CN104805508B - A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway - Google Patents
A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway Download PDFInfo
- Publication number
- CN104805508B CN104805508B CN201510213073.3A CN201510213073A CN104805508B CN 104805508 B CN104805508 B CN 104805508B CN 201510213073 A CN201510213073 A CN 201510213073A CN 104805508 B CN104805508 B CN 104805508B
- Authority
- CN
- China
- Prior art keywords
- primer
- stranded
- library
- mutant
- anchor point
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway of the present invention, belongs to gene engineering technology field.The present invention mediates the structure in recombination mutation library with round pcr using the single-stranded libraries of DNA of synthesis.Host is converted after mutated library recombinant expression carrier and carries out high flux screening evolution mutant strain.The present invention uses this technology, successfully carries out engineered ex vivo to metabolic pathway, obtains property very excellent mutant strain.The rapid in-vitro that this method realizes gene is evolved, simple to operate, is particularly suitable for introducing gene internal abundant mutation diversity, is carried out slewing evolution.
Description
Technical field
The present invention relates to a kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway, belong to technique for gene engineering
Field.
Background technology
With the development of Protocols in Molecular Biology and technique for gene engineering, the natural enzyme gene of existing thousands of species is sent out
It is existing, because the living things catalysis that enzyme is mediated has environmentally friendly, the advantages of efficient selectivity and gentle reaction condition, urged as life
The leader of change, is widely used in the synthesis of complicated medicine, intermediate, the synthesis of compound, or even bio-fuel.Synthesis
Enzyme is the participant of core in biological and metabolic engineering, by building a series of metabolism route of synthesis, it is possible to achieve microorganism
The complex compound that the various organic syntheses of metabolism synthesis can not be obtained, such as aromatic hydrocarbons, carbohydrate, organic acid, alcohol and other times
Level metabolite.However, in most cases, the limitation of the property of native enzyme significantly limit it in various complexity
Under the conditions of use.
Nature has been evolved very accurate and again efficient in genetic mutation and the homeostasis process of natural selection
Enzyme, but the speed of natural selection is very slowly, it is necessary to the very long time.People to native enzyme in the urgent need to carrying out artificial evolution
And transformation, to obtain the new enzyme with better function that disclosure satisfy that people's demand.Under the conditions of current experimental technique, Ren Mentong
The methods such as physical chemistry are crossed, the frequency of gene mutation is drastically increased such as ultraviolet, ray and nitrite, are artificial fast
Fast evolution gene is provided may.However, the mutation that the method such as physical chemistry is caused all is often detrimental mutation, and randomness compared with
Greatly, large-scale evolution demand can not also be met.It is straight from genetic manipulation level with reaching its maturity for Protocols in Molecular Biology
The mutational site specific or random to natural gene introducing is connect to be possibly realized.Random mutation method is random by introducing
Base is replaced, and then screens preferable mutant.Such as fallibility round pcr, be it is current using wider gene evolution mode it
One, by being randomly incorporated into catastrophe point, the gene of the beneficial evolution of high flux screening during polymerase chain reaction in vitro (PCR).
After excessive turn operation, zymologic property can be obtained and the new enzyme of significant change occurs for function.Grow up on this basis
Various dependence round pcrs introduce catastrophe point evolution gene technology such as rite-directed mutagenesis, gene it is chimeric and instantaneously template with
The method such as machine is chimeric.However, the catastrophe point diversity that the above method is produced is few, the mutant of generation is also generally detrimental mutation, work
Work amount is big and extremely inefficient.
1994, a kind of orthogenesis new technology DNA reorganization (DNA shuffling) was quietly born, and Stemmer exists
Nature has delivered entitled Rapid evolution of a p rotein in vitro by DNA shuffling's
Article, proposes DNA shuffling technologies first.Researcher reorganizes using beta-lactam enzyme system as subjects with DNA, passes through
Three-wheel is screened and backcrossing obtains a new strains twice, and the minimum inhibitory concentration of its CTX (cefotaxime) compares original strain
16000 times are improved, far above the screen mutation result of error-prone PCR.Then grow up it is various using recombinant technique as
The method on basis, relatively good effect is obtained as target, all using the degree and screening efficiency for improving gene recombination.However, DNA
Requirement of the shuffling technologies to sequence homology higher (homology be more than 75%) and need to obtain homologous gene material.This
Two maximum of condition limit the application of DNA shuffling technologies, while the mutant that the technology is produced often has more
Phase shift mutant.
