CN105200059A - SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof - Google Patents
SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof Download PDFInfo
- Publication number
- CN105200059A CN105200059A CN201510684316.1A CN201510684316A CN105200059A CN 105200059 A CN105200059 A CN 105200059A CN 201510684316 A CN201510684316 A CN 201510684316A CN 105200059 A CN105200059 A CN 105200059A
- Authority
- CN
- China
- Prior art keywords
- neural stem
- ucp2
- cell
- sirna
- mouse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an RNA interfering recombinant lentiviral vector for targeted inhibition of mouse neural stem cell UCP2 gene expression and construction thereof. The construction comprises the steps of firstly constructing a recombinant lentiviral vector pNL-EGFP/CMV/WPREdU3-sh mUCP2 aiming at a mouse neural stem cell UCP2 gene, and then co-transfecting a 293T cell by using the recombinant lentiviral vector together with a second-generation lentiviral packaging plasmid pCD/NL-BH*DDD and a membrane protein expression plasmid pLTR-G to obtain the packaged recombinant lentiviral vector. By transfecting a mouse primary neural stem cell by using the recombinant lentiviral vector obtained by the invention, the mouse neural stem cell UCP2 gene expression can be efficiently and specifically inhibited, and a good experimental foundation is laid for further functional researches on the mouse UCP2 gene.
Description
Technical field
The invention belongs to technical field of bioengineering, relate to a kind of RNAi recombinant slow virus expression vector for mouse neural stem cells UCP2 gene, and the structure of this expression vector.Recombinant slow virus of the present invention can be applicable in the pathogenetic research of neural tube defects.
Background technology
Neural tube defects (NeuralTubeDefects, NTDs) refers to central nervous system to be the congenital birth defect disease at principal pathogenetic position, and China's Shanxi Province's sickness rate is the highest, and statistics is up to 19.9 ‰.The phenomenon occurred frequently of NTDs, becomes global many countries and regions baby's lifelong disability and main causes of death.
The closing process of neurocele is subject to strict control and the environmental factors adjustment of gene.According to applicant's result of study in recent years and literature search, uncoupling protein-3 (uncouplingprotein2, UCP2) tie up to during census of population study with the pass of neural tube defects and drawn preliminary related conclusions, point out UCP2 gene to be the candidate gene of NTDs.Based on above-mentioned conclusion, applicant proves contacting between UCP2 and NTDs generation for utilizing mouse neural stem cells (closer to body early embryo neurocele cell), and explores the mechanism that it causes neural tube defects.Neural stem cell is a kind of cell utilizing ordinary method to be difficult to transfection, is therefore badly in need of utilizing a kind of higher method of transfection efficiency to meet the research of subsequent experimental.The foundation of above-mentioned technology platform, will provide a UCP2 gene functional research model, and play a significant role in follow-up mechanism research.But the siRNA at present for mouse neural stem cells UCP2 gene yet there are no research report.
RNA interference (RNAi) be utilize double-stranded RNA efficient, special blocking-up body in specific gene express, impel goal gene mRNA degrade and the process of producer silence.RNAi is at initial period, and the double-stranded RNA (dsRNA) that (electricity turn, virus infection etc.) is introduced in every way is progressively cut into the small molecules interference RNA fragment (siRNA) of 21 ~ 23nt by Dicer enzyme.SiRNA double-strand is combined with ribozyme mixture and forms RNA and induce silencing complex (RISC), siRNA sex change in RISC, positive-sense strand departs from, and antisense strand still combines on the compositions and guides RISC to be combined with homology target RNA, the degraded of induction said target mrna, thus blocking gene is expressed.SiRNA can also as a kind of special primer, and under the RNA polymerase effect that RNA relies on, take said target mrna as templated synthesis dsRNA molecule, the latter can enter above-mentioned circulation again.Newborn dsRNA synthetics and degradation repeatedly, constantly forms new siRNA, said target mrna is constantly reduced, and causes goal gene reticent, presents RNAi phenomenon.
