CN105039320B - A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell - Google Patents
A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell Download PDFInfo
- Publication number
- CN105039320B CN105039320B CN201510382699.7A CN201510382699A CN105039320B CN 105039320 B CN105039320 B CN 105039320B CN 201510382699 A CN201510382699 A CN 201510382699A CN 105039320 B CN105039320 B CN 105039320B
- Authority
- CN
- China
- Prior art keywords
- cells
- trail
- rna
- mir
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present invention relates to biological technical field, more particularly to a kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell.The RNA can effectively suppress Hsa miR 222 expression, killing activities of the enhancing TRAIL to tumour.Recombinant virus provided by the invention has biological activity, promises to be the viral candidates of therapy of tumor.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of RNA and application thereof, the composition comprising the RNA, restructuring
Expression vector and host cell.
Background technology
Tumour is one of number one killer for threatening human health, and it is swollen to treat not have highly effective means at present
Knurl.Traditional treatment method, such as chemotherapy, radiotherapy, operation and targeted drug, although initially can successfully control tumour, often
A series of other behaviors can be produced by inducing host cell in turn again, and then ultimately result in the recurrence, diffusion and transfer of tumour.
Gene therapy due to its is with strong points, targeting is good, effectively and the advantages that have no toxic side effect substantially, these years increasingly by
To the favor and concern of people.TRAIL(tumor necrosis factor-related apoptosis inducing
Ligand TNF (TNF) family member) is belonged to, because it can optionally kill tumour cell, but to absolutely mostly
Number normal structure does not have toxicity and turns into one of study hotspot of gene therapy for cancer.Research shows that the restructuring of vein multiple injection can
Dissolubility TRAIL can induce apoptosis of tumor cells, suppress the growth and formation of tumour, while extending the life span of experimental animal
But the toxicity that can be monitored is not caused to occur.Although it can be with induced various types of tumors Apoptosis, different tumour cells pair
TRAIL sensitiveness is different, therefore enhancing resisting cell has good potential applicability in clinical practice to TRAIL sensitiveness.
Current study show that the mechanism of TRAIL resistance is different in different cells, there is such as false receptor occupancy, thin
The hypothesis such as the high expression of intracellular portion anti-apoptotic molecule, but the checking of some hypothesis is difficult, and do not have highly effective side at present
Method improves TRAIL resistance problem.
The content of the invention
In view of this, the present invention provides a kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and place
Chief cell.The RNA can effectively suppress miR-222 expression, killing activities of the enhancing TRAIL to A549.The present invention provides
Recombinant virus have biological activity, promise to be the viral candidates of therapy of tumor.
In order to realize foregoing invention purpose, the present invention provides following technical scheme：
The invention provides a kind of RNA, it is characterised in that it has：
(I), the nucleotide sequence as shown in SEQ ID No.1；Or
(II), the complementary series of the nucleotide sequence as shown in SEQ ID No.1；Or
(III), with the nucleotide sequence coded same protein of (I) or (II), but because of the degeneracy of genetic code and with
(I) or (II) the different sequence of nucleotide sequence；Or
(IV), with the sequence of (I) or (II) or (III) described sequence at least 70% homology.
It is used for the purposes for suppressing Hsa-miR-222 present invention also offers the RNA.
Present invention also offers a kind of composition, including TRAIL95-281With described RNA.
Present invention also offers the preparation method of the composition：
Step 1：TRAIL will be encoded95-281It is connected to described RNA nucleotide sequence in carrier, construction expression carries
Body；
Step 2：The expression vector is converted into host cell, expression, expression product is collected, produces.
Present invention also offers a kind of recombinant expression carrier, including：
(1) TRAIL is encoded95-281Nucleotide sequence；And/or
(2) RNA of the present invention nucleotide sequence is encoded.
In some specific embodiments of the present invention, the construction method of the recombinant expression carrier, it will encode
TRAIL95-281It is connected to the nucleotide sequence of the RNA in carrier, construction of expression vector.
In some specific embodiments of the present invention, the carrier in the construction method of the recombinant expression carrier is plasmid
Or virus.
In some specific embodiments of the present invention, virus is related for gland in the construction method of the recombinant expression carrier
Virus.
Present invention also offers a kind of host cell, including described recombinant expression carrier.
The structure of the recombinant expression carrier is pAM-CAG-pL-INS-TRAIL95-281-polyA-U6-miR-222-
TuD-WPRE-BGH polyA AAV recombinant expression carriers, abbreviation AAV-TRAIL-miR-222-TuD.
