illuminated super-resolution fluorescence microscopy imaging of purified exosomes of the present invention;

FIG. 5 illustrates the stepwise centrifugation extraction process for labeling successful MDA-MB-231 cell exosomes.

Detailed Description

The present invention is further described in detail below with reference to the attached drawings so that those skilled in the art can implement the invention by referring to the description text.

It will be understood that terms such as "having," "including," and "comprising," as used herein, do not preclude the presence or addition of one or more other elements or groups thereof.

In one implementation form of the present invention, a method for preparing a breast cancer cell line that stably secretes a near-infrared fluorescence-labeled exosome is provided, which includes the following steps:

1) acquisition of exosome marker protein CD63 gene

MDA-MB-231 cells were cultured in L-15 medium containing 10% fetal bovine serum and maintained in a saturated humidity incubator at 37 ℃ and 5% CO 2. When the cell density reaches more than 80% (not more than 1X 10)⁷) Washing with PBS twice, digesting with Trypsin digestive juice (0.25% Trypsin, 0.02% EDTA) for 2-3 min, centrifuging at 900r/min for 5min, collecting cell precipitate, extracting total RNA according to a guanidine isothiocyanate/phenol method (TRIZOL) method, and performing reverse transcription, wherein the reaction system comprises the following steps: 10 XTT Mix 2. mu.l, 1 XPuper pure dNTPs (2.5mM each) 2. mu.l, Oligo- (dT) 152. mu.l, Quant ReverseTranscriptase 1. mu.l, template RNA 1. mu.l, RNase-Free water to 20. mu.l. Amplification conditions: 37 ℃ for 60 min. Recovering cDNA with glue, amplifying a CD63 gene containing a restriction enzyme XbaI ClaI site and a linker sequence by using gene upstream and downstream primers by using the cDNA as a template, recovering a product from the glue, connecting the product with a pMD-18T vector at 16 ℃ overnight, converting TG1 competent bacteria, selecting positive monoclonal bacteria in an LB culture medium containing aminobenzyl, culturing for 16h on a constant temperature shaking table (200r/min) at 37 ℃, extracting plasmids, carrying out enzyme digestion identification by XbaI and ClaI, and then delivering the plasmid to Shanghai biological engineering technology Limited company for sequencing comparison.

2) Construction and identification of recombinant fusion expression plasmid vector

The pAAV-CD63-Linker-iRFP682 recombinant plasmid was constructed according to a standard molecular cloning method. Taking a correctly identified pMD-18T-CD63 plasmid, carrying out double enzyme digestion by Cla I and XbaI, and recovering a 776bp fragment from gel; activating and amplifying pAAV-iRFP682 plasmid, transforming escherichia coli SURE2 competence, coating an ampicillin resistant plate, picking positive monoclonal bacteria in ampicillin resistant LB culture solution, culturing for 16 hours at 37 ℃ by a constant temperature shaking table at 200r/min, and extracting the plasmid for later use. The correct pAAV-iRFP682 plasmid skeleton is identified and subjected to ClaI and XbaI double enzyme digestion, and a 5559bp fragment is recovered from the gel; plasmid frameworks pAAV-iRFP682(5559bp) and CD63-Linker (776bp) target gene fragments (the molar ratio is 1:3) are subjected to ligation reaction at 16 ℃ for 4h under the action of T4DNA ligase, the fragments are transformed into competent Sure-2, positive clones are picked for amplification, plasmids are extracted and purified to obtain recombinant plasmids, and electrophoresis and sequencing identification are carried out after enzyme digestion to obtain pAAV-CD63-Linker-iRFP682 recombinant plasmids.

3) Preparation of recombinant adeno-associated virus

AAV-293 cells are inoculated in DMEM medium containing 10% FBS for adherent culture, the cells are placed in an incubator with 37 ℃ and 5% CO2, the cell density reaches 80% within 48 hours, PBS is used for washing the cell surface twice, Trypsin digestion solution (0.25% Trypsin and 0.02% EDTA) is used for digesting 3min, 900rpm is used for centrifugation for 5min, a proper amount of culture medium is added for resuspension, the cells are continuously cultured according to the proportion of 1:3, cells in the logarithmic growth phase are taken for digestion and passage to 15cm culture dishes, the cell density reaches more than 70% after 24h culture, pAAV-CD 63-Lin-iRFP 682 recombinant plasmids and pDG plasmids are CO-transfected with transfection reagents, rAAV-CD63-Linker-iRFP682, viruses are purified and concentrated by adopting a chloroform precipitation method, the viruses are purified and concentrated, the titer of the rAAV-CD63-Linker iRFP recombinant viruses is 8 Xg 1010vg/mL, the Sybranchen (polyclonal PCR) reaction system, the rAAV-CD63-Linker iRFP 682-682 virus titer is measured by fluorescent quantitative PCR (10 ℃ C., 10L, 5L, 10 ℃ C., 10L, 30L, 10 ℃ C., 10-300L, 10, 3L, 10, 3L 4935L 3, 10L 3M 3.

4) rAAV virus infected human breast cancer MDA-MB-231 cell and fluorescence screening

MDA-MB-231 cells are cultured in L-15 culture medium containing 10% fetal calf serum in an adherent way and are placed at 37 ℃ without CO₂When the cell density reached more than 80%, digestion passage was carried out, and 10 cells per well were counted⁵The individual cells were seeded in 24-well plates and cultured at 37 ℃ for 24h to complete adherence. Under the auxiliary action of helper adeno-associated virus rAAVSVAV2, the recombinant adeno-associated virus is infected in the ratio of 5000 copies/cell numberThe above attached MDA-MB-231 cells were examined for expression of fluorescent protein on an inverted fluorescence microscope. The single cells were cloned into a 96-well plate, and MDA-MB-231 cell lines stably expressing iRFP682 were selected. Referring to FIG. 1, the successfully labeled MDA-MB-231 cell membrane fluoresces in the near infrared, and the exosomes fluoresce in the near infrared where they are produced or dense.