SiRNA is the main effects thing of RNA interference.So far mammal cell RNA i technological line can be undertaken by two kinds of modes: the siRNA fragment 1) directly preparing 21 ~ 23nt, proceeds to mammalian cell by siRNA.2) the DNA expression vector of short hairpin RNA (shRNA) is proceeded to cell, express and produce shRNA, after Dicer cutting, obtain siRNA.The former is unsuitable for long research project, and the latter's sustainable long period, be conducive to follow-up experiment and carry out.
RNAi inhibition of gene expression acts on the restriction being subject to rotaring transfecting mode, transfection efficiency to a great extent, and the key of dealing with problems selects suitable vectors into cells.The lead-in mode of current siRNA has three kinds, 1) chemosynthesis siRNAs transfection interference, 2) shRNA siRNA expression vectors, 3) virus vector method.First two method efficiency of infection is low, especially for the cell of liposome interference effect difference, as neural stem cell.
Lentiviral vectors is the gene therapy vector grown up based on HIV-1, and it all has infection ability to somatoblast and Unseparated Cell, is widely used at present in the research of expressed rna i.Compared with plasmid vector and other virus vector, the RNA interference of lentivirus mediated has feature that is efficient, stable, high specificity.
Summary of the invention
The object of this invention is to provide the siRNA of a kind of targeted inhibition mouse neural stem cells UCP2 genetic expression.
Another object of the present invention is to provide the RNA interference recombinant lentivirus vector of a kind of targeted inhibition mouse neural stem cells UCP2 genetic expression, effectively to suppress the expression of UCP2 gene in mouse primary neural stem cell.
The siRNA of targeted inhibition mouse neural stem cells UCP2 of the present invention genetic expression has the nucleotide sequence shown in SeqIDNo.1, is designated as LVT818.
The present invention is according to the siRNA sequence of above-mentioned design, synthesize the DNA profiling strand of two coding shRNA, the DNA profiling strand of described coding shRNA is respectively the positive-sense strand with nucleotide sequence shown in SeqIDNo.2 and has the antisense strand of nucleotide sequence shown in SeqIDNo.3, by 5 ' glutinous end+19nt target sequence+loop-stem structure+target complement sequence sequence+translational termination site+3 ' glutinous end structure forms.
LVT818-1 (positive-sense strand):
5’-CcggCCTAATGGCTGCCTACCAAcTCAAGAGATTGGTAGGCAGCCATTAGGTTTTTTg-3’。
LVT818-2 (antisense strand):
5’-aattcaaaaaaCCTAATGGCTGCCTACCAATCTCTTGAgTTGGTAGGCAGCCATTAGG-3’。
Present invention also offers the RNA interference recombinant lentivirus vector comprising described shRNA, is the carrier pNL-EGFP/CMV/WPREdU3-shmUCP2 built after the multiple clone site of the s-generation lentiviral vectors pMagic4.1 of self inactivation connects described shRNA.
Concrete construction process is that the DNA single chain annealing of described coding shRNA is formed double chain DNA fragment, be connected in the multiple clone site of pMagic4.1 lentiviral vectors (Shanghai sbo-bio company), build recombined lentivirus vector pNL-EGFP/CMV/WPREdU3-shmUCP2, again with described recombined lentivirus vector associating s-generation slow virus packaging plasmid pCD/NL-BH*DDD and membranin expression plasmid pLTR-G (all purchased from Addgene) cotransfection 293T cell, obtain the recombined lentivirus vector of described packaging.
Wherein, in described construction process, be described DNA fragmentation end introduce with
ageIwith
ecoRIenzyme cuts the glutinous end that vector site is connected, and with
ageIwith
ecoRIenzyme cuts pMagic4.1 carrier, reclaims large fragment and is connected rear transformed competence colibacillus bacterium with described double chain DNA fragment, picking recombinant clone.
RNA interference recombinant lentivirus vector constructed by the present invention can be applied to and suppress in mouse neural stem cells UCP2 genetic expression, effectively to suppress UCP2 genetic expression in neural stem cell.