The recombinant expression carrier includes:pAM(the abbreviation of the plasmid of anti-
ampcilin construction)、ITR(adeno-associated virus 2 inverted terminal repeat
sequence)、CAG(cytomegalovirus immediated-early enhancer/chickenβ-actin
hybrid)、INS(human Insulin)secretion signal peptide、pL(poly-linker)、TRAIL95-281
(coding TRAIL the 95th to 281 amino acids), polyA (polyadenylic acid), U6, miR-222-TuD, WPRE (Woodchuck
Heptitis Virus Posttranscriptional Regulatory Element)、BGH(Bos taurus growth
Hormone), polyA (polyadenylic acid) and ITR (the inverted terminal of adeno-associated virus 2
repeat sequence)。
Wherein, ITR sequence (Patent WO0220748) sequence is as shown in SEQ ID No.5；CAG
Sequence sequence is as shown in SEQ ID No.6；INS secretion signal peptide sequence(Genbank
Accession no.NM 000207) sequence as shown in SEQ ID No.7；WPRE sepuence(Genbank
Accession no.J04514) sequence as shown in SEQ ID No.8；BGH(Bos taurus growth hormone)pA
Sequence sequence is as shown in SEQ ID No.9；TRAIL95-281 amino acid sequence(Patent
ZL03138357.2 sequence) is as shown in SEQ ID No.10.
In some specific embodiments of the present invention, the host cell is cell line, and the cell line is selected from HeLa
Cell, A549 cells, Bel-7402 cells, CNE-2Z cells, EC109 cells, MGC-803 cells, SW1990 cells, DU145
Cell, U251 cells, A875 cells, HCT116 cells, MCF7 cells or SK-OV-3 cells.
Present invention also offers the composition, the recombinant expression carrier, the host cell to prepare treatment tumour
Medicine in application.
In some specific embodiments of the present invention, the tumour is primary, Secondary cases or metastatic tumour.
In some specific embodiments of the present invention, it is straight that the tumour includes lung cancer, liver cancer, nasopharyngeal carcinoma, the cancer of the esophagus, knot
Intestinal cancer, stomach cancer, cancer of pancreas, prostate cancer, glioma, melanoma, breast cancer, cervical carcinoma or oophoroma.
It is the experiment proves that thin in HeLa cells, A549 cells, Bel-7402 cells, CNE-2Z cells, EC109
Born of the same parents, MGC-803 cells, SW1990 cells, DU145 cells, U251 cells, A875 cells, HCT116 cells, MCF7 cells, SK-
Has-miR-222 mimics has been transfected in OV-3 cells can strengthen resistance of the cell to TRAIL later, and transfect Has-
MiR-222 inhibitor can strengthen sensitiveness (Fig. 1) of the cell to TRAIL later.The miR-222 specificity of engineer
Inhibitor TuD (Fig. 2A), and polyA is added to terminate II class promoter CAG on the basis of original pAM/CAG-TRAIL carriers,
A new Group III promoter U6 is inserted into express miR-222-TuD (Fig. 2 B).The co-expression plasmid built is transferred to
Verify that each inhibitor is acted on miR-222 targeted inhibition into 293T cells, miR-222-TuD can effectively suppress miR-
222 expression (Fig. 2 C).Each co-expression plasmid is transferred in Hela, withered with the double dye cells of Annexin V-FITC/PI
Die detection kit flow cytometer detection Apoptosis, it can be seen that miR-222-TuD can strengthen killing activities of the TRAIL to Hela
(Fig. 2 D).
The packaging of the recombinant co-expression carrier is carried out using helper virus defective packages system, virus uses Iodixanol density
Gradient ultra centrifugation purifies, and is concentrated by ultrafiltration, and Real-time PCR determine its final titre.Same method prepares and packager code
The AAV recombinant viruses (AAV-EGFP) of green fluorescent protein (EGFP) are used as negative control, only encode the AAV- of trail protein
TRAIL is as positive control.After the cell of AAV-EGFP virus infections 293 and A549 cells 72h, the luciferase expression of cell is observed
Situation, it can be seen that cell is successfully infected and expresses green fluorescent protein (Fig. 3 A).By AAV-EGFP, AAV-TRAIL,
AAV-TRAIL+miR-222-TuD infects 293 cells respectively, detects by AAV-TRAIL and AAV-TRAIL+miR-222-
After TuD infects, TRAIL expression is significantly raised (Fig. 3 B), and after being infected by AAV-TRAIL+miR-222-TuD, miR-
222 expression suppresses (Fig. 3 C) by obvious.In A549 nude mouses in transplantable tumor experiment, after AAV-TRAIL is treated, tumour life
Length is suppressed, but can see more obvious growth inhibition (Fig. 4) in AAV-TRAIL+miR-222-TuD therapeutic alliance groups,
And miR-222-TuD is to promote its target gene PTEN to show play a role (Fig. 5) indirectly by targeted inhibition miR-222
Obtained recombinant virus has biological activity, promises to be the viral candidates of therapy of tumor.
Brief description of the drawings
In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
There is the required accompanying drawing used in technology description to be briefly described.
Fig. 1 shows influences of the miR-222 to TRAIL resistance；After the mimics and inhibitors that have transfected miR-222,
Again human cervical carcinoma cell Hela, human A549 cell lines, Human hepatoma cell line Bel-7402, people's nasopharynx are stimulated with trail protein
Cancer cell CNE-2Z, human esophagus cancer cell EC109, gastric carcinoma cells MGC-803, human pancreatic cancer cell SW1990, human prostate
Cancer cell DU145, human glioma cell U251, human melanoma cell A875, human breast cancer cell MCF7, people's Colon and rectum
The lethal effect of cancer cell HCT116, Proliferation of Human Ovarian Cell SK-OV-3 to cell；
Fig. 2 shows structure and the functional verification of pAM/CAG-TRAIL-U6-miR-222-TuD co-expression plasmids, wherein Fig. 2
(A)：MiR-222-TuD sequences Design；Fig. 2 (B)：PAM/CAG-TRAIL-polyA-U6-miR-222-TuD coexpression vectors
Expression structure；Fig. 2 (C)：Influence after co-expression plasmid transfection 293T cells to miR-222 expressions；Fig. 2 (D)：Streaming
Influence after detection co-expression plasmid transfection Hela cells to Apoptosis；
Fig. 3 shows the biological activity of recombinant virus；Fig. 3 (A) shows that AAV-EGFP can successfully infect 293 cells and A549 is thin
Born of the same parents simultaneously make its expressing green fluorescent protein；Fig. 3 (B) AAV-TRAIL and AAV-TRAIL+miR-222-TuD are infecting 293 cells
After can successfully be overexpressed TRAIL；Fig. 3 (C) AAV-TRAIL+miR-222-TuD can effectively strike low miR-222 expression water
It is flat；
Fig. 4 shows A549 tumor-bearing mices after restructuring AAV-TRAIL and AAV-TRAIL+miR-222-TuD processing, subcutaneous tumors
Growth be suppressed, and AAV-TRAIL+miR-222-TuD can promote AAV-TRAIL using effect, hence it is evident that suppress swollen
Knurl grows；The suppressed morphological observation of Fig. 4 (A) subcutaneous tumors；The dynamic observation of Fig. 4 (B) administration posterior tuberosity Volume Changes；Locate Fig. 4
(C) difference of knurl weight when dead；
Fig. 5 shows that miR-222-TuD plays a role result by adjusting target gene PTEN change level：Fig. 5 (A) shows PTEN
It is miR-222 target genes；Fig. 5 (B) shows that miR-222-TuD can raise PTEN expressions in vivo.
Embodiment
The invention discloses a kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell,
Those skilled in the art can use for reference present disclosure, be suitably modified technological parameter realization.In particular, it is all similar
Replacement and change it is apparent to those skilled in the art, they are considered as being included in the present invention.The present invention
Method and application be described by preferred embodiment, related personnel can substantially not depart from present invention, essence
To method described herein and apply in god and scope and is modified or suitably changes with combining, to realize and using skill of the present invention
Art.
First purpose of the present invention is in the influence in offer Hsa-miR-222 in different cell lines to TRAIL resistance.
The different cell lines be HeLa cells, A549 cells, Bel-7402 cells, CNE-2Z cells, EC109 cells,
MGC-803 cells, SW1990 cells, DU145 cells, U251 cells, A875 cells, HCT116 cells, MCF7 cells, SK-OV-
3 cells.
Second object of the present invention is to provide a kind of carrier, the vector expression TRAIL95-281(coding TRAIL the
95 to 281 amino acids) albumen.
Third object of the present invention is to design Hsa-miR-222 specific inhibitor TuD, its sequence such as SEQ ID
Shown in NO.1.
The specific inhibitor TuD can mediate miRNA degraded, and it is built into the DNA sequence dna such as SEQ in carrier
Shown in ID NO.2.
Fourth object of the present invention is the soluble human TRAIL for providing a kind of secreting type95-281With miR-222 suppression
The preparation method of preparation TuD coexpression vectors, the structure of this expression vector is pAM-CAG-pL-INS-TRAIL95-281-polyA-
U6-miR-222-TuD-WPRE-BGH polyA AAV recombinant expression carriers, abbreviation AAV-TRAIL-miR-222-TuD.
The carrier includes:pAM(the abbreviation of the plasmid of anti-ampcilin
construction)、ITR(adeno-associated virus 2 inverted terminal repeat
sequence)、CAG(cytomegalovirus immediated-early enhancer/chickenβ-actin
hybrid)、INS(human Insulin)secretion signal peptide、pL(poly-linker)、TRAIL95-281
(coding TRAIL the 95th to 281 amino acids), polyA (polyadenylic acid), U6, miR-222-TuD, WPRE (Woodchuck
Heptitis Virus Posttranscriptional Regulatory Element)、BGH(Bos taurus growth
Hormone), polyA (polyadenylic acid) and ITR (the inverted terminal of adeno-associated virus 2
repeat sequence)。
Wherein, ITR sequence (Patent WO0220748) sequence is as shown in SEQ ID No.5；CAG
Sequence sequence is as shown in SEQ ID No.6；INS secretion signal peptide sequence(Genbank
Accession no.NM 000207) sequence as shown in SEQ ID No.7；WPRE sepuence(Genbank
Accession no.J04514) sequence as shown in SEQ ID No.8；BGH(Bos taurus growth hormone)pA
Sequence sequence is as shown in SEQ ID No.9；TRAIL95-281 amino acid sequence(Patent
ZL03138357.2 sequence) is as shown in SEQ ID No.10.
The carrier is plasmid or virus, and the virus is adeno-associated virus.
The 5th purpose of the present invention is to provide a kind of composition, including TRAIL95-281With suppression Hsa-miR-222's
RNA。
In the composition, the RNA of the suppression Hsa-miR-222 is TuD, and its sequence is as shown in SEQ ID NO.1.
The 6th purpose of the present invention be to provide the carrier of any of the above-described, composition or cell line in treating cancer or
Purposes in tumour.
The cancer or tumour are primary, Secondary cases or metastatic tumour.
In described purposes, the tumour includes cervical carcinoma, lung cancer, liver cancer, nasopharyngeal carcinoma, the cancer of the esophagus, colorectal cancer, stomach
Cancer, cancer of pancreas, prostate cancer, glioma, melanoma, breast cancer, oophoroma.
In the present invention, using the modern biology such as genetic engineering technology and method, there is provided encoding human TRAIL95-281With
MiR-222-TuD recombinates preparation, packaging and its application of AAV coexpression vectors and virus.
Composition, recombinant expression carrier and host cell the invention provides RNA and application thereof, comprising the RNA.Its
In, unless otherwise specified, the various reaction reagents being related in embodiment can be commercially available by commercial channel；Such as without special
Illustrate, the concrete operations being related in embodiment referring to《The Molecular Cloning:A Laboratory guide third edition》.
With reference to embodiment, the present invention is expanded on further：
Influences of the miR-222 of embodiment 1 to TRAIL inducing apoptosis of tumour cell activity is detected using CCK-8 methods
2 × 10 are taken respectively5HeLa cells, A549 cells, Bel-7402 cells, CNE-2Z cells, EC109 cells,
MGC-803 cells, SW1990 cells, DU145 cells, U251 cells, A875 cells, HCT116 cells, MCF7 cells, SK-OV-
3 cells (volume 2ml) are inoculated into 6 orifice plates, transfect respectively by Invitrogen companies it is artificial synthesized analogies control,
After miR-222 analogies, inhibitor control, miR-222 inhibitors 4s 8h, cell dissociation is got off and is inoculated in 96 orifice plates, often
8000, hole cell, trail protein is added to final concentration 100ng/ml, 24h is stimulated, removes culture medium, 110 μ l are added per hole and are contained
CCK-8 culture medium (100 μ l culture mediums add 10 μ l CCK-8), 37 DEG C of incubations, per every other hour in MD/SPECTRA MAX
Absorbance value at reading 450nm on 340 spectrophotometers, calculating cell survival rate (cell survival rate=experimental group absorbance value/
Control group absorbance value × 100%).Five sample wells of each group of setting, every group of experiment is in triplicate.
MiR-222, which is overexpressed, can cause cell to TRAIL resistance, be specifically shown in Fig. 1 (A)~Fig. 1 (C).
After the analogies and inhibitor that have transfected miR-222, then with trail protein stimulate human cervical carcinoma cell Hela,
Human A549 cell lines, Human hepatoma cell line Bel-7402, human nasopharyngeal carcinoma cells CNE-2 Z, human esophagus cancer cell EC109, people's stomach
Cancer cell MGC-803, human pancreatic cancer cell SW1990, Human Prostate Cancer Cells DU145, human glioma cell U251, people
Melanoma cells A875, human breast cancer cell MCF7, Human colorectal cancer cells HCT116, SK-OV-3 pairs of Proliferation of Human Ovarian Cell
The lethal effect of cell.
The structure of the pAM/CAG-TRAIL-polyA-U6-miR-222-TuD co-expression plasmids of embodiment 2
U6 promoters (as shown in SEQ ID No.3) are expanded with PCR and add a with Taq enzyme come after, gel extraction, are connected into
Into carrier T.Artificial synthesized polyA tailer sequences GGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGG simultaneously
TTTTTT (as shown in SEQ ID No.4), annealing, carrier T (the EcoRV digestions position of U6 promoters has been connected into EcoRV single endonuclease digestions
Point is in the upstream of U6 promoters), polyA sequences are connected into a manner of flush end in carrier T, obtain the series connection of polyA and U6 promoters
Sequence.Artificial synthesized miR-222-TuD sequences, and end is sticked plus SpeI restriction enzyme sites in upstream, added in downstream
HindIII restriction enzyme sites and SacI restriction enzyme sites stick end, while polyA and U6 T loads are connected with SpeI and SacI double digestions
Body (SpeI and SacI are in U6 downstream), miR-222-TuD sequences are connected into wherein, obtain polyA-U6-miR-222-TuD strings
The sequence of connection.Since so, there are HindIII restriction enzyme sites existing for a script in the carrier T of polyA upstreams, and
MiR-222-TuD downstream, there are the HindIII restriction enzyme sites of our oneself introducing, with HindIII single endonuclease digestions restructuring T
Carrier, cut glue purification and obtain our aim sequence, while the pre-existing pAM/CAG-TRAIL of HindIII single endonuclease digestions
RAAV2 package carriers (HindIII restriction enzyme sites are in TRAIL downstream), two parts are linked together with T4 ligases, be sequenced
Identify forward and reverse, obtain purpose recombinant plasmid.Empirical tests function, the therapeutic effect of TRAIL and miR-222-TuD use in conjunction is very
Well, thus using helper virus defective packages system the packaging of restructuring AAV-TRAIL-miR-222-TuD carriers, virus are carried out
The purifying of Iodixanol density gradient ultracentrifugation is respectively adopted, is concentrated by ultrafiltration, Real-time PCR determine its final titre.
The structure and functional verification result of pAM/CAG-TRAIL-U6-miR-222-TuD co-expression plasmids：
Fig. 2 (A) shows miR-222-TuD sequences Design；
Fig. 2 (B) shows the expression structure of pAM/CAG-TRAIL-polyA-U6-miR-222-TuD coexpression vectors；
Fig. 2 (C) shows influence to miR-222 expressions after co-expression plasmid transfection 293T cells；
Fig. 2 (D) shows influence to Apoptosis after flow cytometer detection co-expression plasmid transfection Hela cells.
Embodiment 3 recombinates AAV-TRAIL+miR-222-TuD and its Determination of biological activity
Human embryonic kidney cells HEK293T is in DMEM complete mediums (hyclone of DMEM culture mediums addition 10%, 100U/
Ml penicillin and 100 μ g/ml streptomysins) in culture more than 6h, 1 × PBS washing after add 2 × 109Prepared by Gps embodiments 2
(culture medium is that DMEM is not added with hyclone to recombinant virus, and dosage is 1 × 104Gps/ cells), it is complete that DMEM is added after 2-4 hours
Full culture medium continues to cultivate.In recombinant virus AAV-EGFP, AAV-TRAIL, the AAV-TRAIL+miR-222-TuD of transduceing respectively
Afterwards, human embryonic kidney cells HEK293T is cracked, RNA is extracted with TRIzol, carries out qPCR detections.
Recombinate the biological activity testing result of AAV viruses：
Wherein AAV-EGFP can successfully infect 293 cells and A549 cells and make its expressing green fluorescent protein, see Fig. 3
(A)；
AAV-TRAIL and AAV-TRAIL+miR-222-TuD can successfully be overexpressed TRAIL after 293 cells are infected, and see
Fig. 3 (B)；
AAV-TRAIL+miR-222-TuD can effectively strike low miR-222 expression, see Fig. 3 (C).
The Western Blot of embodiment 4
AAV-EGFP, AAV-TRAIL, AAV-TRAIL+miR-222-TuD tumor tissues or cell warp have been injected respectively
Lysate (P-40 containing 1%Nonidet, 0.35mg/ml PMSF, 9.5 μ g/ml leupeptin and 13.7 μ g/ml
Pepstatin A 1 × PBS) cracking after, 12000rpm centrifugation go to precipitate, supernatant is through BCA protein assay kits
PAGE gel electrophoresis is carried out after (Pierce Chemical Company) measure protein concentration, is transferred to after pvdf membrane 4 DEG C
Closing overnight, through primary antibody (anti-PTEN polyclonal antibodies, 1:1000 are diluted in confining liquid, room temperature 2h), secondary antibody (HRP mark
Goat anti-rabbit antibody 1:10000 are diluted in confining liquid, room temperature 1h) be incubated after, thoroughly washing, then utilize ECL systems
(Amersham Pharmacia Biotech Co.) carries out albumen colour developing.PTEN is detected in intra-tumor expression, can be seen
Obvious up-regulation is expressed in AAV-TRAIL+miR-222-TuD groups PTEN.
MiR-222-TuD is played a role result by adjusting target gene PTEN change level：
(1) PTEN is miR-222 prediction target gene, sees Fig. 5 (A)；
(2) in injection of AAV-TRAIL+miR-222-TuD tumor tissues, PTEN expressions substantially raise, and see Fig. 5
(B)。
The double dye method stream measuring Apoptosis of the Annexin V-FITC/PI of embodiment 5
According to apoptosis kit (BD-FITC Annexin V Apoptosis Detection Kit I) specification
Carry out.Cell is after 0.25%EDTA digestion process, centrifugation, is washed twice with the PBS of ice, is resuspended with 1 × Binding Buffer
For 1 × 106Cells/ml, take 100 μ l cell suspensions (1 × 105Cells), 5 μ l FITC Annexin V and 5 μ l PI are added,
Soft to mix, room temperature lucifuge is incubated 15 minutes.400 μ 1 × Binding of l Buffer are added, are examined in 1 hour with flow cytometer
Survey.
Double dye method stream measuring Apoptosis results：
Transfection single expression TRAIL plasmid can cause Hela Apoptosis, and transfect TRAIL and miR-222-TuD
Co-expression plasmid after, hence it is evident that promote the apoptotic effect to Hela, see Fig. 2 (D).
The foundation of the mouse model of embodiment 6
Take 5 to 6 week old, body weight about 20g Bal b/c nude mices, subcutaneous vaccination 2 × 106Human lung cancer cell A549, every three or
The line of apsides of the tumour of measurement in four days, calculates knurl volume (volume=1/2 × major diameter × minor axis2).At the end of experiment at disconnected neck
Dead nude mice, tumour or each tissue sample are stored in -70 DEG C after weighing after liquid nitrogen frozen or consolidated in 4%paraformaldehyde
It is fixed.
The experimental therapy of the tumor-bearing mice of embodiment 7 and observation
Take 5 to 6 week old, body weight about 20g Bal b/c nude mices, subcutaneous vaccination 2 × 106Human lung cancer cell A549, (1 ×
μ l of PBS suspensions 100), i.e., the mouse model that prepared by embodiment 6.Tumour length is to 100mm3When, experimental animal is divided into three
Group：A) AAV-EGFP negative control groups；B) AAV-TRAIL positive controls；C) AAV-TRAIL+miR-222-TuD recombinant viruses
(virus titer 1011) treatment group.Every group 5, pass through multi-point injection in knurl.The growing state of different groups of animal tumors is observed weekly
And life span.3 batch weight are done to test again.
A549 tumor-bearing mices are after restructuring AAV-TRAIL and AAV-TRAIL+miR-222-TuD processing, the growth of subcutaneous tumors
It is suppressed, and AAV-TRAIL+miR-222-TuD can promote AAV-TRAIL using effect, hence it is evident that suppress tumour growth：
(1) the suppressed morphological observation of subcutaneous tumors, Fig. 4 (A) is seen；
(2) the dynamic observation of posterior tuberosity Volume Changes is administered, sees Fig. 4 (B)；
(3) difference of knurl weight, is shown in Fig. 4 (C) when putting to death.
The studies have shown that TRAIL of the past few decades plays highly important function in tumour and immune system, is
One factor for having very much treatment potentiality.With TNF families other part members compared with TRAIL has following three advantage：1) have
There is the ability of powerful and specific inducing apoptosis of tumour cell, but to normal cell without this effect；2) than TNF-α and Fas-L
There is wider array of anticancer spectrum；3) only have very faint activation to NF- κ B, even systemic administration, also will not as TNF-α and
Fas-L produces serious inflammatory reaction like that.Therefore many biotechnologys and drugmaker are all directed to activation tumour cell with this
Death program carry out design medicine, at present, different TRAIL receptor stimulating agents, including TRAIL is in itself, and various emulative
Anti- DR4, DR5 monoclonal antibody are all as new cancer target among clinical test.But still there is it at present
The predicament faced, such as resistance problem.
In this patent, Hsa-miR-222 shows the influence to TRAIL resistance in various kinds of cell system, is overexpressed
Cell strengthens TRAIL resistance after miR-222 analogies, and after curbing miR-222, the apoptosis rate increase of cell,
TRAIL resistance is weakened.Therefore we devise miR-222 specific inhibitor miR-222-TuD come and TRAIL joint
Using.It can be seen that Hela cells are as the cell line sensitive to TRAIL, after only expression TRAIL plasmid has been transfected,
Cell be there occurs obvious apoptosis, and herein basis on, TRAIL+miR-222-TuD co-expression plasmids remain to significantly increase
TRAIL lethal effect.A549 equally as to TRAIL than more sensitive cell line, with it into the zoopery after knurl
In, the AAV viruses of packaging are injected respectively, are compared with control group, the tumour growth for having injected AAV-TRAIL groups is partly pressed down
System, and viral group of injection of AAV-TRAIL+miR-222-TuD therapeutic alliances, tumour growth are used alone in AAV-TRAIL
There is further apoptosis again on basis.That is, for cell sensitive TRAIL, TRAIL+miR-222-TuD connection
Application is closed, remains to further enhance sensitiveness of the cell to TRAIL, can be as the new of clinically reduction TRAIL dosages
Selection.
We are predicted the target gene to Hsa-miR-222, some candidate targets are have selected, by tumor tissues
Protein extraction out carry out western blot checkings, finally find, its target gene PTEN is in AAV-TRAIL+miR-222-
TuD therapeutic alliance groups substantially raise.MiRNA is played a role by its target gene of targeted inhibition, and miR-222-TuD
Be miR-222 specific inhibitor, thus detect its target gene PTEN up-regulation in vivo, it is consistent with actual conditions
, on the one hand illustrate that miR-222-TuD has played the effect for suppressing miR-222 really in vivo, on the other hand illustrates its enhancing
The mechanism of TRAIL resistance function may be by PTEN.
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
Claims (10)
1. a kind of composition, it is characterised in that including TRAIL95-281And RNA；
The nucleotide sequence of the RNA is as shown in SEQ ID No.1；
The TRAIL95-281Sequence such as SEQ:Shown in ID NO.10.
A kind of 2. recombinant expression carrier, it is characterised in that including：
(1) TRAIL is encoded95-281Nucleotide sequence；With
(2) DNA of coding RNA；
The nucleotide sequence of the RNA is as shown in SEQ ID No.1；
The TRAIL95-281Sequence such as SEQ:Shown in ID NO.10.
3. the construction method of recombinant expression carrier according to claim 2, it is characterised in that TRAIL will be encoded95-281's
The DNA of nucleotide sequence and coding RNA is connected in carrier, construction of expression vector；
The nucleotide sequence of the RNA is as shown in SEQ ID No.1
The TRAIL95-281Sequence such as SEQ:Shown in ID NO.10.
4. construction method according to claim 3, it is characterised in that the carrier is plasmid or virus.
5. construction method according to claim 4, it is characterised in that the virus is adeno-associated virus.
6. a kind of host cell, it is characterised in that including recombinant expression carrier as claimed in claim 2.
7. host cell according to claim 6, it is characterised in that the host cell is cell line, the cell line
It is thin selected from HeLa cells, A549 cells, Bel-7402 cells, CNE-2Z cells, EC109 cells, MGC-803 cells, SW1990
Born of the same parents, DU145 cells, U251 cells, A875 cells, HCT116 cells, MCF7 cells or SK-OV-3 cells.
8. described in the recombinant expression carrier, claim 6 or 7 described in composition according to claim 1, claim 3
Host cell prepare treatment tumour medicine in application.
9. application according to claim 8, it is characterised in that the tumour is primary, Secondary cases or metastatic swollen
Knurl.
10. application according to claim 8 or claim 9, it is characterised in that the tumour includes lung cancer, liver cancer, nasopharyngeal carcinoma, food
Pipe cancer, colorectal cancer, stomach cancer, cancer of pancreas, prostate cancer, glioma, melanoma, breast cancer, cervical carcinoma or oophoroma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510382699.7A CN105039320B (en) | 2015-07-02 | 2015-07-02 | A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510382699.7A CN105039320B (en) | 2015-07-02 | 2015-07-02 | A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039320A CN105039320A (en) | 2015-11-11 |
| CN105039320B true CN105039320B (en) | 2017-12-22 |
Family
ID=54446293
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510382699.7A Active CN105039320B (en) | 2015-07-02 | 2015-07-02 | A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039320B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100179213A1 (en) * | 2008-11-11 | 2010-07-15 | Mirna Therapeutics, Inc. | Methods and Compositions Involving miRNAs In Cancer Stem Cells |
| AU2010321555B2 (en) * | 2009-11-23 | 2015-10-15 | The Ohio State University | Materials and methods useful for affecting tumor cell growth, migration and invasion |
-
2015
- 2015-07-02 CN CN201510382699.7A patent/CN105039320B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039320A (en) | 2015-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11883448B2 (en) | Oncolytic HSV vector | |
| EP4303225A2 (en) | Polyploid adeno-associated virus vectors and methods of making and using the same | |
| Meng et al. | Cell-penetrating peptides enhance the transduction of adeno-associated virus serotype 9 in the central nervous system | |
| WO2017153606A1 (en) | Nucleic acid constructs and vectors for oncoselective expression of a transgene | |
| CN104726584B (en) | Applications of the miR 425 in the diagnosis, treatment and prognosis of tumour | |
| CN105039320B (en) | A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell | |
| Meunier et al. | Lentiviral-mediated targeted transgene expression in dorsal spinal cord glia: tool for the study of glial cell implication in mechanisms underlying chronic pain development | |
| Chi et al. | Stomatin-like protein 2 of turbot Scopthalmus maximus: Gene cloning, expression profiling and immunoregulatory properties | |
| CN105176998A (en) | RNA and use thereof, composition containing the same, recombinant expression vector and host cell | |
| Xiao-Dan et al. | miR-877-5p antagonizes the promoting effect of SP on the gastric cancer progression. | |
| WO2022121159A1 (en) | Vector system for inducing apoptosis | |
| WO2021174121A1 (en) | Vegfr-3-activating agents and oncolytic viruses and uses thereof for the treatment of cancer | |
| WO2019123414A1 (en) | Engineered viruses expressing cyclic gmp-amp synthase | |
| Wang et al. | Cisplatin‐controlled p53 gene therapy for human non‐small cell lung cancer xenografts in athymic nude mice via the CArG elements | |
| US20240131095A1 (en) | Artificial oncolytic viruses and related methods | |
| Kosmidis et al. | Gene therapy for hepatocellular carcinoma: An update | |
| Huang et al. | FTR33, a member of fish-specific TRIM (finTRIM) subfamily, regulates negatively type I IFN antiviral immunity in zebrafish | |
| Choi et al. | Enhanced tumor targeting and timely viral release of mesenchymal stem cells/oncolytic virus complex due to GRP78 and inducible E1B55K expressions greatly increase the antitumor effect of systemic treatment | |
| CN114042160B (en) | CTD-2256P15.2 and application of encoded micro-peptide thereof as target in development of tumor treatment drugs | |
| Novaes et al. | Genetically modified ZIKA virus as a microRNA-sensitive oncolytic virus against central nervous system tumors | |
| CN105420260A (en) | Target recombination Wnt fusion protein and application thereof in preparing anticarcinogen | |
| CN117899220A (en) | Application of CRTC2 gene inhibitor in preparation of anti-liver cancer drugs | |
| CN117736342A (en) | Construction method of CAR-T cells of double-targeting c-Met and VEGFR2 | |
| RO134900A2 (en) | Biological system based on an anti-tumor targeted hybrid viral vector meant to restore normal genotype of tumor suppressor gene tp53 in malignant cells | |
| Watanabe et al. | 772. Conferring CAR T Cells With Resistance to TGFβ1 Using a Signal Converter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Shi Juan Inventor after: Ma Sisi Inventor before: Ma Sisi Inventor before: Shi Juan |
|
| CB03 | Change of inventor or designer information |