CN105400779A - Target sequence, recognized by streptococcus thermophilus CRISPR-Cas9 system, of human CCR5 gene, sgRNA and application of CRISPR-Cas9 system - Google Patents
Target sequence, recognized by streptococcus thermophilus CRISPR-Cas9 system, of human CCR5 gene, sgRNA and application of CRISPR-Cas9 system Download PDFInfo
- Publication number
- CN105400779A CN105400779A CN201510676703.0A CN201510676703A CN105400779A CN 105400779 A CN105400779 A CN 105400779A CN 201510676703 A CN201510676703 A CN 201510676703A CN 105400779 A CN105400779 A CN 105400779A
- Authority
- CN
- China
- Prior art keywords
- sequence
- sgrna
- crispr
- cas9
- cas9 system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention belongs to the field of genetic engineering, and discloses a target sequence, recognized by a streptococcus thermophilus CRISPR-Cas9 system, of a human CCR5 gene, sgRNA and an application of the CRISPR-Cas9 system. The target sequence is shown as any one of the nth bit to the 30th bit of the SEQ ID NO:1-30, and n is equal to 1-12. The invention further relates to the sgRNA of the sequence -3' with the sequence of 5'-recognition sequence-recruiting Cas9 protein and a coded DNA molecule thereof. The DNA sequence corresponding to the recognition sequence is identical to the target sequence. The invention further relates to the CRISPR-Cas9 system. The system comprises Cas9 protein, the sgRNA and/or the coded sequence carrying the Cas9 protein and a carrier of the coded sequence of the sgRNA. The invention further relates to the application of the CRISPR-Cas9 system in editing the CCR5 gene and preparing medicine for HIV infection. Editing of the human CCR5 gene can be achieved, and therefore Aids is prevented and treated.
Description
Technical field
The invention belongs to genetically engineered field, relate to the target sequence of CRISPR-Cas9 system identification and sgRNA and their related application.
Background technology
Acquired immune deficiency syndrome (AIDS) (acquiredimmunodeficiencysyndrome, AIDS), also known as acquired immune deficiency syndrome (AIDS), is the great transmissible disease of a kind of hazardness.Self-discovery three during the last ten years, AIDS is accumulative causes two over thousands of ten thousand people dead, is a huge public health problem always, affects the life of the whole world 3,5,300,000 people.AIDS is infected by human immunodeficiency virus (HumanImmunodeficiencyVirus, HIV) to cause, and HIV is a kind of slow virus infecting human immune system's cell, belongs to the one of retrovirus, is also called virus of AIDS.HIV can be divided into HIV-1 and HIV-2 two kinds of hypotypes, and the virulence of HIV-1 is strong, is the main pathogens causing acquired immune deficiency syndrome (AIDS).
CD4
+t cell is the primary target spot of HIV-1 virus infection, and studying subsequently and finding only has CD4 molecule can not mediate the intrusion of HIV-1 virus, also needs one or more accessory receptors (coreceptor) simultaneously.Within 1996, confirm, Chemokine receptor CXCR4 and CCR5 are the accessory receptors of HIV-1 virus infection.Wherein, chemokine ccr 5, as the epicyte protein of G-protein coupling receptor (G-proteincoupledreceptor, GPCR) superfamily, is that HIV-1 invades one of main accessory receptor of body cell.CCR5 mainly stationary phase memory T-lymphocyte, monocyte and immature dendritic cell film on express, accessory receptor important when being HIV-1 invasion human body, it invades one of main accessory receptor of body cell as HIV-1, is an important drug target in the research for the treatment of acquired immune deficiency syndrome (AIDS).