In addition, the current transformation of synthetic biology and metabolic engineering to route of synthesis is concentrated on to route of synthesis base substantially
On the expression regulation of cause, for example strengthen pathway gene expression, knock out or suppress competition approach, for example optimal startup or
Ribosome bind site, the codon of optimization gene, interval regulatory region of rebuilding approach gene etc..In addition, to route of synthesis
In enzyme transformed and be also necessary, the speed limit problem of such as key enzyme, by product or substrate feedback inhibition.Cause
For, if only expression is strengthened, waste and the cell growth burden of cell synthesis capability are may result in, and can not be from root
The problem of metabolic pathway flow equilibrium being solved in sheet.
The present invention, by artificial synthesized single-stranded DNA banks, is obtained using based on external PCR recombinant techniques using round pcr
Screen mutation library must be built containing diversity extremely abundant mutated library, then using extracorporeal recombination.This technology overcomes
The factors such as above-mentioned random mutation diversity is not enough, the limitation of DNA shuffling technologies homologous sequences and homologous gene material,
It is that the outer tachytelic evolution of genosome is laid a good foundation and operation implements simple, it is easy to obtain abundant mutant library, meanwhile,
Associated proteins Structure bioinformatics and synthetic biology, the slewing for being particularly suitable for enzyme gene and metabolism route of synthesis are entered
Change application.
The content of the invention
The invention provides a kind of method (Rapidly based on synthesizing single-stranded DNA library evolution metabolic pathway
Efficient Combinatorial Oligonucleotides for Direct Evolution, RECODE), main bag
Include and prepare mutant library, screening mutant；The mutant library includes single-stranded mutant library and double chain mutation body library.
Single-stranded mutant library can separate structure with double chain mutation body library, can also synchronously build.To build single-stranded mutant text
Storehouse, separately designs primer, each primer direction is identical for each targeted mutagenesis region of parental gene, and by PCR system
It is middle to add DNA ligase to connect the nucleotide fragments respectively undergone mutation, obtain complete single-stranded mutant；Dashed forward to build double-strand
Mutant libraries, the two ends of single-stranded mutant need to take extra anchor point sequence, be easy to when duplexed, designed for specificity expansion
Increase the primer of single-stranded mutant.
It is that the targeted mutagenesis region can purposefully select to obtain or randomly generate.It is same to being carried out on a chain
When the region quantity that is mutated it is unrestricted in theory, in practical operation can sets itself as needed, the gene within 2k can
With between 1-15 site.
The direction is identical, refers to that each primer is 3 ' to 5 ' directions, or be 5 ' to 3 ' directions.When parental gene is double
During chain DNA, primer direction is identical can to ensure that PCR processes, only using the DNA of specific direction as template, finally give single-stranded mutation
Body.
Parental gene coding is metabolic pathway gene, including promoter, ribosome bind site and path enzyme base
Cause；The existence form of parental gene is unrestricted, can be plasmid, genome, double chain DNA fragment or single-stranded cDNA.
Single-stranded mutant library and double chain mutation the body library is synchronously built, and is directly to the single-stranded mutant library of structure
PCR system in add the primer of the single-stranded mutant of specific bond, side PCR obtains single-stranded mutant, while using single-stranded mutant as
Template carries out the amplified reaction of duplexed reaction and double chain mutation body.
When single-stranded mutant library and double chain mutation body the library substep is built, directly with containing single-stranded mutant library
PCR mix products are changed without reaction system as template, and the primer that the single-stranded mutant of specific bond is directly added thereto is carried out
Second wheel PCR prepares the complete double chain mutation body of total length；Or it is used as mould to purify the single-stranded mutant library after reclaiming through post
Plate, prepares reaction system and carries out the complete double chain mutation body of the second wheel PCR preparations total length again.
To build single-stranded mutant library, for one or more targeted mutagenesis regions of parental gene, phase is separately designed
The primer answered, referred to as edits primer.Editor's primer is containing the mutating alkali yl in need introduced to Sudden change region and 3 ' and 5 ' ends
There is the sequence matched with template strand of suitable length respectively；When being related to multiple Sudden change region, each editor's primer be it is equidirectional, with
The pairing of same direction template strand is combined.Meanwhile, synthesis two is with editing the equidirectional anchor point primer of primer, wherein one is upstream
Anchor point primer, one is downstream anchor point primer, and the upstream anchor point primer contains one section holds the nucleotides matched with template strand 3 '
Sequence, in addition, there be 15-25bp anchor point sequence at 5 ' ends of the upstream anchor point primer；The downstream anchor point primer contains one section
The nucleotide sequence matched is held with template strand 5 ', in addition, there be 15-25bp anchor point sequence at 3 ' ends of the downstream anchor point primer.