The invention provides a kind of can the siRNA sequence of specificity reticent mouse UCP2 gene, confirmed by in-vitro transfection experiment, this sequence effectively can suppress the UCP2 genetic expression in mouse primary neural stem cell.The present invention constructs further can the recombined lentivirus vector of the above-mentioned siRNA sequence of stably express, and in 293T cell, produce this recombinant slow virus with high infection rate.Tested by In vivo infection, the recombinant slow virus of this high efficiency stable expression UCP2 gene shRNA sequence obviously can suppress the UCP2 genetic expression of primary neural stem cell.Above-mentioned result of study is study the effect of UCP2 gene in neural tube defects generating process further to provide cell model.
The pMagic4.1 carrier that the present invention adopts contains U6 promotor, can have the tiny RNA of interference effect by continuous expression in host cell.Meanwhile, this plasmid can express the fluorescin EGFP driven by CMV promoter, transfection efficiency during convenient virus packaging, and the detection of efficiency of infection during host cells infected.The present invention adopt s-generation slow virus packaging plasmid pCD/NL-BH*DDD and membranin expression plasmid pLTR-G provide virus packaging needed for enzyme and albumen.By above carrier cotransfection 293T cell, the lentiviral vectors of self inactivation efficiently can be assembled.Use helper plasmid packaging virus without the need to infective adenovirus, and only use two plasmids just to improve the output of transfection efficiency and carrier.
Compare with the shRNA built based on transient expression vector with the siRNA of chemosynthesis, the shRNA carrier utilizing slow virus to build has the following advantages: the alternative transient expression vector that can increase on the one hand uses, to proceed to after target cell and can in Insertion Into Host Cell genome and stably express, can not cause inserting inactivation; On the other hand, this virus vector can be used for infecting Conventional transfection reagent and is difficult to the Unseparated Cell system of transfection as primary neural stem cell, and the genome of infected cell can be incorporated into after infection, carry out long stably express, and the transfection experiment of other traditional forms all cannot reach re-set target in earlier stage.Goal gene is integrated into that target cell gene group leader time-histories is expressed, immune response is little by the present invention, is a kind of more satisfactory for importing neural stem cell, for the interference carrier that UCP2 gene is reticent in neural stem cell.
The present invention utilizes inactivation lentiviral vectors to carry the DNA profiling of UCP2RNA interference fragment, and it is transcribed into shRNA in vivo, perfectly solves the targeting of RNA interference, security and expresses the problem of persistence.
Accompanying drawing explanation
Fig. 1 is the structural representation of pMagic4.1 lentiviral vectors.
Fig. 2 is the fluorescence microscopy result of virus infection neural stem cell.
Fig. 3 is the design sketch to the interference of mouse UCP2 gene mRNA expression after virus infection neural stem cell 72h.
Fig. 4 is the albumen Western-blot detected result to mouse UCP2 gene after virus infection neural stem cell 72h.
Fig. 5 scans the albumen Western-blot detected result gray-scale value of mouse UCP2 gene after virus infection neural stem cell 72h.
Embodiment
Below in conjunction with drawings and Examples, the present invention is described in further detail.
Embodiment 1: the siRNA sequence of design targeted inhibition mouse UCP2 genetic expression.
According to the mRNA sequence (NM_011671) of mouse neural stem cells UCP2 gene, design one group for the siRNA sequence of mUCP2 genetic expression and contrast siRNA sequence, and therefrom filter out the siRNA sequence of an interference effect the best, called after LVT818.
Concrete siRNA sequence is as follows, and wherein LVT818 is effective interference fragment group, and LVT4 is negative control group.
LVT818：5’-CCTAATGGCTGCCTACCAA-3’；GC52.6%。
LVT4：5’-TTCTCCGAACGTGTCACGT-3’；GC52.6%。
Embodiment 2: the design of oligonucleotide and synthesis.
The positive-sense strand of the siRNA sequence design and synthesis shRNA designed with above-described embodiment 1 and antisense strand.Loop structure in described shRNA has selected " cTCAAGAGA " and " TCTCTTGAg ", and adds at 5 ' end respectively
ageIwith
ecoRIrestriction enzyme site sticks end, and by Invitrogen company composition sequence, concrete shRNA sequence is as follows.