At present to the treatment means mainly infection of control HIV-1 virus and the development of obstruction AIDS of acquired immune deficiency syndrome (AIDS), be called HAART method (highlyactiveantiretroviraltherapy, HAART), a series of compound suppressing each reproductive stage of virus is comprised.HAART can reduce the breeding of intracellular virus and the generation of plasma viremia to a great extent, but is not infected not effect by HIV-1 for new host cell.Infected by HIV-1 to prevent healthy cell from source, new treatment plan needs the intrusion feature of break virus up hill and dale, thus the HIV-1 receptor antagonist with CCR5 being target spot is more and more concerned, mainly contains chemokine derivative, non-peptide micromolecular compound, monoclonal antibody, peptides etc.The mechanism of the HIV-1 cells infected of classical CCR5 antagonist suppression R5 preferendum is: after they are combined with CCR5, make CCR5 conformational change, cause the endogenous identification turning use (internalization) into or be unfavorable for HIV-1 of CCR5, block the combination of HIV-1 and epicyte protein, cause HIV-1 and CCR5 to reduce in the combination of cell surface, thus play anti-infectious effect.But unfortunately a kind of inhibitor of life-time service, finally can make HIV-1 produce resistance, along with the continuous appearance of resistance, make existing anti-HIV-1 medicines be difficult to reach desirable result for the treatment of.Meanwhile, also there is following shortcoming in CCR5 antagonist, and such as, the transformation period of natural chemokine is short and there is potential incite inflammation response effect; Non-peptide micromolecular compound can not lower expression of receptor; Peptides is unstable, easily degrade; There is human body to shortcomings such as the inadaptability of medicine, potential anaphylaxis in monoclonal antibody.
In recent years, along with the breakthrough step by step of target gene editing technique, from ZFN (zincfingernuclease) TALEN finally (transcriptionactivator-likeeffectornuclease) and up-to-date CRISPR-Cas9 technology, for the thorough healing of acquired immune deficiency syndrome (AIDS) provides new hope.Research shows that the experimenter with CCR5 encoding gene 32 nucleotide deletions contacts HIV but HIV do not detected, indicate CCR5 and affect HIV poisoning intrusion cell, illustrate that CCR5 gene is the target spot of reliable, an efficient and safe treatment HIV, therefore, it is possible to realize the method that CCR5 knocking out in genome aspect is also reliable, efficient and safe treatment HIV.2008, Sangamo successfully utilized ZFNs at CD4
+t cell realizes knocking out of CCR5, but the efficiency that ZFN target knocks out CCR5 is lower, people expect to find that more efficient CCR5's knock out strategy.
Rule cluster interval short palindrome duplicated system (clusteredregularlyinterspacedshortpalindromicrepeat, CRISPR-associated, CRISPR-Cas9) be a kind of complex body with endonuclease activity, a kind of immune defense system that bacterium and archeobacteria are formed during evolution, in order to resist adventitious viruses and foreign DNA invasion.CRISPR-cas9 system is by integrating exogenous dna fragment in CRISPR, utilize CRISPRRNA (CRISPR-derivedRNA, and transacting RNA (trans-activatingRNA crRNA), tracrRNA) identify target sequence specifically, and sequence target site is cut.Under the condition not having template, there is non-homogeneous restructuring end and connect (Non-homologousendjoining, NHEJ), in the process that NHEJ repairs, often produce insertion or the disappearance (indel) of DNA, cause phase shift mutation, cause gene knockout.Or when there being homologous templates, the reparation approach by another homologous recombination (homologousrecombination, HR) is repaired, and can realize the accurate edits to target gene, as introduced specific mutagenesis or fixed point transgenosis.Two kinds of tiny RNA (crRNA and tracrRNA) are fused into a RNA chain now, be called for short sgRNA (singleguideRNA), therefore, it is possible to the sgRNA designing, prepare accuracy and selectively targeted target gene becomes the key of CRISPR-Cas9 gene knockout.
Summary of the invention
The object of the invention is to overcome the deficiencies in the prior art, sgRNA and their the relevant application of a kind of target sequence of CRISPR-Cas9 system identification and accurate targeted human CCR5 gene is specifically provided.
Therefore, to achieve these goals, first aspect, the invention provides a kind of target sequence of CRISPR-Cas9 system identification, and described target sequence is as shown in any one the n-th-30 in SEQIDNO:1-30 and n=1-12.
Second aspect, the invention provides a kind of sgRNA, the sequence of this sgRNA is: the sequence-3 of 5 '-recognition sequence-recruitment Cas9 albumen ', wherein, DNA sequence dna corresponding to described recognition sequence is as shown in any one the n-th-30 in SEQIDNO:1-30 and n=1-12.
The third aspect, the invention provides the DNA molecular of the sgRNA of coding described in second aspect.