For editor's primer, to save synthesis expense, general recommendations editor's primer length is less than 59bp, can increased if necessary
Plus primer length, or two short primers can be divided into.The site being mutated is needed to be typically disposed in the middle part of editor's primer,
Height degeneracy can be carried out as needed, if parent's coding is protein sequence, to avoid terminator codon TAA, TAG and TGA from going out
Existing, codeword triplet can degeneracy be VNN or reduces the probability that terminator occurs, and editor's primer synthesizes preferred PAGE purifying sides
Formula.
The anchor point primer, can also have the function of editor's primer concurrently, i.e., while as anchor point primer, can also contain
The mutating alkali yl in need introduced to Sudden change region.
The anchor point sequence, on the one hand can be when building double chain mutation body library, for designing single-minded and single-stranded mutation
The external primer that body is combined, is on the other hand alternatively arranged as homologous recombination sequence, the connection for mutant library and expression vector.
When double chain mutation body is connected with carrier, it is not recommended that recombinant vector is carried out using restriction enzyme site, because height degeneracy
Mutation introduce, gene internal may be made corresponding restriction enzyme site occur.
It is described to need in the mutating alkali yl that Sudden change region is introduced be specific base sequence or degeneracy base
Sequence.
Editor's primer and downstream anchor point primer, are first held before using T4 polynueleotide kinases to the 5 ' of primer
Hydroxyl carries out phosphorylation reaction.
3 ' and 5 ' terminal sequences of editor's primer retain the 15-30bp oligonucleotide matched completely with template respectively
Sequence.
The course of reaction for preparing single-stranded mutant library is the reaction that DNA extensions and DNA connections are synchronously carried out：Upstream and downstream
Anchor point primer, editor's primer and template DNA are with appropriate mixed in molar ratio, addition archaeal dna polymerase and DNA ligase, reaction buffering
Liquid.Mg in reaction buffer2+Concentration is 1-10mM, and PCR annealing temperatures are 40-66 DEG C, and PCR elongating temperatures are 65-72 DEG C, PCR
Reaction cycle number is 1-35.PCR primer includes being not used as the single stranded DNA of template after denaturation is unwind, substantial amounts of undergone mutation
Single stranded DNA, with the conjugate DNA undergone mutation in double-stranded state of template.
In one embodiment of the invention, when preparing single-stranded mutant library, combined with template strand diverse location
The molal quantity of primer is identical.
To build double chain mutation body library, it can be purified back with the PCR mixtures containing single-stranded mutant library or through post
Single-stranded mutant library after receipts carries out second and takes turns the complete double chain mutation body library of PCR preparations total length as template；Or it is straight
The primer that the single-stranded mutant of specific bond is added into the reaction system for building single-stranded mutant library is connect, side PCR obtains single-stranded
Mutant side carries out the amplified reaction (referred to as One_step PCR) of duplexed reaction and double chain mutation body.To build double chain mutation body
Library, using single-stranded mutant as a pair of external primers for expanding single-stranded mutant full-length gene of stencil design.The outer end
Primer matches or identical with the anchor point sequence of anchor point primer respectively.That only undergos mutation takes the single stranded DNA of anchor point sequence
It can be combined with external primer, thus amplified production is double chain mutation body library.The PCR primer prepared, after purifying is reclaimed, is used
Extracorporeal recombination is cloned, and builds high flux screening library, and screening possesses the muton of required nature and characteristic.
It is described to purify the single-stranded mutant library after reclaiming using single-stranded mutant library or through post and carry out the as template
When two wheel PCR prepare total length complete double chain mutation body gene outcome, it need to only be dashed forward by a small number of circulations with regard to a large amount of double-strands can be obtained
Variant.Described single-stranded mutant library, can be restricted interior using DpnI before the preparation in double chain mutation body library is carried out
Enzyme cutting digests template strand.Certainly, even if without using DpnI restriction enzymes degraded template DNA, preparing double chain mutation library
PCR during, because a pair of external primers contain the sequence with the anchor point sequences match of anchor point primer, and template DNA is free of
There is the sequence with anchor point sequences match, therefore, template DNA can't be expanded.
The primer that the single-stranded mutant of specific bond is directly added into the reaction system for building single-stranded mutant library,
Side PCR obtains single-stranded mutant, and side is carried out in the One_step PCR of the amplified reaction of duplexed reaction and double chain mutation body, will be upper and lower
Anchor point primer, editor's primer and template DNA are swum with appropriate mixed in molar ratio, meanwhile, it is separately added into 2-5 times of anchor point primer amount
Upstream and downstream external primer, addition archaeal dna polymerase, DNA ligase and reaction buffer.Mg in reaction buffer2+Concentration is 1-
10mM, PCR annealing temperature are 40-66 DEG C, and PCR elongating temperatures are 65-72 DEG C, and PCR reaction cycle numbers are 1-35.PCR primer
Containing substantial amounts of double chain mutation body, and minimal amount of template DNA.