LVT818-1(positive-sense strand):
5’-
CcggCCTAATGGCTGCCTACCAAcTCAAGAGATTGGTAGGCAGCCATTAGG
TTTTTTg-3’。
LVT818-2(antisense strand):
5’-
aattcaaaaaaCCTAATGGCTGCCTACCAATCTCTTGAgTTGGTAGGCAGCCATTAGG-3’。
LVT4-1(positive-sense strand):
5’-CcggTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTg-3’。
LVT4-2(antisense strand):
5’-aattcaaaaaTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA-3’。
After above-mentioned synthetic shRNA sequence oligoannealingbuffer is dissolved into 20 μMs, complementary strand is respectively got 30 μ l and is mixed, and 95 DEG C of heating in water bath 5 minutes, are chilled to room temperature naturally, forms double-strand oligo fragment.Get annealed product described in 1 μ l for follow-up ligation, all the other-20 DEG C preservations.
Embodiment 3: the structure of the interference lentiviral vectors of targeted inhibition mouse UCP2 genetic expression.
The structural representation of lentiviral vectors pMagic4.1 is as Fig. 1.This carrier contains U6 promotor, can continue to start downstream gene expression in host cell, and continuous expression has the tiny RNA of interference effect.This carrier also containing CMV promoter, can drive the expression of fluorescin EGFP, facilitate the detection of transfection efficiency and efficiency of infection.
With
ageIwith
ecoRIdouble digestion lentiviral vectors pMagic4.1 makes its linearizing, after glue purification reclaims, to be connected to spend the night with T4 ligase enzyme with the annealed product 16 DEG C of embodiment 2, transformed competence colibacillus bacterium, picking recombinant clone, after transformation and selection, send Invitrogen company to carry out order-checking qualification.
(positive colony sequencing result)
ATAGAAAATATTTGACTGTAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA
CCGGCCTAATGGCTGCCTACCAACTCAAGAGATTGGTAGGCAGCCATTAGGTTTTTTG AATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGACGCCACCATGGTGAGCAAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACACGGGCAAGCTGCCCGTGCCCTGACCACCCTCGTGACCACCCTGACTACGGCGGTGCAGTGCTTCAGCCGCTACCCGACACATGAGCAGCACGACTTCTCAGTCGCATGCCCGAAGCTACGTCCAGGGAGCGCACCATCTTCTTCAGGACGACGGCCAACATACAGAACCGCGCTCAAGGTGAAGCTCCAAGGTCCCAACACCTGGGTGAACCGCCACTCTAGACGCTGAAGGGGGCACTCG。
(contrast cloning and sequencing result)
TCGGGCCGGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA
CCGGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTG AATTCGGATCCATTAGGCGGCCGCGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTACTGAACTGTCAGATCCCGCTAGCGCTACAGACGACACCATGATGAGCCATGGCGAGGAGCTGATCACCGGGGTGTGCCCATCCTGTCTGACTGACTGCTACTAAACTGTCGACCACGTTCAGCGTGTCGGTCAGGCACAGGCGATGCCCTCCTACCGCTATGCTGACCCTGAG。
Sequencing result display is identical with the sequence of design, and the correct clone of acquisition is the interference lentiviral vectors of the targeted inhibition mouse UCP2 genetic expression successfully constructed, called after pNL-EGFP/CMV/WPREdU3-shmUCP2.
Embodiment 4: the packaging of restructuring interference lentiviral vectors and titer determination.
High purity recombined lentivirus vector pNL-EGFP/CMV/WPREdU3-shmUCP2 prepared by Example 3, associating s-generation slow virus packaging plasmid pCD/NL-BH*DDD and membranin expression plasmid pLTR-G (all purchased from Addgene) cotransfection 293T cell, concrete operation step carries out according to Invitrogen company Lipofectamine2000 operation instruction.