Fourth aspect, the invention provides a kind of CRISPR-Cas9 system, this CRISPR-Cas9 system comprises Cas9 albumen and sgRNA and/or comprises the carrier carrying the encoding sequence of Cas9 albumen and the encoding sequence of sgRNA, the described encoding sequence of Cas9 albumen and the encoding sequence of sgRNA are positioned on identical or different carrier, wherein, described sgRNA for the sgRNA described in second aspect and described Cas9 protein source from thermophilus streptococcus (Streptococcusthermophilus).
5th aspect, the invention provides a kind of method of editing CCR5 gene, the method comprises: expressed by the CRISPR-Cas9 system introducing described in fourth aspect in the cell of CCR5.
6th aspect, the CRISPR-Cas9 system described in fourth aspect of the invention provides is for the preparation of the application prevented and/or treated in the medicine of HIV.
7th aspect, the invention provides a kind of method preventing and/or treating HIV, and the method comprises to be expressed the CRISPR-Cas9 system introducing described in fourth aspect in the cell of CCR5.
The present invention can realize the editor of CCR5 gene, and then changes the sequence of CCR5, the sequence especially combined with HIV surface protein, causes cell by HIV, thus cannot realize the object preventing and/or treating acquired immune deficiency syndrome (AIDS).
Other features and advantages of the present invention are described in detail in embodiment part subsequently.
Accompanying drawing explanation
Accompanying drawing is used to provide a further understanding of the present invention, and forms a part for specification sheets, is used from explanation the present invention, but is not construed as limiting the invention with embodiment one below.In the accompanying drawings:
Fig. 1 is the structural representation of the recombinant plasmid of expressing sgRNA;
Fig. 2 is the structural representation of the recombinant plasmid of expressing StCas9;
Fig. 3 is the structural representation of the recombinant plasmid of simultaneously expressing sgRNA and StCas9;
Fig. 4 is the sequencing result after knocking out according to the CCR5 gene of one embodiment of the present invention to HEK293T cell.
Embodiment
Below the specific embodiment of the present invention is described in detail.Should be understood that, embodiment described herein, only for instruction and explanation of the present invention, is not limited to the present invention.
In the present invention, when not doing contrary explanation, the term " gene knockout " of use or " gene editing " refer to be deleted the genomic dna of biology, insert or replaces, thus reaches the object to aim sequence amendment; SgRNA and the CRISPR-Cas9 system that the present invention relates to is artificial reconstructed (engineering, non-naturallyoccurring).
In a first aspect, the target sequence of CRISPR-Cas9 system identification provided by the invention is as shown in any one the n-th-30 in SEQIDNO:1-30 and n=1-12 (integer, 1,2,3,4,5,6,7,8,9,10,11 or 12).
In second aspect, the sequence of sgRNA provided by the invention is: the sequence-3 of 5 '-recognition sequence-recruitment Cas9 albumen ', it is characterized in that, DNA sequence dna corresponding to described recognition sequence is as shown in any one the n-th-30 in SEQIDNO:1-30 and n=1-12 (integer, 1,2,3,4,5,6,7,8,9,10,11 or 12).Wherein, "-" represents that there to be the mode of function to be connected, non-interference expression or performance, the polynucleotide sequence be connected is continuous print to polynucleotide element (recognition sequence and the sequence of recruiting Cas9 albumen).
The sequence of described recruitment Cas9 albumen is the sequence can recruiting Cas9 albumen, namely makes it activate in conjunction with Cas9 albumen and can cut the sequence of target gene, usually having specific secondary structure (as loop-stem structure).Preferably, the sequence of described recruitment Cas9 albumen is as shown in SEQIDNO:31-34.
Described Cas9 albumen can derive from thermophilus streptococcus (S.thermophilus), if the EntryName in UniProt is the albumen of CAS9_STRTR.The aminoacid sequence of Cas9 albumen also can see EWM58113.1, WP_011681470.1, sp|G3ECR1.2|CAS9_STRTR, WP_014727651.1, WP_024703962.1, WP_014608595.1, ETE40675.1, ETE40173.1 or EWM55849.1 etc. of NCBI.Such as, the aminoacid sequence of Cas9 albumen is as shown in SEQIDNO:42.