In the annealing process of the One_step PCR, to avoid anchor point in the combination of anchor point primer and external primer, anchor point primer
The length of sequence accounts for 1/3rd of anchor point primer length.
In the One_step PCR, upper (lower) trip anchor point primer length can be 60bp, wherein 40bp and complete of parental templates
Match somebody with somebody, also 20bp anchor point sequence；Upper (lower) trip external primer length is 20bp, or complementation identical with anchor point sequence.
In the One_step PCR, the adding proportion of upper (lower) trip anchor point primer and upper (lower) trip external primer can be 1：(2-
5), excessive upper (lower) trip external primer can make the single-stranded mutant of generation completely duplexed into double-strand mutant.
In one embodiment of the invention, described archaeal dna polymerase is the hot resistant DNA polymerase of high-fidelity, preferably
5 ' -3 ' high-fidelity DNA polymerase of 5 prime excision enzyme activity missing, such as Phusion DNApolymerase (NEB).
In one embodiment of the invention, described DNA ligase is heat-resistant dna ligase, such as Taq
DNAligase (NEB), 9N DNA ligase (NEB) and Ampligase (EPI), preferably Ampligase.
For screening mutant, mutant library can be integrated with carrier with external package technique.
Described assembled in vitro technology can be fusion DNA vaccine, Gibson assemblings, T4DNA polymerase-mediated recombinant technique
Or internal yeast package technique.The principle of Gibson package techniques is that T5 exonucleases can be from assembling reaction system
5 ' ends of double chain DNA fragment are cut inward, produce the cohesive terminus,cohesive termini that 3 ' distal process go out, homologous due to having between each fragment
Arm sequence, the cohesive terminus,cohesive termini fragment of adjoining two complete complementaries pairing is combined, and the breach of generation is mended by archaeal dna polymerase
Gentle Taq DNA ligases connection is completed, so as to realize the seamless integration of recombinant fragment.
Fig. 1 can help to understand the principle of the present invention, and Fig. 1 does not represent unique embodiment of the present invention.It is of the invention main
Including the process that the two-wheeled PCR of different primers progress is respectively adopted and is screened to the second wheel PCR primer.First round PCR
It is related to the primer in 55 ' to 3 ' directions that Fig. 1 upper ends are shown, wherein two with dotted line primers are anchor point primer, dotted line institute
Show part be anchor point sequence, be respectively provided with ★, ▲, ◆ be for different target Sudden change region design editor's primer；
The denaturation stage of PCR processes, parent DNA, which unwinds, obtains two single stranded DNAs, because 5 primers all can only be with 3 ' to 5 ' directions
DNA is combined, therefore, and the parent's DNA for there was only 3 ' to 5 ' directions during whole PCR can be as template strand, correspondingly, this
Wheel PCR can obtain the single-stranded mutant in a large amount of 5 ' to 3 ' directions, a small amount of single stranded DNA, Shao Liangyu for being not used as template after terminating
The conjugate DNA undergone mutation in double-stranded state of template.Using first round PCR mix products as template, or use
The pure mode of DNA solution post reclaims single-stranded mutant as template, to reduce other influence factors.Correspondingly, the second wheel PCR can be with
Reaction system is changed without, upstream and downstream external primer is added directly into first round PCR mix products, or preparation PCR is anti-again
Answer system.Second wheel PCR is related to a pair of external primers, the anchor point sequence of the external primer and the anchor point primer in first round PCR
Matching is identical, therefore the external primer is only combined with the single stranded DNA with anchor point sequence and carries out amplified reaction, and parent DNA
It is able to cannot be expanded with the sequence of anchor point sequences match due to lacking.Finally, by being carried out to abundant double chain mutation body storehouse
Screening obtains preferable mutant.
Fig. 4 is the One_step PCR obtained after being simplified on the basis of Fig. 1, can directly prepare double chain mutation body library.One
It is that just with the addition of upstream and downstream external primer in Fig. 1 first round PCR reaction system to walk PCR, so, during reaction,
Newly-generated single-stranded mutant is combined with upstream or downstream outer end primer, and is expanded and formed double chain mutation body, and parent's chain due to
It can not combine, will not be amplified with external primer.In the process, the mutant of formation is increased in the form of index, compared to two
PCR reaction systems are taken turns, the mutant of generation is more.Meanwhile, operationally more facilitate, take short.