Prepare the 293T cell of 2 T10cm culture dish in advance, substratum is DMEM+10%FBS, 1%Glutamax, 1% Pen .-Strep.Cell is assigned in 10 10cm culture dish, every bottle of cell density about 10
7individual.Check cell under second clear water surface, cytogamy degree is roughly 80 ~ 90%, is evenly distributed.
First 1 hour of transfection, takes out cell plate, removes original cell culture medium, add 9mlOpti-MEM substratum, send cell back to incubator.
Get two aseptic 15ml centrifuge tubes, 100 μ gpNL-EGFP/CMV/WPREdU3-shmUCP2 recombined lentivirus vectors are added in one, 65 μ gpCD/NL-BH*DDD slow virus packaging plasmids and 35 μ gpLTR-G membranin expression plasmids, with Opti-MEM substratum polishing to 5ml; Add 500 μ lTrans-EZ solution and 4.5mlOpti-MEM substratum in another, mix gently with electric pipettor.
Be added drop-wise to by Trans-EZ diluent in plasmid pipe, limit edged shakes even gently, incubated at room 20 minutes, makes DNA and Trans-EZ fully in conjunction with formation transfecting complexes.
Get 1 5ml transfer pipet, the DNA-Trans-EZ complex body obtained evenly is added drop-wise in Tissue Culture Plate, every plate 1ml.Rock culture plate back and forth, after mixing, be put back into 5% CO2gas incubator, after 6 hours, remove cell conditioned medium, be replaced by the DMEM perfect medium of 10ml.Transfection is observation of cell one day after, can see that the cell being greater than 95% is all with fluorescence.Cell is sent back to incubator and continue cultivation 2 days, collect all supernatants, 4 DEG C, centrifugal 10 minutes of 4000g, after removing cell debris, with 0.45 μM of frit supernatant liquor, obtain the recombined lentivirus vector of packaging.
After concentrated and purified for the recombined lentivirus vector of described packaging, obtain the lentiviral vectors concentrated solution of high titre, after packing ,-80 ° of C preserve for a long time, and get wherein one carry out viral biology titer determination.
Embodiment 5: target cell infects test and gene expression inhibition effect analysis.
1, mouse neural stem cells is infected with interference lentiviral vectors of recombinating.
1) choose mouse neural stem cells in good condition, the soft piping and druming of suction pipe makes cell dispersal, collected by centrifugation, with the resuspended rear cell counting of cell culture fluid, regulates cell concn to be 3 × 10
4~ 5 × 10
4individual/ml, joins in 24 orifice plates by 90 μ l/ holes, places in incubator and cultivates 24 hours.
2) the restructuring interference lentiviral vectors virus dilution liquid that MOI value is 40 is prepared, suck the nutrient solution in 96 orifice plates, every hole adds 100 μ l virus dilution liquid, sets up invalid interference fragment virus vector diluent and empty virus vector diluent, respectively as negative control and blank simultaneously.
3) after 24 hours, removal, containing virulent nutrient solution, adds new nutrient solution and continues to cultivate, and is expressed judge transfection efficiency after 72 hours under inverted fluorescence microscope by observation GFP.Fig. 2 is observed result under the microscope of virus infection neural stem cell fluorescence, and due to pMAGic4.1 carrier containing green fluorescence protein gene, can see that the cell of neural stem cell more than 90% is all by viral vector infection, efficiency of infection is higher.Collecting cell sample, gained cell is used for Real-timePCR (real-time quantitative PCR) and Westernblot (Western blot) and detects.
2, the RT-QPCR infecting rear neural stem cell detects.
Virus infection neural stem cell is after 72 hours, collect infected cell, conventional Trizol method extracts cell RNA, reverse transcription obtains cDNA, wherein M-MLV reversed transcriptive enzyme and dNTP are purchased from PROMEGA company, OligodT is purchased from the raw work in Shanghai, and concrete steps are carried out according to the M-MLV process specifications of Promega company.
1) 1.0 μ lOligodT (0.5 μ g/ μ l) and 2.0 μ g total serum IgE are joined in PCR tubule, supplement DEPC-H
2o to 9 μ l, centrifugal after mixing, 70 DEG C of temperature bath 10min.Be inserted into immediately afterwards in 0 DEG C of ice-water bath, make OligodT and template annealing.
