CN105506066A - Cell identification method for new generation of noninvasive prenatal diagnosis field - Google Patents

Abstract

The invention provides a cell identification method for the new generation of noninvasive prenatal diagnosis field. The method comprises the following steps: (1) extracting samples of a pregnant woman and spouse thereof and extracting DNA, and conducting STR genotyping on the DNA; (2) performing density gradient centrifugation on the blood sample of the pregnant woman so as to obtain a cell suspension or filtering a cervical secretion sample by virtue of a cell sieve so as to obtain the cell suspension; (3) sorting target cells and conducting whole gene amplification, performing high-throughput sequencing and conducting STR genotyping; and (4) in accordance with an STR genotyping result, judging whether fetus cells are successfully isolated from a mother body or not.

Description

A kind of for the cellular identification method of a new generation without wound antenatal diagnosis field

Technical field

The present invention relates to antenatal diagnosis field.More specifically, the present invention relates to the qualification of fetal cell.

Background technology

Methods for prenatal diagnosis used at present according to the difference of method of drawing material be mainly divided into have wound antenatal diagnosis and without wound antenatal diagnosis.Wound antenatal diagnosis is had mainly to comprise fine hair puncture and amniocentesis, these class methods can obtain complete Fetal genome, obtain diagnostic result accurately, become the gold standard of antenatal diagnosis, but because sampling process has wound, bring potential harm can to pregnant woman and fetus.Non-invasive diagnosis method mainly contains ultrasound investigation, maternal peripheral serum mark mensuration and fetal cell detection etc.Wherein ultrasound investigation is because of the restriction of its resolving power and accuracy, is more combine use with other detection methods, mainly as a kind of preliminary screening method.Until 1997, Lu Yuming etc. find the DNA [1] that there is fetus dissociative in pregnant woman blood plasma, subsequently, utilize dissociative DNA in maternal blood and detect the research more and more [2,3,4,5] of fetal chromosomal numerical abnormality in conjunction with high throughput sequencing technologies.The method has the feature of high sensitivity and high specific, and to fetus without any wound.Therefore, based on maternal peripheral blood dissociative DNA without wound antenatal diagnosis technology gradually by hospital and pregnant woman accept [6].

But utilize fetus dissociative DNA also to have the defect of himself, due to the dissociative DNA except fetal origin in maternal blood, there is a large amount of source of parents DNA background in addition, and DNA exists with the form of small pieces, be unfavorable for the detection such as monogenic disease of other genetic mutations.Just because of this, scientists is finding a kind of non-invasive methods to obtain complete Fetal genome.Research shows in maternal blood, and all contain fetal cell [7,8,9,10,11] in pregnant woman's cervical secretions, fetal cell, completely from fetus, comprises complete Fetal genome, covers all genetic information of fetus.Therefore, utilize the fetal cell existed in parent to carry out antenatal diagnosis to extend being and supplementing based on one of fetus dissociative DNA antenatal diagnosis at present.But because fetal cells in maternal peripheral blood is extremely rare, in every milliliter of whole blood, fetal nucleated red blood only has an appointment 1-2, greatly about 10 ⁵-10 ⁷a fetal cell [7,8] is only had in individual mother cell; In cervical secretions, fetal cell is more, containing a fetal cell [10,11] in about 2000 mother cells; Obtain complete Fetal genome and will isolate target fetal cell in the cell of mother's BACKGROUND Many.

Have at present and much report about the technological method of isolation of fetal cells from parent, relatively more conventional mainly contains density gradient centrifugation [12, 13, 14, 15], low cytometric analysis and Fluorescence-activated cell sorting (fluorescence-activatedcellsorting, FACS) [16, 17, 18, 19, 20], Magnetic activated cell sorting method (magnetically-activatedcellsorting, MACS) [21, 22, 23, 24, 25, 26, 27], micrurgy partition method [28, 29], based on the separation method [30 of microflow control technique, 31].There are relative merits in these methods, usually can combine use all separately.Be separated to fetal cell by these technique means, after carrying out whole genome amplification, obtain enough DNA for order-checking, the various heritable variations of fetus can be detected, comprise numerical abnormalities of chromosomes, point mutation etc.This combine with technique has the accuracy of wound antenatal diagnosis, and---fetal cell is completely from fetus and non-invasive without wound antenatal diagnosis---only needs maternal blood, can be described as a new generation without wound antenatal diagnosis technology.