The present invention is based on external PCR recombinant techniques, artificial synthesized single-stranded mutant library, by design for multiple
Obtained after editor's primer of target area, PCR containing diversity extremely abundant mutated library, it is duplexed after again using external weight
Group technique construction screening mutant library.Instant invention overcomes existing random mutation diversity deficiency, DNA shuffling technologies
The shortcoming limited by homologous sequence and homologous gene material, and operation implements simple, it is easy to abundant mutant library is obtained,
Laid a good foundation for tachytelic evolution outside genosome.Object for rapidly and efficiently evolving can be any DNA sequence dna, including start
Son, ribosome bind site, non-transcribed translational control area, enzyme gene and the multiple DNA sequence dnas for constituting metabolism route of synthesis.This
Invention passes through promoter, ribosome bind site and the path enzyme base in evolution Escherichia coli 5-ALA route of synthesis
Cause, successfully brings up to 1930mg/L by ALA yield by 110mg/L.
Brief description of the drawings
Fig. 1 show the method schematic diagram of synthesizing single-stranded DNA library Rapid Combination evolution enzyme and metabolic pathway；Two ends dotted line
Position is anchor point sequence.
Fig. 2 show ALA route of synthesis endogenous E. coli genes hemL-hemA-hemF and builds schematic diagram.
Fig. 3 show the ALA Yield mappings that mutation restructuring ALA metabolic pathways element obtains mutant strain；LAF is recombination to construct
Protoplasm grain, A1-A5 is respectively the mutant strain of different output.
Fig. 4 show the method schematic diagram that RECODE technologies combine evolution DNA using One_step PCR reaction system；Two ends are empty
Line position is anchor point sequence.
Embodiment
The One_step PCR of embodiment 1 carries out engineered ex vivo to 5-ALA (ALA) metabolic pathway of synthesizing
To prove that the inventive method can efficiently and rapidly transform metabolic pathway in vitro, including promoter, ribosomes are combined
Site and the transformation of approach enzyme gene, build three endogenous genes hemL, hemA and hemF of Escherichia coli C5 route of synthesis,
HemL-hemA-hemF of the sequence as shown in SEQ ID NO.1 is built as mode as shown in Figure 2, gained combination approach is implemented in
PRSFDuet-1 plasmids.Choose ribosome bind site RBS, hemF gene of three genes promoter -10 and -35 it is interval with
And three suitable sites of gene internal, design edits primer (JPS/LAF-P1F to JPS/LAF-P14F) for 14 altogether, to generation
The approach of thanking is transformed, and primer sequence information is as follows：
JPS/LAF-P1F:AACTTTAATAAGGAGGGATCCATAAAAGGRRRDDDDTATATGAGTAAGTCTGAAAATCT
JPS/LAF-P2F：CGTGGTTTAAGCTTTGGTNCANCANNCVNNVNNVNNNTGNAAATGGCGCAACTGGTGA
JPS/LAF-P3F：CGCCTGGCCCGTGGTTTTNCCNNTVNNVNNANNNNTNTTAAATTTGAAGGGTGTTACC
JPS/LAF-P4F：ACTTATAATGATCTGGCTNCTVTAVNNVNNNCANNTVNGCAATACCCGCAAGAGATTGC
JPS/LAF-P5F：GGTGGTCGTCGTGATGTAATGNATVNNVNNVNNVNNNCGNGTCCGGTCTATCAGGCGG
JPS/LAF-P6F：GGTGTTTGCGAAGTTGTAADDRRRRRDDDDDATGNNCVNNVNGCTTTTAGCGCTCGGTA
JPS/LAF-P7F：AATGACGCCGTCAGCCACNTGNTGVNNVNNVNNNGCNGTCTGGATTCACTGGTGCTGGG
JPS/LAF-P8F：AGCGCCGTCTCCGTCGCGNTTNCCVNNNNTVNNVNNGCCCGCCAAATCTTTGAATCGCT
JPS/LAF-P9F：ATTATCGCCAACCGAACCNGCVAGVNNVNNVAANCCCTGGCGGATGAGGTAGGCGCCG
JPS/LAF-P10F：GCATTAAAAAGCCGTCGTNACVNGVNNNTGVNNVNNGTGGATATCGCCGTACCGCGCG
JPS/LAF-P11F：CCGCATAATCGAAATTAATANNNNNNNNTATAGGGGAATTGTGAGCGGATAAC
JPS/LAF-P12F:GTATATTAGTTAAGTATAAGRRRRRRDDDDDDATGAAACCCGACGCACACCAGG
JPS/LAF-P13F：CATCGCCCGGAACTTGCCNGGVNNVNNNNCGAGGCGATGGGCGTTTCACTG
JPS/LAF-P14F：TTCTATGGTTTTGAAGAAGATNCTNNTNNNNNGNATCGCACCGCCCGTGACCTGTGCC