2) according to the form below ratio, figures out required amount of reagent according to reaction tubes.M-MLV enzyme etc. is mixed on ice, obtains RT reaction solution.
3) in each reaction tubes, add 11 μ lRT reaction solutions, centrifugal after mixing.
4) complete after RT reaction carries out 1 hour at 42 DEG C, 70 DEG C of process 10min, make RT enzyme deactivation afterwards.
5) the RT reaction product cDNA obtained is for PCR.
6) Real-timePCR detects.
Using β-actin gene as internal reference, real-time fluorescence quantitative PCR is adopted to detect:
(1) primer sequence is as follows:
(2) by following proportional arrangement reaction system:
(3) setting program is that two-step approach Real-time is quantitative, 95 DEG C of denaturation 15S, afterwards each step 95 DEG C of sex change 5S, and 60 DEG C of annealing extend 30S, totally 45 circulations.Read light absorption value in the extension stage at every turn.
Result shows, designed specificity interference fragment can effectively suppress UCP2 genetic expression, infected mouse neural stem cells UCP2 expression amount is only 21% of contrast, namely jamming rate is 79%, concrete outcome is as shown in table 1 and Fig. 3, wherein pLVT4 is the groups of cells (negative control) of the empty virus control of transfection, and pLVT818 is the groups of cells of transfection pLVT818 target spot viral supernatants.
Fig. 3 recombinates after interference lentiviral vectors infecting mouse neural stem cell 72h, to the design sketch of mouse UCP2 gene mRNA expression interference.In figure, empty virus has organized as transfection the control group (blank) of empty virus, pLVT4 is the groups of cells (negative control) of transfection pLVT4 virus control, and pLVT818 is the groups of cells (positive group) of transfection pLVT818 target spot viral supernatants.Visible infected mouse neural stem cells UCP2 gene mRNA expression amount is only 21% of blank, and namely jamming rate is 79%.
3, Western-blot detects.
Antibody information in this experiment.
After virus transfection 72 hours, extract each experimental group total protein of cell, Westernblot detects, the gray level ratio display of UCP2 and β-actin, and inhibiting rate is 75%, illustrates that this plasmid suppresses the efficiency of UCP2 higher, as shown in Figure 4,5.
Fig. 4 is to UCP2 gene protein Western-blot detected result after virus infection neural stem cell 72h, in figure, 1 is empty virus control group, 2,3 is pLVT4 Viral interference negative control group, and 4 is pLVT818 Viral interference group, and visible 4th histone band of expression obviously reduces.
Fig. 5 scans the gray-scale value of mouse UCP2 gene protein Western-blot detected result after virus infection neural stem cell 72h.In figure, 1 is empty virus control group, and 2,3 is invalid interference group, and 4 is pLVT818 Viral interference group.Gray scale scanning shows, and expresses interference for the 4th group and reaches 75%.
Above-mentioned Fig. 3,4,5 all can illustrate, pLVT818 Viral interference group obviously can reduce the expression of UCP2 in neural stem cell, and pLVT818 is effective interference fragment.
SEQUENCELISTING
<110> Mountain Western Medicine S University
The siRNA of <120> targeted inhibition mouse UCP2 genetic expression and the structure of expression vector thereof
<160>3
<170>Patentinversion3.2
<210>1
<211>21
<212>RNA
<213> artificial sequence
The siRNA of <223> targeted inhibition mouse neural stem cells UCP2 genetic expression
<400>1
CCTAATGGCTGCCTACCAA19
<210>2
<211>58
<212>RNA
<213> artificial sequence
The positive-sense strand of the shRNA sequence of <223> targeted inhibition mouse neural stem cells UCP2 genetic expression
<400>2
CCGGCCTAATGGCTGCCTACCAACTCAAGAGATTGGTAGGCAGCCATTAGGTTTTTTG58
<210>3
<211>58
<212>RNA
<213> artificial sequence
The antisense strand of the shRNA sequence of <223> targeted inhibition mouse neural stem cells UCP2 genetic expression
<400>3
AATTCAAAAAACCTAATGGCTGCCTACCAATCTCTTGAGTTGGTAGGCAGCCATTAGG58
Claims (7)
1. a siRNA for targeted inhibition mouse neural stem cells UCP2 genetic expression, described siRNA has the nucleotide sequence shown in SeqIDNo.1.
2. encode a DNA of shRNA, and described shRNA is the shRNA of positive-sense strand containing siRNA described in claim 1 or antisense strand.
3. a RNA interference recombinant lentivirus vector for targeted inhibition mouse neural stem cells UCP2 genetic expression is the carrier pNL-EGFP/CMV/WPREdU3-shmUCP2 built after the multiple clone site of the s-generation lentiviral vectors pMagic4.1 of self inactivation connects shRNA described in claim 2.
4. the construction process of RNA interference recombinant lentivirus vector described in claim 3, that the DNA single chain annealing of described coding shRNA is formed double chain DNA fragment, be connected in the multiple clone site of pMagic4.1 carrier, build recombined lentivirus vector pNL-EGFP/CMV/WPREdU3-shmUCP2, again with described recombined lentivirus vector associating s-generation slow virus packaging plasmid pCD/NL-BH*DDD and membranin expression plasmid pLTR-G cotransfection 293T cell, obtain the recombined lentivirus vector of described packaging.
5. the construction process of RNA interference recombinant lentivirus vector according to claim 4, be described DNA fragmentation end introduce with
ageIwith
ecoRIenzyme cuts the glutinous end that vector site is connected.
6. the construction process of RNA interference recombinant lentivirus vector according to claim 4, be with
ageIwith
ecoRIenzyme cuts pMagic4.1 carrier, reclaims large fragment and is connected rear transformed competence colibacillus bacterium with described double chain DNA fragment, picking recombinant clone.
7. RNA interference recombinant lentivirus vector described in claim 3 is suppressing the application in mouse neural stem cells UCP2 genetic expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510684316.1A CN105200059B (en) | 2015-10-22 | 2015-10-22 | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510684316.1A CN105200059B (en) | 2015-10-22 | 2015-10-22 | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105200059A true CN105200059A (en) | 2015-12-30 |
| CN105200059B CN105200059B (en) | 2018-07-17 |
Family
ID=54948021
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510684316.1A Expired - Fee Related CN105200059B (en) | 2015-10-22 | 2015-10-22 | The siRNA of targeted inhibition mouse UCP2 gene expressions and its structure of expression vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105200059B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055389A (en) * | 2018-08-08 | 2018-12-21 | 北京诺思兰德生物技术股份有限公司 | The recombinant plasmid of carrier's glucagon-like peptide 1 (7-36) gene |
| CN110951733A (en) * | 2019-11-27 | 2020-04-03 | 山西医科大学 | siRNA for targeted inhibition of esophageal cancer EGFL6 gene expression, constructed expression vector and application |
| CN113652428A (en) * | 2021-08-24 | 2021-11-16 | 南通大学 | Application of nuclear membrane protein knock-down in stem cell transplantation |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050026164A1 (en) * | 2002-11-20 | 2005-02-03 | Affymetrix, Inc. | Methods of genetic analysis of mouse |
-
2015
- 2015-10-22 CN CN201510684316.1A patent/CN105200059B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050026164A1 (en) * | 2002-11-20 | 2005-02-03 | Affymetrix, Inc. | Methods of genetic analysis of mouse |
Non-Patent Citations (1)
| Title |
|---|
| 黄伟: "人乳腺癌抗雌激素药物耐药蛋白1基因siRNA慢病毒载体的构建与鉴定", 《中国生物制品学杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055389A (en) * | 2018-08-08 | 2018-12-21 | 北京诺思兰德生物技术股份有限公司 | The recombinant plasmid of carrier's glucagon-like peptide 1 (7-36) gene |
| CN109055389B (en) * | 2018-08-08 | 2021-07-09 | 北京诺思兰德生物技术股份有限公司 | Recombinant plasmid carrying human glucagon-like peptide 1(7-36) gene |
| CN110951733A (en) * | 2019-11-27 | 2020-04-03 | 山西医科大学 | siRNA for targeted inhibition of esophageal cancer EGFL6 gene expression, constructed expression vector and application |
| CN113652428A (en) * | 2021-08-24 | 2021-11-16 | 南通大学 | Application of nuclear membrane protein knock-down in stem cell transplantation |
| CN113652428B (en) * | 2021-08-24 | 2023-09-22 | 南通大学 | Application of nuclear membrane protein knockout in stem cell transplantation |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105200059B (en) | 2018-07-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6903305B2 (en) | Human-derived interleukin 6 siRNA, recombinant expression CAR-T vector and its construction method and use | |
| CN101591653A (en) | The liver cell of low-expression CYP 7 A 1 and construction process thereof | |
| CN105200059A (en) | SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof | |
| CN107523569A (en) | The purposes and its related drugs of PDCD1 genes | |
| CN114058619A (en) | Construction of RIPLET knockout cell line and application of RIPLET knockout cell line as production cell line of picornaviridae virus vaccine | |
| CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
| CN111235150B (en) | shRNA for inhibiting replication of African swine fever virus and application thereof | |
| WO2021121321A1 (en) | Fusion protein that improves gene editing efficiency and application thereof | |
| CN101787374A (en) | Recombinant adenovirus vector capable of specifically proliferating in tumor cells based on micro RNA regulation and control, and construction method and application thereof | |
| CN102965372A (en) | SiRNA interfering GDF9 gene expression and application thereof | |
| CN103952406B (en) | The siRNA of targeting STAT3 gene of suppression people's malignant glioma propagation and expression vector thereof and application | |
| CN110951733A (en) | siRNA for targeted inhibition of esophageal cancer EGFL6 gene expression, constructed expression vector and application | |
| CN102643860A (en) | Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN102965371A (en) | SiRNA inhibiting BMP15 gene expression and application thereof | |
| CN103205461B (en) | SiRNA expression vector and application thereof | |
| CN102604994B (en) | Recombinant lentivirus-based vector for implementing RNA (Ribose Nucleic Acid) interference aiming at FLG (filaggrin) gene and preparation of recombinant lentivirus-based vector | |
| CN104745635B (en) | A kind of method of OASL genes in silence DF-1 cell lines | |
| CN106957845A (en) | Suppress siRNA and its application of mouse gonadotropin inhibiting hormone (GN-IH) gene expression | |
| CN101624596B (en) | External guide sequence of target c-myc cancer gene | |
| CN101979520A (en) | Core-binding factor alpha1 gene recombinant virus for specifically promoting cartilage differentiation, preparation method and application thereof | |
| Zhu et al. | Construction of a lentiviral vector encoding heme oxygenase 1 and its introduction into mouse adipose tissue-derived stem cells | |
| CN116622652A (en) | Lentivirus for neuroblastoma gene therapy and preparation method and application thereof | |
| CN101463351A (en) | External leader sequence for guiding RNase P ribozyme and use thereof in anti-HCMV medicament preparation | |
| CN105754949B (en) | Method for promoting osteogenic differentiation and inhibiting adipogenic differentiation of adipose-derived stem cells by adopting Sema3A gene | |
| CN103417989B (en) | People miR-26b is preparing the application improved in insulin sensitivity medicine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20151230 Assignee: Shanxi Medical University Asset Management Co., Ltd Assignor: Shanxi Medial University Contract record no.: X2019980000611 Denomination of invention: SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof Granted publication date: 20180717 License type: Common License Record date: 20191115 |
|
| EC01 | Cancellation of recordation of patent licensing contract | ||
| EC01 | Cancellation of recordation of patent licensing contract |
Assignee: Shanxi Medical University Asset Management Co.,Ltd. Assignor: SHANXI MEDICAL University Contract record no.: X2019980000611 Date of cancellation: 20210422 |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180717 Termination date: 20201022 |