5) Extraction of successfully labeled MDA-MB-231 cell exosomes

Referring to fig. 5, exosomes were extracted using a stepwise centrifugation method. The exosome step-by-step centrifugal extraction method comprises the following steps: firstly, centrifuging the cell culture supernatant for 15min at 2000g, 15min at 5000g and 30min at 12000g in sequence at 4 ℃ to remove cell debris to obtain a first supernatant;

secondly, filtering the first supernatant by using a membrane with the pore diameter not more than 0.2 mu m, and centrifuging for 120min at 4 ℃ and 12000g to obtain an exosome crude precipitate;

and finally, resuspending the crude exosome precipitate by using a 1 XPBS solution, uniformly mixing, centrifuging for 90min at 4 ℃ and 12000g to obtain a purified exosome, and resuspending the purified exosome by using the 1 XPBS solution and storing at-80 ℃ for later use.

6) Identification of successfully labeled MDA-MB-231 cell exosomes

Referring to fig. 2, 10 μ g and 5 μ g of the secretion body purified in step 5) are respectively taken, a rabbit anti-human CD63 monoclonal antibody is used for detecting the surface marker protein of the purified secretion body membrane in a Western blot test, and the successfully labeled MDA-MB-231 cell lysate is used as a positive control to detect a specific CD63 protein band, wherein (a), (b) and (c) in the figure are respectively corresponding bands of the positive control, 10 μ g of the purified secretion body and 5 μ g of the purified secretion body.

Referring to fig. 3, the purified exosomes were observed by TEM high-resolution transmission electron microscopy to find circular vesicles of 30-150nm size, evenly distributed on the copper mesh.

Referring to fig. 4, the purified exosome is observed by a SIM structured light illumination super-resolution fluorescence microscope to find that the purified exosome emits a strong near-infrared fluorescence signal.

As described above, the genetically engineered breast cancer cell strain prepared by the invention can stably secrete the exosome marked by the near-infrared fluorescent protein iRFP682, and then the extracted near-exosome is identified by utilizing a western blot, a TEM high-resolution transmission electron microscope and an SIM structured light illumination super-resolution fluorescence microscope, so that the method of fractional centrifugation can effectively separate and purify the near-infrared marked exosome, and the novel biomarker for in-vivo and in-vitro research of a breast cancer tumor microenvironment can be used as a novel biomarker by utilizing the unique function of the exosome and the superiority of the near-infrared fluorescent protein in-vivo and in-vitro tracing, thereby providing a powerful tool for further researching an intercellular substance transfer mechanism, and having important application value in a diagnosis and treatment scheme of cancer.

The number of apparatuses and the scale of the process described herein are intended to simplify the description of the present invention. The application, modification and variation of the preparation of the breast cancer cell line capable of stably secreting the near infrared fluorescence labeled exosome of the present invention will be apparent to those skilled in the art.

While embodiments of the invention have been disclosed above, it is not intended to be limited to the uses set forth in the specification and examples. It can be applied to all kinds of fields suitable for the present invention. Additional modifications will readily occur to those skilled in the art. It is therefore intended that the invention not be limited to the exact details and illustrations described and illustrated herein, but fall within the scope of the appended claims and equivalents thereof.

Claims

1. A preparation method of a breast cancer cell strain capable of stably secreting near-infrared fluorescence labeled exosomes is characterized by comprising the following steps:

1) acquisition of the gene encoding the exosome marker protein CD 63:

extracting total RNA from human breast cancer MDA-MB-231 cells, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification by using primers with XbaI and ClaI enzyme cutting sites and a Linker sequence to obtain a target gene fragment CD 63-Linker; the Linker sequence is as follows: ggtggaggcggttcaggcggaggtggctctggcggtggcggatcg, respectively;

2) construction of recombinant plasmid vector:

wherein the molar ratio of the CD63-Linker to the plasmid skeleton pAAV-iRFP682 is 2-5;

3) preparation of recombinant adeno-associated virus:

the helper plasmid is a pDG plasmid;

wherein the helper adeno-associated virus is rAAVSVAV 2; the ratio of the number of the cells of the recombinant adeno-associated virus to the number of the cells of the human breast cancer MDA-MB-231 is 3000-6000;

5) extracting and identifying exosomes of near-infrared fluorescence labeled human breast cancer MDA-MB-231 cells:

extracting an iRFP 682-labeled exosome from the MDA-MB-231 cell culture supernatant successfully labeled in the step 4) by adopting a fractional centrifugation method and identifying the exosome;

the step-by-step centrifugation method in the step 5) comprises the following steps:

then filtering the first supernatant by using a membrane with the pore diameter not more than 0.2 mu m, and centrifuging for 120min at 4 ℃ under the condition of 12000g to obtain crude exosome precipitate;

finally, resuspending the exosome coarse precipitate by using a PBS solution, uniformly mixing, centrifuging for 90min at 4 ℃ under 12000g to obtain a purified exosome, and resuspending the purified exosome by using the PBS solution and then storing at-80 ℃ for later use;

the method for identifying the iRFP 682-labeled exosomes in the step 5) comprises the following steps: and (3) identifying the membrane surface protein of the exosome by using western blot, observing the structure of the exosome by using a transmission electron microscope, and observing the fluorescent marker of the exosome by using an SIM (subscriber identity module) structured light illumination super-resolution fluorescence microscope.