JPS/LAF-P15F：GGCGTTAAGTGAGTTTATTAAGGTCAGGGATTGGGTGTAAGCACTTCGTGGCCGAGCTCG
JPS/LAF-ELF:TGTTTAACTTTAATAAGGAGGGATCC
JPS/LAF-ELR:CGAGCTCGGCCACGAAGTGC
PRSFDUET-F:GCACTTCGTGGCCGAGCTCGAGTCTGGTAAAGAAACCGCTGC
PRSFDUET-R:CTCCTTATTAAAGTTAAACAAAATTATTTCTACAG
Editor's primer is JPS/LAF-P1F to JPS/LAF-P14F, and wherein JPS/LAF-P1F has the work(of anchor point primer concurrently
Can, JPS/LAF-P15F is another anchor point primer, after JPS/LAF-ELF and JPS/LAF-ELR primers is whole mutation transformations
Metabolic pathway external primer, PRSFDUET-F and PRSFDUET-R draw to prepare the carrier for being used to recombinantly express metabolic pathway
Thing.
In 25 μ l reaction systems：2.5 μ l 10x reaction buffers, upstream anchor point primer JPS/LAF-P1F, phosphorylation
Downstream anchor point primer JPS/LAF-P15F and editor's primer JPS/LAF-P1F to JPS/LAF-P14F of phosphorylation it is appropriate (according to
Phosphorylation system computing, every editor primer 1-5pmol), DNA profiling addition about 10-50ng (is 1 with primer ratio:
100), upstream outer end primer JPS/LAF-ELF, downstream outer end primer JPS/LAF-ELR are separately added into and drawn relative to downstream anchor point
The amount that 2 times of thing, adds the μ l of Phusion DNA polymerase (NEB) 0.5 μ l, Ampligase (EPI) ligase 1.After mixing
Run by following PCR programs：94 DEG C of 2min, [94 DEG C of 30s, 50 DEG C of 1min, 66 DEG C of 5min] x32,72 DEG C of 5min, 4 DEG C of hold
on.PCR primer is mutant library, with 1% agarose gel electrophoresis gel extraction.Using gel reclaims kit by specification
Recommendation method reclaims PCR primer.PRSFDUET-F and PRSFDUET-R draws to prepare the carrier for being used to recombinantly express metabolic pathway
Thing.The metabolic pathway mutated library of structure enters pRSFDuet-1 plasmids using homologous recombination technique clone, converts BL21DE3 tables
Up to host, the LB solid plates containing 50ng/ml kanamycins, 37 DEG C of overnight incubations are mutated.Using high flux culture technique, with
2400 monoclonals of machine picking are inoculated in 96 well culture plates containing minimal medium, medium component (g L-1)：pH 7.0、
Glucose 20.0, yeast extract 2.0, (NH4)2SO416.0,KH2PO43.0,Na2HPO4·12H2O 16.0,MgSO4·7H2O
1.0,MnSO4·H2O 0.01. add 50ng/ml kanamycins and final concentration of 0.1mM IPTG derivants.37℃220rpm
Cultivate 36h.After fermented liquid supernatant centrifugation, appropriate dilution determines ALA fermentation yields.
ALA detection methods are：Sample is diluted to 2mL, 1mL acetate buffer is added, 0.5mL acetylacetone,2,4-pentanedione,
Then 15min is boiled.Room temperature is cooled to, 2mL reaction solution is taken into new pipe, 2mL improvement Ehrlich ' s examinations are then added
Agent, reacts 20min, is detected using under spectrophotometer 554nm.Using 96 orifice plate assay methods of batch in the present invention, mutually take an entrance examination
Agent usage amount reduces volume by same ratio.
Shown (as shown in Figure 3) according to determination of yield result, the former plasmid cloning ALA yield of restructuring is only 110mg/L,
And screening obtains the mutant strain for significantly improving ALA yield from mutated library, highest ALA yield to 1930mg/L is carried
It is high nearly 17 times.Thus illustrate, the present invention has obvious effect for the engineered ex vivo of product catabolism approach.
Although the present invention is disclosed as above with preferred embodiment, it is not limited to the present invention, any to be familiar with this skill
The people of art, without departing from the spirit and scope of the present invention, can do various changes and modification, therefore the protection model of the present invention
Enclose being defined of being defined by claims.