A preferred embodiment of the invention, DNA sequence dna corresponding to described recognition sequence as shown in SEQIDNO:22 and the sequence of recruiting Cas9 albumen as shown in SEQIDNO:33.This preferred sgRNA more effectively can edit (knocking out) CCR5 gene.
In a third aspect, the invention provides the DNA molecular of the sgRNA of coding described in second aspect.
In fourth aspect, CRISPR-Cas9 system provided by the invention comprises Cas9 albumen and sgRNA and/or comprises the carrier carrying the encoding sequence of Cas9 albumen and the encoding sequence of sgRNA, the described encoding sequence of Cas9 albumen and the encoding sequence of sgRNA are positioned on identical or different carrier, described sgRNA for the sgRNA described in second aspect and described Cas9 protein source from thermophilus streptococcus.
Described carrier is the nucleic acid molecule that can transmit entrained nucleic acid (encoding sequence).Described carrier can be plasmid, lambda particles phage, cosmid, yac vector etc.In specific embodiment, described carrier is carrier for expression of eukaryon, as pcDNA3.
The structure carrying the carrier of the encoding sequence of sgRNA can be as shown in Figure 1.The structure carrying the carrier of the encoding sequence of Cas9 albumen can be as shown in Figure 2.The structure simultaneously carrying the carrier of the encoding sequence of Cas9 albumen and the encoding sequence of sgRNA can be as shown in Figure 3.
As mentioned above, the encoding sequence of described Cas9 albumen derives from thermophilus streptococcus, and can for being suitable for the sequence (sequence as shown in SEQIDNO:38 3815-8107 position) at eukaryotic expression after codon optimized.
According to the preferred embodiment of the present invention, the sgRNA that described sgRNA is " DNA sequence dna corresponding to recognition sequence as shown in SEQIDNO:22 and the sequence of recruiting Cas9 albumen as shown in SEQIDNO:33 ".
In in the 5th, the method for editor CCR5 gene provided by the invention comprises: expressed by the CRISPR-Cas9 system introducing described in fourth aspect in the cell of CCR5.Editor's CCR5 gene can realize rise, the downward of CCR5 genetic expression or lose, and is in harmonious proportion forfeiture preferably.Described cell can derive from primate, preferably derives from people.The method can in vivo or external enforcement.
In in the 6th, the CRISPR-Cas9 system described in fourth aspect of the invention provides is for the preparation of the application prevented and/or treated in the medicine of HIV.
It should be noted that, each sgRNA provided by the invention can conbined usage, can be the conbined usage of two or more sgRNA arbitrarily, and by conbined usage, CRISPR-Cas9 system can the multiple site of target, thus can more effectively knock out CCR5 gene.
Below will be described the present invention by embodiment.If do not specialize, the conventional means that technique means used in embodiment is well known to those skilled in the art, is raw materials usedly commercial goods.
In the examples below, the oligonucleotide sequence trust money Si Rui bio tech ltd synthesis related to obtains.
Embodiment 1
The present embodiment is used for illustrating the design of sgRNA of the present invention.
Sequence-3 according to 5 '-recognition sequence-recruitment Cas9 albumen ' and the base sequence shown in following table 1 build 120 sgRNA.
Table 1
Embodiment 2
The present embodiment is used for illustrating the structure of CRISPR-Cas9 system of the present invention.
(1) add that CACC obtains forward oligonucleotide (Forwardoligo) at 5 ' end of DNA sequence dna (as described in Example 1) corresponding to sgRNA, according to this sgRNA, obtain its complementary strand, and add that AAAC obtains reverse oligonucleotide (Reverseoligo) at its 5 ' end.Synthesize respectively.If DNA sequence dna 5 ' end first base that sgRNA recognition sequence is corresponding is not G, then need after CACC, add a G, add the C of a coupling accordingly at 3 ' end of reverse oligonucleotide.By above-mentioned forward oligonucleotide and the paired sex change of reverse oligonucleotide, annealing, annealing forms the double-strand sgRNA oligonucleotide that can be connected in U6 carrier for expression of eukaryon afterwards, and the system of sex change, annealing is:
The condition of PCR is: 37 DEG C of 30min; 95 DEG C of 5min; Then with the speed slow cooling to 25 DEG C of 5 DEG C/min; Preserve stand-by at being placed in 4 DEG C.
(2) carry out BsmBI enzyme to plasmid to cut and dephosphorylation, reaction system is as follows:
Hatch 1 hour for 37 DEG C, product carries out agarose gel electrophoresis, utilizes glue to reclaim test kit (TIANGEN, DP080822) and cuts glue recovery digestion products.
(3) the double-strand sgRNA oligonucleotide after annealing has the sticky end of BsmBI, by its with carried out ligation by the plasmid that BsmBI enzyme cuts through, the system of ligation is:
Hatch 1 hour for 16 DEG C.
(4) by above-mentioned connection product conversion in Stbl3 competent cell (purchased from Bo Maide Bioisystech Co., Ltd), be coated with Amp+ (100 μ g/ml), picking mono-clonal.
(5) obtain positive colony by PCR qualification, the primer of use is as follows:
F1：TCATATGCTTACCGTAACTTGAAAG(SEQIDNO:35)
R1：CCAATTCCCACTCCTTTCAAG(SEQIDNO:36)
Reaction system is: damping fluid, 2.5ul; DNTP, 2.5ul; ExTaq (TaKaRa), 0.15ul; Dilution bacterium liquid, 1ul; Primers F 1/R1,0.3ul; ddH
2o, 18.25ul.
The condition of PCR is: 37 DEG C of 30min; 94 DEG C of 5min; (94 DEG C of 30s; 68 DEG C of 30s; 72 DEG C of 45s) 22 circulations; 72 DEG C of 8min; Preserve stand-by at being placed in 4 DEG C.
The exactness of sequence verification plasmid sequence.
(6) 37 DEG C of incubator overnight cultivate positive colony, and with the little extraction reagent kit (TIANGE of plasmid, DP106-02) extracting plasmid, obtain the recombinant plasmid U6-hCCR5sgRNA-EF1a-Neo-WPRE of expression sgRNA (see Fig. 1, wherein a kind of sequence is as shown in SEQIDNO:37, the 2857-2973 position of SEQIDNO:37 is replaced different sgRNA encoding sequences and can obtain the recombinant plasmid of expressing each sgRNA in embodiment 1), express the recombinant plasmid U6-EF1a-NLS-stCas9-2A-Puro-WPRE of StCas9 (see Fig. 2, wherein a kind of sequence is as shown in SEQIDNO:38, the 3815-8107 position of SEQIDNO:38 is replaced different Cas9 encoding sequences can obtain express the recombinant plasmid of Different Ca s9) and the recombinant plasmid U6-hCCR5sgRNA-EF1a-NLS-StCas9-NLS-2A-Puro-WPRE of co expression StCas9 and sgRNA (see Fig. 3, wherein a kind of sequence is as shown in SEQIDNO:39, different sgRNA encoding sequences is replaced in the 2857-2973 position of SEQIDNO:39 and 4172-8464 position is replaced different Cas9 encoding sequences and can be obtained the recombinant plasmid of expressing each sgRNA in embodiment 1 and Different Ca s9).
Embodiment 3
The present embodiment is used for the method using CRISPR-Cas9 system compiles CCR5 gene of the present invention is described.
(1) cell cultures and transfection
(1) by HEK293T cell (CBR-130005, purchased from Shanghai Sai Qi biotechnology company limited) at DMEM high glucose medium (FBS containing 10%, penicillin (penicillin, 100U/ml) and Streptomycin sulphate (streptomycin, 100 μ g/ml)) in cultivate;
(2) divide in six orifice plates before transfection, when cell density reaches 70%, carry out transfection;
(3) according to Lipofectamine3000 (Invitrogen, 11668-019) usage ratio, the U6-EF1a-NLS-StCas9-NLS-2A-Puro-WPRE of the U6-hCCR5sgRNA-EF1a-NLS-StCas9-NLS-2A-Puro-WPRE of 3 μ g or the U6-hCCR5sgRNA-EF1a-Neo-WPRE of 1.5 μ g and 1.5 μ g is used to combine the every porocyte of transfection, liquid is changed after 8h, accordingly, add tetracycline (Puromycin) and G418 (Geneticin) carries out medicine sieve, after 48h, collect cell.
(2) TA cloning and sequencing detects:
(1) by collect cell in lysate (10 μMs of Tris-HCl, 0.4MNaCl, 2 μMs of EDTA, 1%SDS), with 100 the cracking of μ g/ml Proteinase K digest after, be dissolved in 100 μ l deionized waters after phenol-chloroform extracting;
(2) primers F 2/R2 is used to carry out pcr amplification, use test kit (TIANGEN, DP080822) purifying PCR reclaims product, wherein, F2:TCAATGTGAAGCAAATCGCAGCC (SEQIDNO:40), R2:GATGGTGAAGATAAGCCTCACAG (SEQIDNO:41);
(3) PCR of acquisition is reclaimed product rTaq to carry out adding A reaction, system is:
37 DEG C of temperature bath 30min, get 1 μ l product and pMD19-T carrier (TAKARA, 3271) connects (mode of connection is see the specification sheets of pMD19-T carrier) and transforms Top10 competent cell (purchased from Bo Maide Bioisystech Co., Ltd).
(4) picking mono-clonal checks order, and finds according to sequencing result: target gene CCR5 has occurred deletion and insertion (indel) at the sequence place of sgRNA target, causes CCR5 that phase shift mutation occurs, gene knockout success.Wherein, be SEQIDNO:22 for the DNA sequence dna that recognition sequence is corresponding and the sequence of recruiting Cas9 albumen be monoclonal sequencing result after the sgRNA process of SEQIDNO:33 as shown in Figure 4 (wherein, arrow represents Csa9 cleavage site, and light-colored part is the deletion fragment to gene order in the autarcetic crowd of HIV; Random choose 50 clone, detect that altogether 9 clones carry the sudden change causing frameshit or premature termination, mutation rate is 9/50=18%).
As can be seen from the above embodiments, CRISPR-Cas9 system of the present invention can realize knocking out of CCR5 gene, and it is also higher to knock out efficiency.
Claims (10)
1. a target sequence for CRISPR-Cas9 system identification, is characterized in that, described target sequence is as shown in any one the n-th-30 in SEQIDNO:1-30 and n=1-12.
2. the sequence of a sgRNA, this sgRNA is: the sequence-3 of 5 '-recognition sequence-recruitment Cas9 albumen ', it is characterized in that, DNA sequence dna corresponding to described recognition sequence is as shown in any one the n-th-30 in SEQIDNO:1-30 and n=1-12.
3. sgRNA according to claim 2, wherein, recruits the sequence of Cas9 albumen as shown in SEQIDNO:31-34.
4. the sgRNA according to Claims 2 or 3, wherein, DNA sequence dna corresponding to described recognition sequence as shown in SEQIDNO:22 and the sequence of recruiting Cas9 albumen as shown in SEQIDNO:33.
5. the DNA molecular of the sgRNA of coding described in claim 2,3 or 4.
6. a CRISPR-Cas9 system, is characterized in that, this CRISPR-Cas9 system comprises:
Cas9 albumen and sgRNA, and/or
Carry the carrier of the encoding sequence of Cas9 albumen and the encoding sequence of sgRNA, the described encoding sequence of Cas9 albumen and the encoding sequence of sgRNA are positioned on identical or different carrier,
Wherein, described sgRNA for the sgRNA described in claim 2,3 or 4 and described Cas9 protein source from thermophilus streptococcus (Streptococcusthermophilus).
7. CRISPR-Cas9 system according to claim 6, wherein, described sgRNA is sgRNA according to claim 4.
8. edit a method for CCR5 gene, it is characterized in that, the method comprises: expressed by the CRISPR-Cas9 system introducing described in claim 6 or 7 in the cell of CCR5.
9. method according to claim 8, wherein, described cell derived, in primate, preferably derives from people.
10. the CRISPR-Cas9 system described in claim 6 or 7 is for the preparation of the application prevented and/or treated in the medicine of HIV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510676703.0A CN105400779A (en) | 2015-10-15 | 2015-10-15 | Target sequence, recognized by streptococcus thermophilus CRISPR-Cas9 system, of human CCR5 gene, sgRNA and application of CRISPR-Cas9 system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510676703.0A CN105400779A (en) | 2015-10-15 | 2015-10-15 | Target sequence, recognized by streptococcus thermophilus CRISPR-Cas9 system, of human CCR5 gene, sgRNA and application of CRISPR-Cas9 system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105400779A true CN105400779A (en) | 2016-03-16 |
Family
ID=55466540
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510676703.0A Pending CN105400779A (en) | 2015-10-15 | 2015-10-15 | Target sequence, recognized by streptococcus thermophilus CRISPR-Cas9 system, of human CCR5 gene, sgRNA and application of CRISPR-Cas9 system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105400779A (en) |
Cited By (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016183236A1 (en) * | 2015-05-11 | 2016-11-17 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating hiv infection and aids |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| CN106446600A (en) * | 2016-05-20 | 2017-02-22 | 同济大学 | CRISPR/Cas9-based sgRNA design method |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| CN108148875A (en) * | 2016-12-30 | 2018-06-12 | 广东赤萌医疗科技有限公司 | A kind of gene editing system, expression vector, gene editing kit and application thereof |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN109402116A (en) * | 2017-09-30 | 2019-03-01 | 广东赤萌医疗科技有限公司 | A kind of gRNA, gRNA composition and CRISPR-Cas9 system and application thereof for knocking out CCR5 gene |
| US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| CN109689866A (en) * | 2016-09-12 | 2019-04-26 | 切除生物治疗公司 | HIV clinical program |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103923911A (en) * | 2014-04-14 | 2014-07-16 | 黄行许 | Method for specifically knocking out human CCR5 (Chemokine Receptor 5) gene by CRISPR (clustered regularly interspaced short palindromic repeat-associated)-Cas 9 and SgRNA (single guide RNA) for specifically targeting CCR5 gene |
| WO2014165825A2 (en) * | 2013-04-04 | 2014-10-09 | President And Fellows Of Harvard College | Therapeutic uses of genome editing with crispr/cas systems |
| CN104694573A (en) * | 2015-03-26 | 2015-06-10 | 中国科学院武汉病毒研究所 | Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9 |
-
2015
- 2015-10-15 CN CN201510676703.0A patent/CN105400779A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014165825A2 (en) * | 2013-04-04 | 2014-10-09 | President And Fellows Of Harvard College | Therapeutic uses of genome editing with crispr/cas systems |
| CN103923911A (en) * | 2014-04-14 | 2014-07-16 | 黄行许 | Method for specifically knocking out human CCR5 (Chemokine Receptor 5) gene by CRISPR (clustered regularly interspaced short palindromic repeat-associated)-Cas 9 and SgRNA (single guide RNA) for specifically targeting CCR5 gene |
| CN104694573A (en) * | 2015-03-26 | 2015-06-10 | 中国科学院武汉病毒研究所 | Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9 |
Non-Patent Citations (2)
| Title |
|---|
| GERO HÜTTER ET AL.: "CCR5 Targeted Cell Therapy for HIV and Prevention of Viral Escape", 《VIRUSES》 * |
| SEUNG WOO CHO ET AL.: "Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease", 《NATURE BIOTECHNOLOGY》 * |
Cited By (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10227581B2 (en) | 2013-08-22 | 2019-03-12 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| WO2016183236A1 (en) * | 2015-05-11 | 2016-11-17 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating hiv infection and aids |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| CN106446600B (en) * | 2016-05-20 | 2019-10-18 | 同济大学 | A kind of design method of the sgRNA based on CRISPR/Cas9 |
| CN106446600A (en) * | 2016-05-20 | 2017-02-22 | 同济大学 | CRISPR/Cas9-based sgRNA design method |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| CN109689866A (en) * | 2016-09-12 | 2019-04-26 | 切除生物治疗公司 | HIV clinical program |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| CN108148875B (en) * | 2016-12-30 | 2021-12-28 | 广东赤萌医疗科技有限公司 | Gene editing system, expression vector, gene editing kit and application thereof |
| CN108148875A (en) * | 2016-12-30 | 2018-06-12 | 广东赤萌医疗科技有限公司 | A kind of gene editing system, expression vector, gene editing kit and application thereof |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| CN109402116A (en) * | 2017-09-30 | 2019-03-01 | 广东赤萌医疗科技有限公司 | A kind of gRNA, gRNA composition and CRISPR-Cas9 system and application thereof for knocking out CCR5 gene |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105400779A (en) | Target sequence, recognized by streptococcus thermophilus CRISPR-Cas9 system, of human CCR5 gene, sgRNA and application of CRISPR-Cas9 system | |
| CN105331607A (en) | Human CCR5 gene target sequence recognized by streptococcus thermophilus CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR-associated protein 9) system, sgRNA (single guide ribonucleic acid) and application | |
| CN105331609A (en) | Human CCR5 gene target sequence identified by neisseria meningitidis CRISPR-Cas9 system, sgRNA and application of target sequence and sgRNA | |
| CN105316337A (en) | Streptococcus thermophilus derived human CXCR3 gene target sequence recognizable by CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated 9) system and sgRNA (single guide ribonucleic acid) and application thereof | |
| CN105331608A (en) | Human CXCR4 gene target sequence identified by neisseria meningitidis CRISPR-Cas9 system, sgRNA and application of target sequence and sgRNA | |
| CN105316324A (en) | Streptococcus thermophilus derived human CXCR3 gene target sequence recognizable by CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated 9) system and sgRNA (single guide ribonucleic acid) and application thereof | |
| Xu et al. | Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing | |
| CN105518135B (en) | Method for specifically knocking out pig CMAH gene by CRISPR-Cas9 and sgRNA for specifically targeting CMAH gene | |
| CN105518139B (en) | Method for specifically knocking out pig FGL2 gene by CRISPR-Cas9 and sgRNA for specifically targeting FGL2 gene | |
| CN105518138B (en) | Method for specifically knocking out pig GFRA1 gene by CRISPR-Cas9 and sgRNA for specifically targeting GFRA1 gene | |
| CN103923911B (en) | The method of CRISPR-Cas9 specific knockdown CCR5 gene and the sgRNA for selectively targeted CCR5 gene | |
| CN105492608B (en) | Method for specifically knocking out pig PDX1 gene by CRISPR-Cas9 and sgRNA for specifically targeting PDX1 gene | |
| Grandi et al. | Contribution of type W human endogenous retroviruses to the human genome: characterization of HERV-W proviral insertions and processed pseudogenes | |
| CN105518137B (en) | Method for specifically knocking out pig SALL1 gene by CRISPR-Cas9 and sgRNA for specifically targeting SALL1 gene | |
| US20180340176A1 (en) | Crispr-cas sgrna library | |
| WO2016187904A1 (en) | Method for pig cmah gene specific knockout by means of crispr-cas9 and sgrna for specially targeting cmah gene | |
| WO2016197357A1 (en) | Method for specific knockout of swine sla-3 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-3 gene | |
| CN107418974A (en) | It is a kind of to sort the quick method for obtaining CRISPR/Cas9 gene knockout stable cell lines using monoclonal cell | |
| CN114438110B (en) | Adenine base editor without PAM limitation accurately and construction method thereof | |
| Karagyaur et al. | Practical recommendations for improving efficiency and accuracy of the CRISPR/Cas9 genome editing system | |
| CN106987560A (en) | The construction method of the stable strain of the cell HB gene knockouts of RK 13 | |
| CN112608948A (en) | Structure of two multifunctional gene editing tools and use method thereof | |
| CN102199616B (en) | HIV-1 phenotypic resistance detection vector and construction method thereof | |
| Han et al. | Base editing of the HBG promoter induces potent fetal hemoglobin expression with no detectable off-target mutations in human HSCs | |
| Hultquist et al. | Leveraging APOBEC3 proteins to alter the HIV mutation rate and combat AIDS |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20170714 Address after: 241000, A-15 building, Service Outsourcing Industrial Park, 717 South Zhongshan Road, Wuhu hi tech Development Zone, Anhui, China Applicant after: Zhang Jingfang Address before: 241003, A-15 building, Service Outsourcing Industrial Park, 717 South Zhongshan Road, Wuhu hi tech Development Zone, Anhui, China Applicant before: WUHU INNO BIOTECHNOLOGY CO., LTD. |
|
| TA01 | Transfer of patent application right | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160316 |
|
| RJ01 | Rejection of invention patent application after publication |