A new generation is without in wound antenatal diagnosis, the most important thing is to use various technological method isolation of fetal cells, and existing all separation methods all need to carry out discernable cell by antigen antibody reaction, by the limitation of antigen-specific, isolated target cell has a lot of false positives, is not fetal cell entirely, if male tire, can carry out whether containing the special gene of Y in identification of cell with primer PCR special on Y chromosome, also cannot get rid of external source simultaneously and pollute; If female's tire then cannot be identified with Y.If checked order by the cell that all separation obtain, cost is higher, and the cycle is longer.This just needs after isolated cell and before the order-checking of upper machine, must carry out cellular identification, no matter sex of foetus, and accurately can judge which is target fetal cell, which is mother's cell, and which cell has the pollution of foreign DNA.

Summary of the invention

In view of above-mentioned, the invention provides a kind of a new generation that is applied to without the cellular identification method creating antenatal diagnosis field, described method comprises the steps:

(1) extract the sample of pregnant woman and spouse thereof and extract DNA, str locus somatotype is carried out to described DNA;

(2) pregnant woman blood sample carries out density gradient centrifugation and obtains cell suspension, and cervical secretions sample is crossed cell sieve and obtained cell suspension;

(3) sorting target cell carry out full genome amplification, carries out high-flux sequence, and carries out str locus somatotype;

(4) according to above-mentioned str locus genotyping result, under same str locus seat, the different STR type of father and mother, detection is separated cytogene amplification (such as multiple displacement amplification) product obtained and whether has the peculiar STR type of father, successfully from parent, is separated to fetal cell if any then thinking.

In a specific embodiment, the str locus of the inventive method is selected from locus D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA on 8 euchromosomes and 16 locus DYS456, DYS389 I, DYS390, the DYS389 II on Y chromosome, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA_H4, DYS437, DYS438, DYS448.

The present invention is the perfect adaptation of cellular identification method in a new generation without wound antenatal diagnosis field, be separated between order-checking at fetal cell, integrate effective cellular identification method, cell derived can be judged more accurately, decontaminate, improve the validity of sequencing data, and then improve the accuracy without the antenatal detection of wound.

Accompanying drawing explanation

Fig. 1: after micro-fluidic sorting, target cell (400X) is found under fluorescent microscope, our target cell is that hochest is positive, CD71 is positive and the cell of CD45 feminine gender, upper row is hochest coloration result, CD71 fluorescence from left to right respectively, and lower row is CD45 fluorescence, hochest, CD71, CD45 duplicative effect figure from left to right respectively.

Fig. 2: the cell of separation carries out whole genome amplification product and parent gene group DNA, 8 pairs of house-keeping genes carry out Quality Control, rough evaluation expanding effect, be marker from left to right respectively, cell-1, cell-2, mother gDNA, father gDNA, positive control, blank, marker, can find out that cell-1 and cell-2 has more than 5 bands by result, tentatively think that whole genome amplification effect is better.

Fig. 3: cell MDA product and parent gene group carry out STR somatotype respectively, comprise locus D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA on 8 euchromosomes and 16 locus DYS456, DYS389 I, DYS390, the DYS389 II on Y chromosome, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA_H4, DYS437, DYS438, DYS448, this figure has only intercepted the detected result in mother 8 STR sites.

Target cell after Fig. 4: STR qualification, after high-flux sequence, the data obtained calculate the chromosomal copy rate of every bar, in table, 1-24 refers to 1-22 euchromosome and X, Y chromosome respectively, the longitudinal axis represents copy rate size, dark representative sample cell-1, light color represents cell-2, finds out that two cells are 18-tri-bodies by figure.

Embodiment

In recent years, large quantity research shows, methods of genotyping is the most effectively and accurately method of carrying out cell contamination qualification.STR (shorttandemrepeat, tandem repetitive sequence) the Short tandem repeatSTR structure [32] of 2-6 base that to be core sequence be, STR sequence and abundant in human genome, on average just occur one [33] every 6kb-10kb, most STR is positioned at non-coding region.The STR of half is about had to have genetic polymorphism.Although do not wish to rigidly adhere in concrete theory, contriver thinks that this identifies for individual and qualification provides basis.Str locus somatotype has following advantage: one is the information highly enriched, and can analyze multiple str locus seat simultaneously, can judge accurately to pollute; Two is High sensitivity, and can detect minimum 0.1ngDNA (about 15 diploid gene groups), trace sample can satisfy the demands, and early stage pollution can be detected; Three is high-throughput and systematize platform: adopt automatic analysis system to detect in a large number and data analysis, result is more accurate, objective.Except str locus somatotype, SNP somatotype also can reach effect same, SNP (SingleNucleotidePolymorphisms, single nucleotide polymorphism) be the polymorphism of the DNA sequence dna that genome nucleotide level is caused by single nucleotide diversity, in human genome, every 1000 Nucleotide just have a SNP, see that each SNP site can have three kinds of different variant forms in theory, SNP somatotype also can be applied to cellular identification.

Compare existing without wound antenatal diagnosis technology, a new generation's nothing wound antenatal diagnosis technology has following advantage, adopts high-flux sequence to analyze fetal cell, can once obtain many-sided information, comprise chromosomal aneuploidy, chromosomal deletion and insertion, also have the variation etc. of Single locus.And cellular identification is step the most key in the nothing wound antenatal diagnosis of whole a new generation, there is following meaning:

First, can judge whether we have by cellular identification and be separated to fetal cell, regardless of male tire female tire, as long as there is the genome of father and mother, identification of cell source can be come by STR somatotype, judge the success or failure of sorting cells.

Secondly, can judge whether the cell of institute's sorting has the pollution of other non-fetal cells by cellular identification, such as modal abundant source of parents cellular context, also can get rid of the foreign DNA may introduced in whole genome amplification process and pollute, ensure the credibility of sequencing data.

In addition, order-checking cost can also be reduced by cellular identification, as there is no STR Classification Identification, the pollution of cell or DNA cannot be got rid of, directly affect data validity.

The present invention relates to fetal cell conventional to be up till now separated, in conjunction with s-generation sequencing technologies, the single nucleotide polymorphism (SNP) in the dysploidy of fetal chromosomal, the deletion and insertion of fetal chromosomal and genome is detected.The object of the invention is cellular identification to be integrated in this Non-Invasive methods for prenatal diagnosis, accurately judging cell derived to reaching, decontaminating, improve the accuracy without wound antenatal diagnosis whereby.

Although this invention uses maternal blood sample in a particular embodiment, also can be cervical secretions sample, different sample process mode be different, and net result obtains single cell suspension; Use micro-fluidic platform of Denging in this embodiment, in conjunction with micro-dissections, but be not limited to this platform, also can use fluidic cell sorting platform, or micrurgy etc.; Use QIAGEN whole genome amplification test kit in the embodiment of the present invention, amplification principle is multiple displacement amplification (MultipleDisplacementAmplification, MDA), as long as all can use based on the test kit of this know-why; The 8 pairs of house-keeping genes used in the embodiment of the present invention, from DNA sequence dna very conservative in human genome, also can use other house-keeping genes to carry out preliminary assessment whole genome amplification effect; In the embodiment of the present invention, cellular identification is ABI company miniFiler ^tMpCRAmplificationKit and 3130xlGeneticAnalyzer analysis platform, but be not subject to test kit in actual applications and institute uses the restriction of platform of checking order, such as also can adopt the methods such as mass spectrum SNP somatotype; Use in this embodiment the order-checking plant and instrument of company and Principle Method, but be not subject in actual applications use order-checking platform restriction, such as can use company order-checking platform or sOLiDTM order-checking platform etc.What combine in this specific embodiment is s-generation sequencing technologies, too can in conjunction with the third generation, forth generation sequencing technologies.

Key step of the present invention is as follows:

(1) a family sample is provided, comprises the blood sample of pregnant woman or the blood sample sample of cervical secretions sample and pregnant woman husband;

(2) pregnant woman blood sample carries out density gradient centrifugation and obtains cell suspension, and cervical secretions sample is crossed cell sieve and obtained cell suspension, extracts the DNA of pregnant woman and pregnant woman husband respectively;

(3) sorting target cell carry out full genome amplification;

(4) expanding effect Quality Control and cellular identification;

(5) high-flux sequence instrument checks order;

The above method is concrete to be in this experiment implemented as follows:

Get the peripheral blood of appropriate pregnant woman man and wife, gather with heparin heparin tube, leave and take portion perimeter blood and extract DNA, extract DNA and use QIAGEN commercial kits; Maternal blood sample will be remained with not containing Ca ²⁺, Mg ²⁺0.1M phosphate buffered saline buffer (PBS) dilute in 1:1 ratio; 2mL parting liquid 1119 (parting liquid is from Sigma Co., USA) is added in the 15mL centrifuge tube carrying out mark, then successively 2mL parting liquid 1110 and 1077 (parting liquid is all from Sigma Co., USA) is added gently, finally add the blood sample having used PBS1:1 volume dilution gently, 800g × 20min, elevation rate is 1 gear; Visible two layers of cells after centrifugal, careful sucking-off 6ml place and 4ml place cellular layer are transferred in new 15ml centrifuge tube, and 6ml place cellular layer saves backup, and 4ml cellular layer is target cell layer; WashingMedium1640 (gibco is added in the pipe after cell transfer byLifetechnologies ^tM) about 10mL, mix cell gently, action wants soft, prevents cell rupture; 500g × 5min, elevation rate is 1, abandons supernatant, and remaining liq volume is less than 50 μ L, is dispelled by cell; Add the capture antibody of 200 μ L5ng/ μ L, incubated at room 1h; Microfluidic system sorting cells [30], first carries out primary antibodie immunity, and primary antibodie comprises the anti-human CD71 of rabbit and mouse-anti people CD45 (all from ABCAM company, working concentration is 0.5mg/mL to antibody); Then two anti-immunity are carried out, two anti-donkey anti-rabbit IgG-Alexa488 and donkey against murine IgG-Alexa555 (all from INVITROGEN company, working concentration is 1mg/mL to antibody); Last hochest (Lifetechnologies) dyes, micro-dissections obtains the target cell of fluoresced green, the target cell obtained carries out whole genome amplification, and amplification principle is multiple displacement amplification (MultipleDisplacementAmplification, MDA); Amplification obtains enough DNA, and adopt 8 pairs of house-keeping gene preliminary assessment expanding effects, eight pairs of primer sequences are respectively

18-F/GGCAACGCTTAGACTCTGTGTG(SEQIDNO.1),

18-R/CTGCCCTTGGCCTAA-CTAACCT(SEQIDNO.2)；

12F/GTTCCTCAAGAAGCTGCACGAG(SEQIDNO.3),

12-R/CGTTAGA-CTCTGGATCTGGCGT(SEQIDNO.4)；

16-F/CCAGCCAATTCATGAGTCGGTG(SEQIDNO.5),

16-R/CCTGACAACTCGCAAGTAGCAC(SEQIDNO.6)；

17-F/GCTCAATGGGGTACTT-CAGGGT(SEQIDNO.7),

17-R/GTGGACGTTACGTAAAAGGCCC(SEQIDNO.8)；

19-F/TGCTCTGG-ATGTGAAGATGCCA(SEQIDNO.9),

19-R/TTCCAGGTAAATCCAGCCCAGG(SEQIDNO.10)；

3-F/CAGCCAGTCAGCATCATCCAAC(SEQIDNO.11)；

3-R/GAAAGCCGGATTGCGGTA-ACAT(SEQIDNO.12)；

8-F/GGATAGCTCTGCAAGGGGAGAG(SEQIDNO.13),

8-R/TCGTCGCAGTA-GAAATACGGCT(SEQIDNO.14)；

22-F/AGAAGTCAGGCACGTAGCTCAG(SEQIDNO.15),

22-R/GG-CACGTTGGTGTTTACGATGA(SEQIDNO.16)。

Amplification system is:

dNTP(2.5mM)3.2μL，

TAKARA10*PCRbuffer3μL，

Housekeepingprimermix3μL，

BSA0.2μL，

TAKARArTaq0.4μL，

MDA product 0.5 μ L,

DdH ₂o19.7 μ L is totally 30 μ L;

Reaction conditions is:

95℃5min；

35 circulations:

95℃30s，

58℃50s，

72℃1min；

72℃5min；

4℃hold。

Then, commercial ABI is chosen miniFiler ^tMpCRAmplificationKit and 3130xlGeneticAnalyzer analysis software carries out gene type; According to the genotyping result of family, under same str locus seat, the different STR type of father and mother, detection is separated the cell MDA product obtained and whether has the peculiar STR type of father, successfully from parent, is separated to fetal cell if any then thinking; Then interrupted by target cell MDA product, undertaken building storehouse by the requirement for construction data base of corresponding sequenator, upper machine order-checking, lower machine data is analyzed.

Embodiment

One routine sample is from the pregnant woman of existing clinical effectiveness, and dissociative DNA analytical results is shown as 18-tri-body man tire.In this experiment, extract 5ml maternal blood, with the blood sampling of heparin heparin tube, by blood sample with not containing Ca ²⁺, Mg ²⁺0.1M phosphate buffered saline buffer (PBS) dilute in 1:1 ratio; 2mL parting liquid 1119 (parting liquid is from Sigma Co., USA) is added in 15mL centrifuge tube, then successively 2mL parting liquid 1110 and 1077 (parting liquid is all from Sigma Co., USA) is added gently, finally add the blood sample having used PBS1:1 volume dilution gently, 800g × 20min, elevation rate is 1 gear; At visible two cellular layers in 6ml place and 4ml place after centrifugal, careful sucking-off 6ml place and 4ml place cellular layer are transferred in new 15ml centrifuge tube, and 6ml place cellular layer saves backup, and 4ml cellular layer is target cell layer; WashingMedium1640 is added (from gibco in the pipe after cell transfer byLifetechnologies ^tMcompany) about 10mL, mix cell gently, action wants soft, prevents cell rupture; 500g × 5min, elevation rate is 1 gear, abandons supernatant, and remaining liq volume is less than 50 μ L, is dispelled by cell; Capture antibody (from R & DSYSTEMS company) is diluted with 200 μ LABDS (PBS+2% donkey serum), capture antibody mainly comprises goat-anti people CD71 and goat-anti people CD147, capture antibody can with cell-surface antigens specific binding, the other end can be combined with micro-fluidic chip, and it is stand-by that certain density capture antibody and above-mentioned cell suspension lucifuge mix 1h.

[30] assembling chip in addition on request, and hunt leak, when determining without leakage, with 200 μ LddH ₂o dissolves 8mgEDC (1-ethyl-(3-dimethylaminopropyl) phosphinylidyne diimmonium salt hydrochlorate, again with the EDC solubilize NHS (N-hydroxy thiosuccinimide sodium salt) after dissolving, finally this solution passes through micro fluidic device with the speed of 200 μ L/h, micro-fluidic surface chemistries is modified, after modification completes, logical PBS washs, then chip is modified once again with 20 μ L enzyme avidin (SA, INVITROGEN) that 200 μ LPBS dissolve; After chip has been modified, logical PBS washing; Then add in the cell that 800uLABDS (PBS+2% donkey serum) hatches to above and capture antibody, centrifugal 300g × 5min after mixing, abandon supernatant, be resuspended in by cell in 200 μ LLoadingBuffer (1640Medium+10%FBS), cell suspension passes through chip with the speed of 200 μ L/h; After completing, logical ABDS washs chip, and then by the primary antibodie that 200 μ LABDS dilute, primary antibodie mainly comprises the anti-human CD71 of rabbit and mouse-anti people CD45 (all from ABCAM company, working concentration is 0.5mg/mL to antibody), passes through chip with the speed of 200 μ L/h; The same ABDS washs chip, and dilute with 200 μ LABDS two resist, and two anti-mainly comprise donkey anti-rabbit IgG-Alexa488 and donkey against murine IgG-Alexa555 (all from INVITROGEN company, working concentration is 1mg/mL to antibody); Chip is passed through with the speed of 200 μ L/h; The same ABDS washs chip, after completing, tears chip open, adds 1 dye liquor hochest (Lifetechnologies) in 500 μ LPBS, and after half an hour, lucifuge is dry.

After drying completes, by the corresponding ArcturusXT software manual operation of the micro dissectors of ABI company, the cell that hochest is positive and CD71 is positive and CD45 is negative is selected to be target cell, as shown in Figure 1, by this cell with cutting down, transfer in 0.2mlPCR pipe.Then carry out whole genome amplification, amplification kit uses REPLI-gkit, increases according to corresponding specification sheets.

Product after whole genome amplification, we are referred to as MDA product, and we use 8 pairs of house-keeping genes on human genome to carry out preliminary Quality Control, and house-keeping gene PCR Quality Control result as shown in Figure 2, evaluates whole genome amplification effect.We carry out STR qualification at MDA product preferably more than 5 bands.STR qualification is generally carried out in a family, in this embodiment, because of known male tire, STR site comprises the site on euchromosome and Y chromosome, is respectively locus D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA on 8 euchromosomes and 16 locus DYS456, DYS389 I, DYS390, the DYS389 II on Y chromosome, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA_H4, DYS437, DYS438, DYS448.The ABI company that the DNA also having this pregnant woman and husband thereof that we identify simultaneously, STR qualification uses miniFiler ^tMpCRAmplificationKit and 3130xlGeneticAnalyzer analyzes STR result, and concrete outcome, as Fig. 3, the results are shown in Table 1 after arrangement, but is not limited to this test kit and this platform; Concrete operations refer to and this test kit specification sheets and corresponding instrument explanation.To the target cell of cell MDA product as us of pregnant woman husband specificity STR type be detected, by target cell MDA product according to the Hiseq2000 requirement for construction data base that official of company announces carries out building storehouse order-checking, and order-checking type is monolateral order-checking 50bp, and each sample about obtains data 0.5G.

Utilize comparison software SOAP2 (available from soap.genomics.org.cn), human genome reference sequences in order-checking gained DNA sequence dna and ncbi database is compared, obtain the location of sequenced dna on described genome, for avoiding tumor-necrosis factor glycoproteins to detecting the interference analyzed, only choose and the sequencing sequence of the unique comparison of human genome reference sequences (read).According to being the window of W with reference to genome delimitation length, calculating the GC content of each window and calculating in sample to be tested the sequencing sequence segments UR dropped on each window _sample.Because GC skewed popularity, the high GC in genome or low GC region can be made to occur copy number deviation, removing skewed popularity is conducive to improving accuracy.To UR _sampleand GC _refmap, by Smothspline method, scatter diagram is fitted to level and smooth curve, can draw by the curve after matching unique comparison order-checking number, i.e. M that each GC value is corresponding _fit, WGC=M/M _fit, wherein M is the UR number that sample to be tested drops in equal GC value window, calculates the sequencing sequence number after each window correction: UR _fit=UR _sample× W _gC.Calculate total sequencing sequence number and total window number on 22 euchromosomes, ask sequencing sequence number average in each window and set copy rate for 1 with this.Calculate the average sequencing sequence number of each window on each karyomit(e) more then except the copy rate obtaining whole chromosome in ensemble average sequencing sequence number.First will divide sex for X and Y chromosome, women directly removes in the average sequencing sequence number of other 22 autosomal each windows, and the male sex is just multiplied by 2 again.If occurred, copy rate is abnormal just can intuitively be drawn by analytical results, as shown in Figure 4.

Table 1

Locus	Mother	Father	cell-1	cell-2
					D21S11	26/28/29	27/29/30	29/30	/26/28/29/30
D7S820	10/12	8/10	8/10	8/10/12
					CSF1P0	10/11	10/12	12	10/11/12
D13S317	8/10	9/11	9/11	8/9/11
					D16S539	11/12.2-13	11/13	11	11
D2S1338	17/20	24/25	20/24/25	17/20/25
					D18S51	13	13/20/21	13/20	13/20
AMEL	X	XY	XY	XY
					FGA	22/23	23/25	23/25	22/23/25

Locus	Mother	Father	cell-1	cell-4
					DYS456	Nothing	13/15/16	15	13/15/16
DYS389Ⅰ	Nothing	13	13	13
					DYS390	Nothing	24	24	24
DYS389Ⅱ	Nothing	29/30	29	29
					DYS458	Nothing	16	16	16
DYS19	Nothing	14	14	14
					DYS385	Nothing	11/14	11/14	11/14
DYS393	Nothing	13/14	13	13
					DYS391	Nothing	11	11	11
DYS439	Nothing	12	12	12
					DYS635	Nothing	25	25	25
DYS392	Nothing	13/14	13	13/14
					GATA_H4	Nothing	10/OL	10	10
DYS437	Nothing	15	15	15
					DYS438	Nothing	12	12	12
DYS448	Nothing	19	19	19

Table 1: according to the result of Fig. 3, this form illustrates the genotyping result of totally 24 str locus seats in the euchromosome of this family and Y dyeing, red-label think assorted peak.Cell-1 and cell-2 can be found out all containing the distinctive STR type of pregnant woman husband by table, explanation, we are successfully sorted into fetal cell, but because some STR site of cell-1 and cell-2 has three different types, illustrate that the cell of institute's sorting is not single cell homozygous.

Reference

[1]LoYM,CorbettaNP,ChamberlainF,RaiV,SargentIL,RedmanCW,WainscoatJS.(1997).PresenceoffetalDNAinmaternalplasmaandserum.Lancet,350:485-487.

[2]CostaJM,ErnaultP.(2002).AutomatedassayforfetalDNAanalysisinmaternalserumClinChem,48:679-680.

[3]FinningKM,MartinPG,SoothillPW,AventND.(2002).PredictionoffetalDstatusfrommaternalplasma:introductionofanewnoninvasivefetalRHDgenotypingservice.Transfusion,42:1079-1085.

[4]C.Wright,PHGFoundation,2009,http://www.phgfoundation.org/pages/ffdna.html.

[5]Maddocks,Biochem.Soc.Trans.37(2009)460.

[6]FanHC,BlumenfeldYJ,ChitkaraU,HudginsLS,QuakeR.(2008).NoninvasivediagnosisoffetalaneuploidybyshotgunsequencingDNAfrommaternalblood.PNAS,105:16266-16271.

[7]TakabayashiH,KuwabaraS,UkitaT,IkawaK,YamafujiK,IgarashiT.(1995).Developmentofnon-invasivefetalDNAdiagnosisfrommaternalblood.PrenatDiagn,15:74-77.

[8]BianchiDW,WilliamsJM,SullivanLM,HansonFW,KlingerKW,ShuberAP.(1997).PCRquantitationoffetalcellsinmaternalbloodinnormalandaneuploidpregnancies.AmJHumGenet,61:822-829.

[9]ImudiaAN,KumarS,DiamondMP,DecherneyAH,ArmantDR.Transcervicalretrievaloffetalcellsinthepracticeofmodernmedicine:areviewofthecurrentliteratureandfuturedirection.FertilSteril2010；93:1725–30.

[10]ImudiaAN,SuzukiY,KilburnBA,YelianFD,DiamondMP,RomeroR,etal.Retrievaloftrophoblastcellsfromthecervicalcanalforpredictionofabnormalpregnancy:apilotstudy.HumReprod2009；24:2086–92.

[11]BolnickJM1,KilburnBA1,BajpayeeS1,ReddyN1,JeelaniR1,CroneB1,SimmermanN1,SinghM,etal.Trophoblastretrievalandisolationfromthecervix(TRIC)fornoninvasiveprenatalscreeningat5to20weeksofgestation.FertilSteril.2014Jul；102(1):135-142

[12]KuoPL,GuoHR.(1999).Nucleatedredbloodcellsinmaternalbloodduringpregnancy.JObstetGynaecol,94:464–468.

[13]SekizawaA,FarinaA,ZhenDK,etal.(1999).Improvementoffetalcellrecoveryfrommaternalblood:suitabledensitygradientforFACSseparation.FetalDiagnTher,14:229–233.

[14]SamuraO,SekizawaA,ZhenDK,FalcoVM,BianchiDW.(2000).Comparisonoffetalcellrecoveryfrommaternalbloodusingahighdensitygradientfortheinitialseparationstep:1.090versus1.119g/ml.PrenatDiagn,20:281–286.

[15]SmitsG,HolzgreveW,HahnS.(2000).AnexaminationofdifferentPercolldensitygradientsandmagneticactivatedcellsorting(MACS)fortheenrichmentoffetalerythroblastsfrommaternalblood.ArchGynecolObstet,263:160–163.

[16]IversonGM,BianchiDW,CannHM,HerzenbergLA.(1981).Detectionandisolationoffetalcellsfrommaternalbloodusingthefluorescence-activatedcellsorter(FACS).PrenatDiagn,1:61–73.

[17]BianchiDW,FlintAF,PizzimentiMF,KnollJH,LattSA.1990.IsolationoffetalDNAfromnucleatederythrocytesinmaternalblood.ProcNatlAcadSciUSA87:3279–3283.

[18]PriceJO,EliasS,WachtelS,etal.(1991).Prenataldiagnosiswithfetalcellsisolatedfrommaternalbloodbymultiparameterflowcytometry.AmJObstetGynecol,165:1731–1737.

[19]LewisDE,SchoberW,MurrellS,etal.(1996).Rareeventselectionoffetalnucleatederythrocytesinmaternalbloodbyflowcytometry.Cytometry,23:218–227.

[20]WangJY,ZhenDK,FalcoVM,etal.(2000).Fetalnucleatederythrocyterecovery:fluorescenceactivatedcellsorting-basedpositiveselectionusinganti-gammaglobinversusmagneticactivatedcellsortingusinganti-CD45depletionandanti-gammaglobinpositiveselection.Cytometry,39:224–230.

[21]Ganshirt-AhlertD,Borjesson-StollR,BurschykM,etal.(1993).Detectionoffetaltrisomies21and18frommaternalbloodusingtriplegradientandmagneticcellsorting.AmJReprodImmunol,30:194–201.

[22]Ganshirt-AhlertD,BurschykM,GarritsenHS,etal.(1992).Magneticcellsortingandthetransferrinreceptoraspotentialmeansofprenataldiagnosisfrommaternalblood.AmJObstetGynecol,166:1350–1355.

[23]BuschJ,HuberP,PflugerE,MiltenyiS,HoltzJ,RadbruchA.(1994).Enrichmentoffetalcellsfrommaternalbloodbyhighgradientmagneticsorting(doubleMACS)forPCR-basedgeneticanalysis.PrenatDiagn,14:1129–1140.

[24]CampagnoliC,MulthauptHA,LudomirskiA,HautMJ,WarholMJ.(1997).Noninvasiveprenataldiagnosis:useofdensitygradientcentrifugation,magneticallyactivatedcellsortingandinsituhybridization.JReprodMed,42:193–199.

[25]ValerioD,AielloR,AltieriV.(1997).Isolationoffetalerythroidcellsfrommaternalbloodbasedonexpressionoferythropoietinreceptors.MolHumReprod,3:451–455.

[26]TroegerC,HolzgreveW,HahnS.(1999b).AcomparisonofdifferentdensitygradientsandantibodiesforenrichmentoffetalerythroblastsbyMACS.PrenatDiagn,19:521–526.

[27]MavrouA,KouvidiE,AntsaklisA,SoukeA,KitsiouTzeliS,KolialexiA.(2007).Identificationofnucleatedredbloodcellsinmaternalcirculation:Asecondstepinscreeningforfetalaneuploidiesandpregnancycomplications.PrenatDiagn,27:150–153.

[28]TakabayashiH,KuwabaraS,UkitaT,IkawaK,YamafujiK,IgarashiT.(1995).Developmentofnon-invasivefetalDNAdiagnosisfrommaternalblood.PrenatDiagn,15:74–77.

[29]SekizawaA,PurwosunuY,FarinaA,etal.(2007).DevelopmentofnoninvasivefetalDNAdiagnosisfromnucleatederythrocytescirculatinginmaternalblood.PrenatDiagn,27:846–848.

[30]ZhaoL1,LuYT,LiF,WuK,HouS,YuJ,ShenQ,WuD,SongM,OuyangWH,LuoZ,LeeT,FangX,ShaoC,XuX,GarciaMA,ChungLW,RettigM,TsengHR,PosadasEM.High-PurityProstateCirculatingTumorCellIsolationbyaPolymerNanofiber-EmbeddedMicrochipforWholeExomeSequencing.AdvMater.2013Mar26.

[31]HouS1,ZhaoH,ZhaoL,ShenQ,WeiKS,SuhDY,NakaoA,GarciaMA,SongM,LeeT,XiongB,LuoSC,TsengHR,YuHH.Captureandstimulatedreleaseofcirculatingtumorcellsonpolymer-graftedsiliconnanostructures.AdvMater.2013Mar20；25(11):1547-51

[32]EdwardsA1,CivitelloA,HammondHA,CaskeyCT.DNAtypingandgeneticmappingwithtrimericandtetramerictandemrepeats.AmJHumGenet.1991Oct；49(4):746-56.

[33]LinsAM1,SprecherCJ,PuersC,SchummJW.Multiplexsetsfortheamplificationofpolymorphicshorttandemrepeatloci--silverstainandfluorescencedetection.Biotechniques.1996May；20(5):882-9.

Claims (5)

1. be applied to the method without the antenatal cellular identification of wound, described method comprises the steps:

(1) extract the sample of pregnant woman and spouse thereof and extract DNA, str locus somatotype is carried out to described DNA;

(2) pregnant woman blood sample carries out density gradient centrifugation and obtains cell suspension or cervical secretions sample and cross cell sieve and obtain cell suspension;

(3) sorting target cell carry out full genome amplification, carries out high-flux sequence, and carries out str locus somatotype;

(4) according to above-mentioned str locus genotyping result, under same str locus seat, the different STR type of father and mother, detection is separated the cytogene amplified production obtained and whether has the peculiar STR type of father, successfully from parent, is separated to fetal cell if any then thinking.

2. the method for claim 1, described gene amplification is multiple displacement amplification.

3. the method for claim 1 or 2, described str locus is selected from locus D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA on 8 euchromosomes and 16 locus DYS456, DYS389 I, DYS390, the DYS389 II on Y chromosome, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA_H4, DYS437, DYS438, DYS448.

4. one group is used for the str locus without the antenatal cellular identification of wound, and described str locus is selected from locus D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA on 8 euchromosomes and 16 locus DYS456, DYS389 I, DYS390, the DYS389 II on Y chromosome, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA_H4, DYS437, DYS438, DYS448.

5. the str locus of claim 4, described str locus is locus D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA on 8 euchromosomes and 16 locus DYS456, DYS389 I, DYS390, the DYS389 II on Y chromosome, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA_H4, DYS437, DYS438, DYS448.