Claims (8)
1. a kind of method of evolution metabolic pathway, it is characterised in that main to be dashed forward including preparing single-stranded mutant library, preparing double-strand
Mutant libraries, screening mutant, single-stranded mutant library are built step by step or simultaneously with double chain mutation body library；It is single-stranded prominent to build
Mutant libraries, separately design primer, each primer direction is identical for each targeted mutagenesis region of parental gene, and by
DNA ligase is added in PCR system to connect the nucleotide fragments respectively undergone mutation, and obtains complete single-stranded mutant；For structure
Double chain mutation body library is built, the two ends of single-stranded mutant need to take extra anchor point sequence, be easy to when duplexed, be designed for
The primer of the single-stranded mutant of specific amplification；The parental gene coding is metabolic pathway gene；Described single-stranded mutant
After the completion of prepared by library, before the preparation in double chain mutation body library is carried out, using DpnI digestion with restriction enzyme template strands.
2. according to the method described in claim 1, it is characterised in that the existence form of the parental gene is unrestricted, can be with
For plasmid, genome, double chain DNA fragment or single-stranded cDNA.
3. method according to claim 1 or 2, it is characterised in that to build single-stranded mutant library, for parental gene
One or more targeted mutagenesis regions, separately design corresponding primer, referred to as edit primer；Editor's primer is containing in need
The mutating alkali yl introduced to Sudden change region and there is the sequence matched with template strand of suitable length at 3 ' and 5 ' ends respectively；It is related to multiple
During Sudden change region, each editor's primer is equidirectional, matches and combines with same template strand；Design two is same with editor's primer in addition
The anchor point primer in direction, wherein one is upstream anchor point primer, one is downstream anchor point primer, and the upstream anchor point primer contains
One section is held the nucleotide sequence matched with template strand 3 ', in addition, there be 15-25bp anchor point sequence at 5 ' ends of the upstream anchor point primer
Row；The downstream anchor point primer contains one section holds the nucleotide sequence matched with template strand 5 ', in addition, the downstream anchor point primer
There is 15-25bp anchor point sequence at 3 ' ends.
4. method according to claim 3, it is characterised in that need the site being mutated to be placed in the centre of editor's primer
Position, can carry out height degeneracy as needed.
5. method according to claim 3, it is characterised in that the anchor point primer, also has the function of editor's primer concurrently, i.e.,
While as anchor point primer, also containing the mutating alkali yl in need introduced to Sudden change region.
6. method according to claim 1 or 2, it is characterised in that the single-stranded mutant library and double chain mutation body text
Storehouse is built simultaneously, is the primer that the single-stranded mutant of specific bond is directly added into the PCR system for building single-stranded mutant library,
Side PCR obtains single-stranded mutant, while carrying out the amplified reaction of duplexed reaction and double chain mutation body by template of single-stranded mutant；
When single-stranded mutant library and double chain mutation body the library substep is built, directly with containing the PCR of single-stranded mutant library mixing
Thing is changed without reaction system as template, and the primer that the single-stranded mutant of specific bond is directly added thereto carries out the second wheel PCR
The complete double chain mutation body of total length is prepared, or to purify the single-stranded mutant library after reclaiming through post as template, is matched somebody with somebody again
Reaction system processed carries out second and takes turns the complete double chain mutation body of PCR preparations total length；To build double chain mutation body library, with single-stranded prominent
Variant is as template, and design matches for a pair with anchor point sequence or identical is drawn for the outer end of the single-stranded mutant of specific amplified
Thing, the single stranded DNA only undergone mutation can be combined with external primer.
7. method according to claim 1 or 2, it is characterised in that during screening mutant, will be double using assembled in vitro technology
Mutant is connected with carrier.
8. method according to claim 7, it is characterised in that described assembled in vitro technology is fusion DNA vaccine, Gibson groups
Dress, the polymerase-mediated recombinant techniques of T4DNA or internal yeast package technique.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510213073.3A CN104805508B (en) | 2015-04-29 | 2015-04-29 | A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510213073.3A CN104805508B (en) | 2015-04-29 | 2015-04-29 | A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104805508A CN104805508A (en) | 2015-07-29 |
| CN104805508B true CN104805508B (en) | 2017-07-14 |
Family
ID=53690687
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510213073.3A Active CN104805508B (en) | 2015-04-29 | 2015-04-29 | A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104805508B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789555A (en) * | 2015-04-29 | 2015-07-22 | 江南大学 | Method of expressing regulatory element based on evolution gene by synthesizing single-chain DNA library |
| WO2021190600A1 (en) * | 2020-03-25 | 2021-09-30 | 南京金斯瑞生物科技有限公司 | Automated gene assembly system and method |
| CN113981148A (en) * | 2021-11-18 | 2022-01-28 | 中国农业科学院哈尔滨兽医研究所（中国动物卫生与流行病学中心哈尔滨分中心） | Method for identifying RV infection and virus genotype and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1145641A (en) * | 1994-02-17 | 1997-03-19 | 阿菲马克斯技术公司 | DNA mutagenesis by random fragmentation and reassembly |
| WO2011089574A2 (en) * | 2010-01-22 | 2011-07-28 | Proteus | Methods of generating modified polynucleotide libraries and methods of using the same for directed protein evolution |
| CN104789555A (en) * | 2015-04-29 | 2015-07-22 | 江南大学 | Method of expressing regulatory element based on evolution gene by synthesizing single-chain DNA library |
| CN104789556A (en) * | 2015-04-29 | 2015-07-22 | 江南大学 | Method of carrying out rapid and efficient DNA combination and evolution based on synthesis of single-chain DNA library |
| CN104877977A (en) * | 2015-04-29 | 2015-09-02 | 江南大学 | Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library |
-
2015
- 2015-04-29 CN CN201510213073.3A patent/CN104805508B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1145641A (en) * | 1994-02-17 | 1997-03-19 | 阿菲马克斯技术公司 | DNA mutagenesis by random fragmentation and reassembly |
| WO2011089574A2 (en) * | 2010-01-22 | 2011-07-28 | Proteus | Methods of generating modified polynucleotide libraries and methods of using the same for directed protein evolution |
| CN104789555A (en) * | 2015-04-29 | 2015-07-22 | 江南大学 | Method of expressing regulatory element based on evolution gene by synthesizing single-chain DNA library |
| CN104789556A (en) * | 2015-04-29 | 2015-07-22 | 江南大学 | Method of carrying out rapid and efficient DNA combination and evolution based on synthesis of single-chain DNA library |
| CN104877977A (en) * | 2015-04-29 | 2015-09-02 | 江南大学 | Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104805508A (en) | 2015-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104789556A (en) | Method of carrying out rapid and efficient DNA combination and evolution based on synthesis of single-chain DNA library | |
| Abbasi et al. | Recombineering for genetic engineering of natural product biosynthetic pathways | |
| CN104805508B (en) | A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway | |
| CN109154001A (en) | Novel minimum UTR sequence | |
| CN104877977A (en) | Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library | |
| CN109750035A (en) | Target and guide the sgRNA of Cas9 albumen high efficiency cutting TCR and B2M locus | |
| CN109706148A (en) | A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer | |
| CN108300671A (en) | One plant of common fermentation xylose and glucose is with an industrial strain of S.cerevisiae strain of high yield xylitol and ethyl alcohol and construction method | |
| CN107759675A (en) | A kind of signal peptide and its application that secernment efficiency can be improved from bacillus subtilis | |
| CN111304258A (en) | Ndufs2 gene conditional point mutation mouse model and construction method and application thereof | |
| CN109486814A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN114317386B (en) | Genetic engineering strain for producing inosine and construction method and application thereof | |
| CN106282208B (en) | Crocus sativus and crocus sativus endophytic fungus GGPPS gene, gene cloning method and application | |
| CN104404077B (en) | A method of multiple foreign genes are cloned into microbial genome simultaneously | |
| CN109487005A (en) | For expanding the primer of the intranasal tumour virus whole genome sequence of goat region | |
| CN104878036B (en) | A kind of models fitting and genetic modification improve method and the application of protein expression efficiency | |
| CN103131718A (en) | Cloning of hypertonicity-resistant functional gene CgHog1 from Candida glycerinogenes and application thereof | |
| TW202330918A (en) | Circular rna and preparation method thereof | |
| CN111004813A (en) | Super-large plasmid construction kit, super-large plasmid construction method and application thereof | |
| JP3777158B2 (en) | Method for producing recombinant DNA library using unidirectional single-stranded DNA section | |
| WO2020018905A1 (en) | Materials and methods for creating strains of saccharomyces cerevisiae that exhibit an increased ability to ferment oligosaccharides | |
| CN103146753B (en) | Adenovirus vector and production method for same | |
| CN107475289A (en) | Apple necrosis mosaic virus full length infectious cDNA and its construction method | |
| CN104789555A (en) | Method of expressing regulatory element based on evolution gene by synthesizing single-chain DNA library | |
| CN112501199A (en) | Melon aphid yellowed virus infectious clone recombinant vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |