CN104805189B

CN104805189B - A kind of method of the specificity for determining hybrid plant new varieties, uniformity and stability

Info

Publication number: CN104805189B
Application number: CN201510150504.6A
Authority: CN
Inventors: 彭海; 张静; 陈红; 陈利红
Original assignee: Agriculture Ministry Technology Development Center; Jianghan University
Current assignee: Agriculture Ministry Technology Development Center; Jianghan University
Priority date: 2015-03-31
Filing date: 2015-03-31
Publication date: 2017-12-15
Anticipated expiration: 2035-03-31
Also published as: CN104805189A

Abstract

The invention discloses a kind of method of specificity for determining hybrid plant new varieties, uniformity and stability.This method includes：Obtain variant sites；Determine the test zone of kind to be measured；Build database；After determining amount of sampling, random sampling mixes and extracts the DNA of mixing sample；Prepare primer；Expanded using the DNA of primer pair mixing sample, amplified production is used to build high-throughput sequencing library；High-flux sequence is carried out to high-throughput sequencing library, obtains that fragment group is sequenced；Analysis sequencing fragment group, obtains variety and genetype to be measured and hybrid strain genotype；Compare and obtain approximate kind, variant sites and variant sites rate；By hybrid strain genotype compared with the genotype in database, after obtaining hybrid strain kind, hybrid strain rate is calculated；Using variant sites, variant sites rate and hybrid strain rate, varietY specificity, uniformity and stability to be measured are judged.Methods described can accurately, intactly judge the specificity, stability and uniformity of kind to be measured, and test speed is faster.

Description

A kind of method of the specificity for determining hybrid plant new varieties, uniformity and stability

Technical field

The present invention relates to biological technical field, more particularly to a kind of specificity, uniformity for determining hybrid plant new varieties With the method for stability.

Background technology

As a kind of intellectual property of specialization, new variety of plant has become a company and competing to a national core Strive power.The solution that new variety of plant authorizes account and relative legal problems is tested dependent on DUS, i.e. the specificity to kind to be measured (Distinctness), the field trapping test or molecules inside of uniformity (Uniformity) and stability (Stability) Marker Identification.Field trapping test flow is：Kind to be measured is planted in field simultaneously with approximate kind, in 2 years and the life of the above In long season, their multiple characters are observed, the significance of difference of the kind to be measured with approximate kind are judged according to trait expression, i.e., Specificity, while judge hybrid strain ratio in colony, i.e. uniformity and stability；The flow of molecules inside Marker Identification is：Divide single DNA of the kind to be measured with each sample in approximate kind is extracted in strain, and enters performing PCR to each test zone of each sample respectively (Polymerase Chain Reaction, polymerase chain reaction), and electrophoresis or generation sequencing inspection are carried out to each PCR primer Survey, according to testing result, obtain the difference site ratio of kind to be measured and approximate kind, according to difference site ratio, judge to treat Survey the specificity of kind.

The shortcomings that field trapping test is：Cycle is long, workload is big, environmental impact shape, causes to judge inaccuracy.It is indoor The shortcomings that molecular markers for identification is：Need to handle each test zone of each sample respectively, workload is big, it is impossible to sample with Test zone bulk sampling, hybrid strain rate can not be calculated, thus the test of stability and uniformity can not be carried out.Field trapping test Common drawback with molecules inside Marker Identification is：Due to workload is big, can not from existing kind objective selection Approximate kind, applicant can only be weighed by kind and provided, and the approximate product provided based on the motivations such as commercial interest, kind power applicant Kind may be untrue, so as to cause the legal consequence of wrong kind mandate.

The content of the invention

In order to solve the problems of the prior art, the embodiments of the invention provide a kind of spy for determining hybrid plant new varieties The method of the opposite sex, uniformity and stability.The technical scheme is as follows：

The embodiments of the invention provide the side of a kind of specificity for determining hybrid plant new varieties, uniformity and stability Method, methods described include：

Obtain the variant sites in kind between different cultivars belonging to kind to be measured；

The test zone of the kind to be measured is determined by the variant sites, the test zone includes universal test area Domain, at least partly described variant sites are included in the universal test region；

The database of genotype in all test zones of the structure comprising the different cultivars；

After the amount of sampling SN for determining the kind to be measured, random sampling mixes and extracts the DNA of mixing sample；

The primer for expanding the test zone is prepared, the primer includes universal test region primer；

Expanded using the DNA of mixing sample described in the primer pair, obtain the amplified production of the test zone, institute Amplified production is stated to be used to build high-throughput sequencing library；

High-flux sequence is carried out to the high-throughput sequencing library, obtains that fragment group is sequenced；

The sequencing fragment group is analyzed, obtains variety and genetype to be measured and hybrid strain genotype；

By the variety and genetype to be measured compared with the genotype of the different cultivars in the database, described in acquisition Approximate kind, variant sites and the variant sites rate of kind to be measured；

By the hybrid strain genotype compared with the genotype of the different cultivars in the database, hybrid strain kind is obtained Afterwards, hybrid strain rate is calculated；

Using the variant sites, the variant sites rate and the hybrid strain rate, the varietY specificity to be measured, one are judged Cause property and stability.

Specifically, the amount of sampling SN meets following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein BINOM.INV is the function in excel 2010, and M is described to take out to judge threshold value selected when the uniformity and stability Sample amount SN meet condition implication be：Even if the hybrid strain rate only exceeds the 15% of the judgment threshold M of uniformity and stability, institute Amount of sampling is stated in the case where 95% probability ensures, can correctly judge the stability and uniformity of the kind to be measured.

Specifically, the depth CF of the high-flux sequence meets following condition：BINOM.DIST(10,10,BI NOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >=99.9%, 1-BIN OM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, its In, CF is the depth of the high-flux sequence, and M is to judge threshold value selected when the uniformity and stability, BINOM.DIST is the function in excel 2010, and the condition implication that the depth CF of the high-flux sequence meets is：Described Hybrid strain rate as little as 0.1%, the hybrid strain kind are 10 and the hybrid strain kind averagely only has 20 with the product to be tested inter-species Under conditions of difference site, the detection that is determined by the depth CF of the high-flux sequence all the hybrid strain kinds probability >= 99.9%；Averagely only have 20 with the product to be tested inter-species in the kind of the database for 10000 and the hybrid strain kind Under conditions of difference site, the presence that is determined by the depth CF of the high-flux sequence judge by accident the probability of the hybrid strain kind≤ 0.1%；When the hybrid strain kind is that 10 and true hybrid strain rate exceed only the 10% of threshold value selected when judging specific, Correct probability >=95.0% of the judgement conclusion to stability and uniformity determined by the depth CF of the high-flux sequence.

Specifically, the test zone also includes non-universal test zone, and the primer also includes non-universal test zone Primer.

Further, the non-universal test zone primer includes the first primer and the second primer, the first primer bag The first forward primer and the first reverse primer are included, second primer includes the second forward primer and the second reverse primer, described First primer and second primer carry out individually amplification and obtain the amplified production of two non-universal test zones respectively, will The amplified production mixed in equal amounts of two non-universal test zones is used to build the high-throughput sequencing library individually expanded；

5 ' end connections of first forward primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1, described first 5 ' end connections in reverse primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；

5 ' end connections of second forward primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2, described second 5 ' end connections of reverse primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1.

Further, using the variant sites, the variant sites rate and the hybrid strain rate, the kind to be measured is judged The method of specificity, uniformity and stability includes：

When the variant sites be present in the variant sites rate >=non-universal test zones of SD or described, the product to be tested Kind there is specificity, as the variant sites rate ＜ SD and when the variant sites are not present in the non-universal test zone, For the kind to be measured without specificity, wherein SD is threshold value selected when judging specific；

As the hybrid strain rate≤M of the kind to be measured, the kind to be measured has uniformity and stability, when described When the hybrid strain rate of kind to be measured is more than ＞ M, the kind to be measured does not have uniformity and stability, and M is to judge described one Selected threshold value when cause property and stability；

The hybrid strain rate R=R1+R2-R3-R4+Rm, wherein：

Wherein, n1 be nucleus hybrid strain kind number, t1 For the number of all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds, i1j1 is the i-th 1 nucleus After all special hybrid strain karyogene types of hybrid strain kind sort from low to high by frequency, the special hybrid strain core base of jth 1 Because of type, R1i1j1 is the frequency of the i-th 1j1 special hybrid strain karyogene types；R1 is as described in calculating hybrid strain karyogene type The summation of the hybrid strain rate of nucleus hybrid strain kind, the hybrid strain rate of the nucleus hybrid strain kind are to remove the nucleus hybrid strain product In kind after the frequency of the special hybrid strain karyogene type of minimum 80% and highest 10%, the remaining special hybrid strain core 2 times of the average value of the frequency of genotype；

Wherein, t2 be possess except the nucleus hybrid strain kind described in The number of the hybrid strain karyogene type outside hybrid strain karyogene type and frequency >=0.17%, i2 are except the nucleus hybrid strain After all hybrid strain karyogene types outside the hybrid strain karyogene type that kind possesses sort from low to high by frequency, the i-th 2 The individual hybrid strain karyogene type, R2i2 are the frequency of the i-th 2 hybrid strain karyogene types；R2 is utilized except the nucleus is miscellaneous The hybrid strain rate that the hybrid strain karyogene type that strain kind possesses calculates, R2 are to remove except the nucleus hybrid strain kind possesses The hybrid strain karyogene type frequency in minimum 80% and highest 10% value after, 2 times of the average value of surplus value；

Wherein, n2 is the number of cytoplasm hybrid strain kind, R3i3 is the hybrid strain rate of the i-th 3 cytoplasm hybrid strain kinds, and t3 is all special of the i-th 3 cytoplasm hybrid strain kinds The number of hybrid strain matter genotype, i3j3 are that all special hybrid strain matter genotype of the i-th 3 cytoplasm hybrid strain kinds are pressed After frequency sorts from low to high, the special hybrid strain matter genotype of jth 3, R3i3j3 is the i-th 3j3 special hybrid strain matter The frequency of genotype；R3 is the summation of the hybrid strain rate of the cytoplasm hybrid strain kind calculated by hybrid strain matter genotype, described thin The hybrid strain rate of kytoplasm hybrid strain kind is to remove the spy of 80% and highest 10% minimum in the cytoplasm hybrid strain kind After the frequency of different hybrid strain matter genotype, the average value of the frequency of the remaining special hybrid strain matter genotype；

Wherein, t4 be possess except the cytoplasm hybrid strain kind described in The number of the hybrid strain matter genotype outside hybrid strain matter genotype and frequency >=0.17%, i4 are except the cytoplasm hybrid strain After all hybrid strain matter genotype outside the hybrid strain matter genotype that kind possesses sort from low to high by frequency, the i-th 4 The individual hybrid strain matter genotype, R4i4 are the frequency of the i-th 4 hybrid strain matter genotype；R4 is utilized except the cytoplasm is miscellaneous The hybrid strain rate that the hybrid strain matter genotype that strain kind possesses calculates, R4 is to remove the institute possessed except the cytoplasm hybrid strain kind After the value for stating 80% and highest 10% minimum in the frequency of hybrid strain matter genotype, the average value of surplus value；

Wherein, t5 is the number of the special test zone of hybrid；I5 is described miscellaneous for the i-th 5 The special test zone of kind；Rmi5 is in the i-th 5 special test zone of hybrid, the frequency of female genotype；Rfi5 is the i-th 5 In the individual special test zone of the hybrid, the frequency of male parent gene type；Rm is the hybrid strain rate of maternal selfing, and Rm is that the hybrid is special In different test zone, the average value of the frequency of the female genotype and the difference of the frequency of the male parent gene type；

Int () is bracket function；

The nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained, the cytoplasm merely with karyogene type Hybrid strain kind refers to calculate the hybrid strain kind obtained merely with matter genotype；The special hybrid strain karyogene type refers to All hybrid strain karyogene types of one nucleus hybrid strain kind；The special hybrid strain matter genotype refers to only one All hybrid strain matter genotype of the cytoplasm hybrid strain kind；The hybrid strain karyogene type refers to that the hybrid strain genotype is The karyogene type；The hybrid strain matter genotype refers to that the hybrid strain genotype is the matter genotype；It is special in the hybrid In test zone, the female genotype differs with the male parent gene type, the female genotype and all cells The genotype of core hybrid strain kind is different, and the genotype of the male parent gene type and all nucleus hybrid strain kinds is not yet Together；The female genotype is the genotype identical genotype with female parent in the kind to be measured；The male parent gene type is In the kind to be measured, the genotype identical genotype with male parent；

The karyogene type refers to the genotype on nuclear genome；The matter genotype refers to be located at cytoplasm base Because of the genotype in group.

Further, methods described also includes the uniformity and stability for judging the kind to be measured in the following ways The correct probability of conclusion is：When the kind to be measured has uniformity and stability, the correct probability of conclusion >= BINOM.DIST(M*SN,SN,R,TRUE)*BINOM.DIST(ΣSeN*M,ΣSeN,R,TRUE)；When the kind to be measured not With the uniformity and during stability, the correct probability >=BINOM.DIST of conclusion ((1-M) * SN, SN, (1-R), TRUE) * BINOM.DIST(ΣSeN*(1-M),ΣSeN,1-R,TRUE)；Wherein, M is selected when the uniformity and stability to judge Threshold value, Σ SeN are all sequencings for being used for the test zones where calculating the frequencies of the genotype of the hybrid strain rate R The summation of fragment, BINOM.DIST (M*SN, SN, R, TRUE) are that the kind to be measured has carried out SN sampling, are actually pumped The hybrid strain rate R is less than the probability of the threshold value M, and BINOM.DIST (Σ SeN*M, Σ SeN, R, TRUE) meaning is：To institute State kind to be measured and carried out SeN sampling of Σ, the hybrid strain rate R being actually pumped is less than threshold value M probability；BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) has carried out SN time for the kind to be measured and sampled, and the hybrid strain rate R being actually pumped is big In the probability of the threshold value M, BINOM.DIST (Σ SeN* (1-M), Σ SeN, 1-R, TRUE) meaning is：To the product to be tested Kind has carried out SeN sampling of Σ, and the hybrid strain rate R being actually pumped is more than threshold value M probability, and the frequency of the genotype refers to In the sequencing fragment group, the sequencing segments for representing the genotype accounts for the sequencing of the test zone where the genotype The ratio of fragment sum.

Further, when the variant sites are not present in the non-universal test zone, if judging the kind to be measured With specificity, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD, TR UE)；If treated described in judging Kind is surveyed without specific, the correct probability >=BINOM.DIST (SD*TRN, TRN, OD, TRUE) of conclusion, wherein, TRN is Detect the number of successful test zone, OD is the variant sites rate, and BINOM.DIST is the function in excel 2010, institute State the correct probability of conclusion to be expressed as when judging that the kind to be measured has specific, the variant sites rate is general more than SD's Rate, when judging that the kind to be measured does not have specific, the variant sites rate is less than SD probability, and the detection is successful Test zone after analyzing the sequencing fragment group by obtaining.

Specifically, obtaining the method for the hybrid strain kind includes：The hybrid strain kind is to be present in the database Kind, and the potential hybrid strain genotype of the hybrid strain kind is with there is the test section of phase homogenic type between the hybrid strain genotype The number in domain accounts for total ratio >=60% that the hybrid strain kind has the test zone of the potential hybrid strain genotype； The hybrid strain genotype refers to the potential hybrid strain genotype of frequency >=0.02%；

Quantity >=2 of distinguishing base between all genotype of the potential hybrid strain genotype and the kind to be measured or There are insertion or the missing of discontinuous base in the distinguishing base.

Specifically, the method for determining the universal test region by the variant sites is：Pass through discriminationThe value of discrimination is calculated, wherein, a is the kind sum being detected in variation window area, and bi is The kind number of i-th kind of genotype in the variation window area, and bi>1, k is the number of the genotype comprising more than a kind Mesh, the variation window area is centered on each single nucleotide variations site, to the two of the single nucleotide variations site Side respectively extends 1/2 window as detection for surveying sequence length；

The universal test region is the area on the region that discrimination is big on cytoplasmic skeleton or nuclear genome Index big and equally distributed region.

The beneficial effect that technical scheme provided in an embodiment of the present invention is brought is：Method provided in an embodiment of the present invention passes through High-flux sequence and the amplification of more sites, realize large sample sampling and the large sample of the test zone of each individual of kind to be measured Sampling, recycle the comprehensive means such as hybrid strain genotype and hybrid strain rate, successfully realize it is accurate, intactly judge kind to be measured The target of specificity, stability and uniformity, and test speed is faster, can be completed within 10 days.

Embodiment

To make the object, technical solutions and advantages of the present invention clearer, embodiment of the present invention will be made into one below It is described in detail on step ground.

Embodiment one, measure new rice variety ' the excellent 8377' of section specificity, uniformity and stability

For rice varieties, " section excellent 8377 ", " section excellent 8377 " is rice product to rice varieties to the kind to be measured that the present embodiment provides Plant " R8377 " and " Jin Ke 1A " cross combination, above kind are kind known to disclosure.Determine the special of the rice varieties The method of property, uniformity and stability comprises the following steps.

First, the variant sites belonging to kind to be measured in kind between different cultivars are obtained.

The kind of kind to be measured is rice, therefore, obtains the variant sites belonging to kind to be measured in kind between different cultivars and then should To obtain the variant sites between different rice varieties, the variant sites between different rice varieties can be from the documents and materials announced Middle acquisition, but the results contrast that this method is obtained is fragmentary, in the present embodiment, by by the genome sequence of different rice with It is compared with reference to the genome sequence of rice varieties, the variant sites between substantial amounts of different rice varieties is obtained, wherein joining It can be " Japanese eyeball " rice to examine rice varieties, and " Japanese eyeball " rice could alternatively be other known and refer to rice varieties.

Further, the method for obtaining the genome sequence of different rice varieties is as follows：

The genome sequence of the different rice varieties of the present embodiment shows three kinds of sources, and the first is Han Bin to 1082 rice The high-flux sequence sequence of the genome of kind, pertinent literature information are as follows：Huang XH et al.A map of rice genome variation reveals the origin of cultivated rice.Nature.2012；7:497–503. The genome sequence of 1082 rice varieties is published in European NucleotideArchive (http:// Www.ebi.ac.uk/ena/), reception number is ERP001143, ERP000729 and ERP000106；Second be Xu Xun to 50 The high-flux sequence sequence of the genome of rice varieties, pertinent literature information are as follows：Xun X et al.Resequencing 50accessions of cultivated and wild rice yields markers for identifying agronomically important genes.Nat Biotechnol.2011,30(1):105-11,50 rice varieties Genome sequence be published in NCBI Short Read Archive (http://www.ncbi.nlm.nih.gov/sra), connect Collect the digits for SRA023116；The third be by the method provided in the above-mentioned articles delivered of Han Bin to " R8377 ", " Jin Ke 1A ", " " D excellent 527 " has carried out high-flux sequence to Jin Ke 1A/R7723 " with hybrid strain kind for " IRBB23 ", cenospecies.The present embodiment obtains altogether The high-flux sequence sequence of the genome of 1137 rice varieties.

Further, variant sites are obtained using the genome sequence of different cultivars.

Specifically, because the sequencing depth of this 1137 rice varieties is not high, it is only capable of identifying single nucleotide variations (SNP) Site, other variation types are as repeated number variation, due to a low credibility, without identification.Utilize Frederick Sanger ratios " Japan is compared respectively by the high-flux sequence sequence of the genome of this 1137 rice varieties to software (version number 0.4) (version is IRGSP 4.0 to eyeball " rice cell core reference gene group, download address：http://www.ncbi.nlm.nih.gov) In cytoplasm reference gene group, the cytoplasm reference gene group includes mitochondria reference gene group and chloroplaset reference gene Group, it is in NCBI (National Center for Biotechnology Information, US National biotechnology letter Breath center) on reception number be respectively NC_011033 and NC_001320.During contrast, Insert Fragment length is set to 500bp, other Parameter setting is default value.The Ssaha Pileup software kits (version number 0.5) used identify the SNP positions of each rice varieties Point.The SNP site is defined as base-pair, the insertion of single base or the missing of single base of difference determination.The alkali that the difference determines For base to referring to not include the uncertain base-pair of difference, the uncertain base-pair of difference refers to the base between some degeneracy bases It is right, as R represents A or G, therefore, difference is there may be between A and R, it is also possible to which, in the absence of difference, therefore, difference is failed to understand between A and R Really, SNP it is not mutually.Therefore, the SNP site in the present embodiment is not include the uncertain base-pair of above-mentioned difference.By above SNP The definition in site, the present embodiment obtains 7236888 SNP sites altogether between all 1137 rice varieties, wherein 59503 SNP site is located on cytoplasmic skeleton, and remaining SNP site is located on nuclear genome.Genotype referred to hereafter is Refer to the combination of multiple SNP sites in test zone, karyogene type refers to genotype and is located on nuclear genome, and matter genotype is Refer to genotype to be located on cytoplasmic skeleton.For example, the 8th test zone is located on nuclear genome in table 1, it is karyogene Type, the test zone share 9 SNP sites, and the genotype of the test zone is the combination of this 9 SNP sites.

2nd, the test zone of kind to be measured is determined by variant sites, test zone includes universal test region, at least portion Variant sites are divided to be included in universal test region, its method includes：

Determine universal test region

Universal test region be on cytoplasmic skeleton on the big region of discrimination or nuclear genome discrimination it is big and The equally distributed region of SNP site, wherein, discriminationWherein, a is tested in variation window area The kind sum measured, bi are the kind number of i-th kind of genotype in variation window area, and bi>1, k is to include more than 1 product The number of the genotype of kind, variation window area are centered on each single nucleotide variations site, to single nucleotide variations position The both sides of point respectively extend 1/2 window as detection for surveying sequence length.The Computing Principle of discrimination is as follows：It is all interracial Number of combinations isWherein, the combination between the different cultivars in same gene type is undistinguishable, and its number isThat , the ratio for the breed combination that can not be distinguished isThe ratio for the breed combination that can be distinguished i.e. discrimination As can be seen here, discrimination is bigger, can more distinguish different cultivars, the big variation window of discrimination Region is tested DUS more effective.If the test zone skewness on nuclear genome, some regions can be caused adjacent, So as to linkage inheritance, information is easily overlapping, and therefore, the principle of compositionality in universal test region is selected on nuclear genome is：Area Indexing is big and SNP site is uniformly distributed.Cytoplasmic skeleton without linkage inheritance problem, so, on cytoplasmic skeleton only need The big region of selective discrimination degree.

High-flux sequence is carried out using Proton high-flux sequences instrument in the present embodiment, the test zone length of detection is sequenced in it Degree can reach 200bp, and in order to obtain maximum fault information, the most long test zone in the present embodiment is also 200bp.Therefore, this reality Apply the variant sites that example is mentioned to be located in whole test zone, the variant sites may include multiple SNP sites.

First, centered on each SNP site of acquisition, respectively extend 99bp and 100bp to the left and right, form 200bp change Different window.According to the 7236888 of acquisition SNP sites, 7236888 variation windows can be obtained, calculate these variation windows The discrimination in regionFor example, in the 1st variation window area, a=520 kind is detected altogether, altogether There are k=3 kind genotype ACCT, CGTT, ACCC, their kind number is respectively b1=10, b2=30 and b3=431, Therefore, It is meant that：, can be by 520 by the 1st variation window area 31% breed combination in kind distinguishes, and 79% breed combination cannot be distinguished by out, it is necessary to the window that more makes a variation in addition It can just distinguish.After the same method, calculate to obtain all discriminations of 7236888 variation windows and therefrom choose and be located at In nuclear genome 6800 maximum variation windows of discrimination and discrimination is maximum in cytoplasmic skeleton 200 Make a variation window.Check one by one in 6800 variation windows of nuclear genome, each make a variation window and next variation Distance between window, if distance exceed 100K (1K=1000 base), abandon wherein discrimination it is less make a variation window it After reexamine, until it is adjacent look into variation window distance be all higher than 100K untill.Selection 100K criterion distance is because rice Genome Size is about 500M (ten thousand bases of 1M=100), by final selected 2000 general surveys for being located at nuclear genome Region meter is tried, the interregional distance of average universal test is 250K, but due to few changes such as some specific regions such as centromeres Ectopic sites, therefore, average distance should be less than 250K.By the above process, 4061 changes for being located at nuclear genome be have selected Different window, their totally 4261 changes together with 200 that are located at discrimination maximum in the cytoplasmic skeleton windows that make a variation of acquisition Different window is as selected universal test region.Wherein, 200 maximum variation windows of selective discrimination degree, are empirical value, the number Amount can modify as the case may be.

The test zone can also include non-universal test zone.

Determine non-universal test zone

Non-universal test zone refers to the special site that special kinds needs detect.DUS tests need to detect fixed point transformation Special site, fixed point transformation is the technological means commonly used in modern breeding, and such as back cross breeding, transgenic breeding, fixed point changes Specificity can also be had because of it and turn into new varieties by making kind.It is non-universal based on the specific decision principle of New variety protection Test zone should not be included in universal test region and the site of qualitative character is controlled for known to.

In the present embodiment, the gene Xa23 of high bacterial leaf spot resistant is present in database kind IRBB23, the control of Xa23 genes Bacterial leaf spot resistance be qualitative character, and Xa23 derives from wild rice, is not included in universal test region.Managed based on more than By being detected Xa23 genes as non-universal test zone, Xa23 genes have been cloned, and its resistance is lacked by 7 bases Mistake causes, and therefore, the special detection region of kind to be measured is the base of this 7 missings, and it is located at Japanese eyeball reference gene group 24046820 to 24046825 of upper 11st chromosome, the more detailed information on Xa23 genes is shown in：Wang,C., X.Zhang,et al.(2014)."XA23is an executor R protein and confers broad-spectrum disease resistance in rice."Molecular plant:ssu132.

3rd, the primer in amplification assay region is prepared, the primer includes universal test region primer, specific as follows：

Universal test region primer is prepared, the universal test region primer is directed to all kinds, specifically：

Universal test region is detected using multiple PCR technique, and multiple PCR technique refers in same PCR reacts Add multiple PCR primers, while multiple sites in amplification gene group.The key of the technology is to design and synthesize multiplex PCR to draw Thing, the multiple PCR technique that the present embodiment is provided using match Mo Feishier companies of the U.S., it can set up to 12000 weight PCR to draw Thing.

Primer acquisition process is as follows：Log in match Mo Feishier company multiple PCR primer Photographing On-line webpage https:// Ampliseq.com/protected/help/pipelineDetails.action, relevant information is submitted by its requirement. In the present embodiment, " Application type " options select " DNA Hotspot designs (single-pool) ".If Multi-pool is selected, then multiplex PCR will divide multitube to carry out, and cost can increased, and single-pool primer only needs Multiplex PCR, cost is saved, shortcoming is that some universal test regions design of primers may fail, but on genome Alternative universal test region is more, therefore, abandons some alternative universal test regions and has no effect on result.By kind to be measured Nucleus reference gene group and cytoplasm reference gene group permeate file, and in " Select the genome you After " Custom " being selected in wish to use " options, reference base when uploading the file of fusion as design multiple PCR primer Because of group." Standard DNA ", in Add Hotspot options, addition needs the general survey designed to the selection of DNA type options The positional information of the SNP site in region, including chromosome information, SNP initiation site and SNP end locus are tried, Its certain embodiments is shown in Table 1.Finally click on the " multiple PCR primer that Submit targets " buttons are submitted and designed.This reality Apply in example, from the above-mentioned 4261 universal test regions obtained, design and be successfully authenticated 2231 pairs of multiple PCR primers, use In the corresponding 2231 universal test regions of amplification.The method for verifying multiple PCR primer is by method provided by the invention, extraction Leaves genomic DNA on same strain rice, and using design multiple PCR primer the genomic DNA of acquisition is expanded, Build storehouse, high-flux sequence and analyze sequencing fragment group, remove the corresponding primer of following test zone：The sequencing piece of the test zone Hop count is less than 1000 or hybrid strain genotype be present, and the primer remained is the multiple PCR primer being proved to be successful.Due to gene Group DNA derives from same strain rice leaf, it is impossible to hybrid strain kind be present, therefore, hybrid strain genotype is the spy by test zone PCR caused by different structure or sequencing Preference mistake, remove these test zones and avoid such system mistake.It is proved to be successful Multiple PCR primer is supplied to client to use in fluid form after also being mixed by the said firm.Above-mentioned successful design multiplex PCR 2231 universal test regions of primer are the universal test region eventually for kind to be measured detection, meanwhile, the number of structure Above-mentioned 2231 universal test regions are also contains according to each kind in storehouse, wherein, 100 universal test regions are located at cell On matter genome, remaining 2131 universal test regions are located on nuclear genome.

It should be noted that：The number requirement >=900 in universal test region, reason is as follows：If less than 900, exist The probability of the hybrid strain kind of erroneous judgement will be more than 1%, and the projectional technique of the threshold value is shown in Table 2.Due to there may be the survey of detection failure Region is tried, therefore, test zone number is general >=and 1000.

Test zone primer can also include the primer of non-universal test zone, and the non-universal test zone primer is for treating Kind is surveyed, test zone primer can also include non-universal test zone primer, specific as follows：

The primer of non-universal test zone includes the first primer and the second primer, the first primer include the first forward primer and First reverse primer, the second primer include the second forward primer and the second reverse primer, and the first primer and the second primer enter respectively Individually amplification obtains the amplified production of two non-universal test zones to row, by the amplified production equivalent of two non-universal test zones It is mixed for building the high-throughput sequencing library individually expanded.The 5' ends of first forward primer are connected just like SEQ ID in sequence table NO:Sequence 1 shown in 1, the 5' ends in the first reverse primer are connected just like SEQ ID NO in sequence table:Sequence 2 shown in 2；The The 5' ends of two forward primers are connected just like SEQ ID NO in sequence table:Sequence 2 shown in 2, the 5' ends connection of the second reverse primer Just like SEQ ID NO in sequence table:Sequence 1 shown in 1.

The design process of non-universal test zone primer is as follows：The first step, it is no more than 200bp and comprising non-by amplification length The requirement of all SNP sites in universal test region, by common PCR primers design method, design expands non-universal test zone PCR forward primer and reverse primer；Second step, the 5' ends of designed forward primer and reverse primer are connected into sequence respectively SEQ ID NO in list:1 and sequence table in SEQ ID NO:2, the forward primer and first primer of the first primer are obtained respectively Reverse primer；3rd step, SEQ ID NO in catenation sequence table are distinguished at the 5' ends of designed forward primer and reverse primer:2 With SEQ ID NO in sequence table:1, the forward primer of the second primer and the reverse primer of the second primer are obtained respectively.In sequence table SEQ ID NO:1 and sequence table in SEQ ID NO:2 be the joint sequence used in high-flux sequence, thereby using PCR primer band There is the joint sequence of high-flux sequence, after establishing sequencing library after directly being mixed with the product in the general sequencing region of amplification Together be sequenced, without by fragmentation, jointing etc. it is cumbersome build storehouse step, improve operating efficiency and reduce into This.It is to be sequenced from the both ends of non-universal test zone simultaneously to make two pairs of only different primers of joint.

Specifically, in the present embodiment, it is designed to be used to expand the non-universal test zone of kind to be measured (Xa23 genes) The forward primer sequence of common PCR primers is：TGCGGCATCACTAACATCAG, reverse primer sequences are： TGTTAGTGATGCGGGAGGAA.SEQ ID NO in sequence table are added respectively to its both ends:1 and sequence table in SEQ ID NO:2 The forward primer of the first primer formed afterwards is：5'- SEQ ID NO in CCATCTCATCCCTGCGTGTCTCCGACTCAGTGCGGCATCACTAACATCAG such as sequence table:3；First The reverse primer of primer is：SEQ in 5'-CCTCTCTATGGGCAGTCGGTGATTGTTAGTGATGCGGGAGGAA such as sequence table ID NO:4；The forward primer of second primer is：5'-CCTCTCTATGGGCAGTCGGTGATTGCGGCATCACTAACATCAG is such as SEQ ID NO in sequence table:5；The reverse primer of second primer is：5'- SEQ ID NO in CCATCTCATCCCTGCGTGTCTCCGACTCAGTGTTAGTGATGCGGGAGGAA such as sequence table:6.It is set The non-universal test zone primer of meter is matched Mo Feishier companies by the U.S. and synthesized.

4th, the method for the database of genotype in all test zones of the structure comprising different cultivars is as follows：

The database of genotype in all test zones of the structure comprising different cultivars, specifically, in kind to be measured On test zone, different cultivars is obtained to genotype that should be on test zone and composition data storehouse.This example obtains 2231 universal test region primers and 1 non-universal test zone primer, amplification region corresponding to them is kind to be measured Test zone.The database of the genotype of 2232 test zones of the structure comprising 1137 kinds and its SNP positional information, Partial results are shown in Table 1.

Table 1 is the part of database variety and genetype and its position, variety and genetype to be measured, hybrid strain genotype and its frequency Example

'-' represents the position of the SNP site and lacked in reference gene group in table 1；"/" represents that the test zone is heterozygosis Genotype, the different genotype of "/" both front and back be present；In addition to ATGC, other letters represent degeneracy base.If genotype entirely by Degeneracy base N is formed, and claims corresponding test zone genotype and SNP shortage of data, genotype or SNP and any genotype of missing Or SNP makees indifference processing when comparing.Can be by the method Test database of detection variety and genetype to be measured provided by the invention The genotype of kind and completion missing.

The present embodiment does not list all database content completely as space is limited, only lists wherein 5 kinds The information of 10 test zones.Equally limited based on length, also have some areas also only to list part in the present embodiment related real Example, remaining unlisted data can be according to the method completion of the present embodiment.

5th, after the amount of sampling SN for determining kind to be measured, random sampling mixes and extracts the DNA of mixing sample, and method is as follows：

Calculate kind amount of sampling to be measured

Amount of sampling SN should meet following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein, BINOM.INV For the function in excel 2010, its application method is identical with the definition in excel 2010, and its implication is so that accumulation binomial The functional value of distribution is more than or equal to the smallest positive integral of critical value.Amount of sampling SN meet condition implication be：Even if hybrid strain rate is only Beyond the 15% of threshold value M, the amount of sampling in the case where 95% probability ensures, can correctly judge the stability of kind to be measured with it is consistent Property.M values artificially determine according to conditions such as crop species, type, specific requirements.In Ministry of Agriculture's New variety protection office In the issue of room《New variety of plant specificity, uniformity and stability test guide-rice》Middle regulation：Hybrid rice seed uses 1% population norms, therefore, in the present embodiment, M values are used as from median 1%.After progressively increasing SN values, above-mentioned public affairs are calculated Formula is found, as SN >=12000, BINOM.INV (SN, 1%, 0.95)/SN≤1.15*1% is set up.Therefore, in the present embodiment Sample to be tested amount of sampling should >=12000.

Random sampling mixes and extracts the DNA of mixing sample

In the present embodiment, 50000 germinations are have chosen, 30000 buds being substantially equal to the magnitudes is randomly selected and mixes It is placed in after conjunction in mortar, powder is fully ground into after adding liquid nitrogen into mortar.Given birth to using Beijing Tiangeng biochemical technology Co., Ltd The article No. of production is that DP305 plant genome DNA extracts kit is extracted and obtains the DNA of kind mixing sample to be measured, and DNA is carried Method is taken to be carried out by the operation manual of the kit.Utilize the production of Invitrigen companies of the U.S. dsDNA HS Assay Kit (article No. Q32852) and its specification quantify to the DNA of acquisition, and the kind DNA to be measured after quantifying is dilute It is interpreted as 10.00ng/ μ l.

6th, expanded using the DNA of primer pair mixing sample, obtain the amplified production of test zone, amplified production is used In structure high-throughput sequencing library, wherein primer includes universal test region primer and the high-flux sequence text in universal test region Storehouse, specific method are as follows：

High-throughput sequencing library includes：The high pass of the high-throughput sequencing library in universal test region and non-universal test zone Sequencing library is measured, in the present embodiment, builds the high-throughput sequencing library of universal test region and non-universal test zone respectively, The two is mixed, obtains the high-throughput sequencing library of all test zones.

The method for building the high-throughput sequencing library in universal test region is as follows：

Utilize library construction Kit 2.0 (production of Mo Feishier companies, article No. 4475345 are matched by the U.S.) multiplex PCR After expanding universal test region, high-throughput sequencing library is built using amplified production.The kit includes following reagent：5×Ion AmpliSeq^TMHiFi Mix, FuPa reagents, transferring reagent, sequence measuring joints solution and DNA ligase.The method of library construction is pressed The operation manual of the kit《Ion AmpliSeq^TMLibrary Preparation》(publication number：MAN0006735, version： A.0) carry out.It is as follows by 2231 universal test regions of multiplexed PCR amplification, the amplification system of multiplex PCR：5×Ion AmpliSeq^TMμ l of HiFi Mix 4, μ l of universal test region primer mixed liquor 4 prepared, the DNA 10ng and nothing of kind to be measured The μ l of enzyme water 11.The amplification program of multiplex PCR is as follows：99 DEG C, 2 minutes；(99 DEG C, 15 seconds；60 DEG C, 4 minutes) × 25 circulations；10 DEG C insulation.After primer unnecessary in multiplexed PCR amplification product is digested using FuPa reagents, then carry out phosphorylation, specific method For：2 μ L FuPa reagents are added into the amplified production of multiplex PCR, after mixing, are reacted in PCR instrument by following program：50 DEG C, 10 minutes；55 DEG C, 10 minutes；60 DEG C, 10 minutes；10 DEG C of preservations, obtain mixture a, and mixture a is containing by phosphorylation Amplified production solution.By the upper sequence measuring joints of amplified production connection of phosphorylation, specific method is：Conversion is added into mixture a μ L of reagent 4, the μ L of sequence measuring joints solution 2 and the μ L of DNA ligase 2, after mixing, reacted in PCR instrument by following program：22 DEG C, 30 Minute；72 DEG C, 10 minutes；10 DEG C of preservations, obtain mixed liquor b.Dissolved after purifying mixed liquor b using the ethanol precipitation methods of standard In 10 μ L without in enzyme water.Utilize the production of Invitrigen companies of the U.S.(article No. is dsDNA HS Assay Kit Q32852) and according to its specification it is measured, and after obtaining mixed liquor b mass concentration, mixed liquor b after purification is diluted To 15ng/ml, the high-throughput sequencing library in concentration about 100pM universal test region is obtained.

The method for building the high-throughput sequencing library of non-universal test zone is as follows：

Using the DNA of kind to be measured as template, the first primer of the non-universal test zone prepared using the above method and the Two primers carry out independent PCR amplifications respectively, and the high-flux sequence text of non-universal test zone is obtained after mixed in equal amounts amplified production Storehouse.Concrete operations are pressed《Ion Amplicon Library Preparation(Fusion Method)》(publication number： 4468326) carry out, substantially process is as follows：The forward primer of first primer and reverse primer are dissolved as with water to 10 μM of concentration Afterwards, isometric mixing, obtains the first primer solution.It is formulated as follows PCR reaction systems：μ L of first primer solution 1,30ng products to be tested Kind DNA and PCR high-fidelities mixture (invirtrigen companies of the U.S. produce, article No. 12532016) 45 μ L, after mixing, Reacted in PCR instrument by following program：94 DEG C, 3 minutes；(94 DEG C, 30 seconds；58 DEG C, 30 seconds；68 DEG C, 1 minute) × 40 circulations；4 DEG C insulation.Pcr amplification product is dissolved in 10 μ L water after purification by the method for the ethanol precipitation of standard, utilizes the reagents of DNA 1000 On the biological analyser (model 2100) that box (article No. 5067-1504) produces in Agilent company of the U.S., by the kit After specification determines and obtains the molar concentration of amplified production, 200pM, as the first primer amplified production are diluted to.Using Identical method, obtain the amplified production for the second primer that concentration is 200pM.By the amplified production of the first primer and the second primer Amplified production mix in equal volume, obtain concentration be 100pM non-universal test zone high-throughput sequencing library.

Obtain the high-throughput sequencing library of all test zones

In universal test region number and non-universal test zone number ratio mixing equimolar concentration it is general The high-throughput sequencing library of the high-throughput sequencing library of test zone and non-universal test zone, obtained mixture are all The high-throughput sequencing library of test zone.In the present embodiment, the high-throughput sequencing library in the universal test region of acquisition is taken After the high-throughput sequencing library of 2231 μ L and the 1 non-universal test zones of μ L mixes, all test zones that concentration is 100pM are obtained High-throughput sequencing library.

7th, high-flux sequence is carried out to high-throughput sequencing library, obtains that fragment group is sequenced, specific method is as follows：It is it is determined that high Flux sequencing depth CF principle：The depth CF of high-flux sequence meets following condition：BINO M.DIST(10,10, BINOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >=99.9%, 1-BINOM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * C F, 10*CF, 1-110%*M, TRUE) >=95.0%, its In, CF is the depth of high-flux sequence, and M is to judge threshold value selected when uniformity and stability, namely average each test The capped multiple in region, BINO M.DIST are the function in excel 2010, and its application method in excel 2010 with determining Justice is identical, and what it was returned is the probability of binomial distribution.The meaning of three functions is：In hybrid strain rate as little as 0.1%, hybrid strain product Under conditions of kind up to 10 and hybrid strain kind and product to be tested inter-species averagely only 20 difference sites, determined by high-flux sequence depth Probability >=99.9% of the fixed whole hybrid strain kinds of detection；In database kind up to 10000 and hybrid strain kind and product to be tested Under conditions of inter-species averagely only 20 difference sites, the presence that is determined by high-flux sequence depth judge by accident the probability of hybrid strain kind≤ 0.1%；It is wide in variety up to 10 and when true hybrid strain rate exceeds only the 10% of threshold value selected when judging specific in hybrid strain, by Correct probability >=95.0% of the judgement conclusion to stability and uniformity that high-flux sequence depth determines.Conditions above is very Strictly, therefore, true effect is better than above-mentioned threshold value.The projectional technique of above probability is shown in Table 2.

Table 2 is the computational methods of the present embodiment dependent probability

Table 2 is that the tables of data of Excel 2010, its function, cell etc. is identical with Excel 2010 definition.Wherein, " judging threshold value selected when uniformity and stability (M) " for cell B2, other cell numberings are pressed using B2 as reference Excel 2010 rule defines, such as the cell where " hybrid strain rate (R) " adds 4 rows 1 on the basis of B2 and arranged, therefore Numbering is C6, and other cell coding rules are identical with this.

The determination method of the present embodiment high-flux sequence depth is：After M=1% is substituted into above three formula, progressively add It during big sequencing depth CF to 2783, can set up above three equation, therefore, the present embodiment sequencing depth is defined as >=2783 Times.

High-flux sequence is carried out using high-throughput sequencing library

Utilize the high-throughput sequencing library and kit Ion PI Template OT2 of all test zones of acquisition 200Kit v2 (invirtrigen companies of the U.S. produce, article No. 4485146) be sequenced before ePCR (Emulsion PCR, emulsion polymerization enzyme chain reaction) expand, operating method is carried out by the operation manual of the kit.Utilize ePCR products and reagent Box Ion PI Sequencing 200Kit v2 (invirtrigen companies of the U.S. produce, article No. 4485149) are in Proton High-flux sequence is carried out on two generation high-flux sequence instrument, operating method is carried out by the operation manual of the kit.In the present embodiment In, high-flux sequence flux is arranged to average 30000 times of coverage test region.

A large amount sequencing result is pre-processed

First determine whether high-flux sequence the quality of data whether >=Q20, if<Q20 (this situation is few), then as stated above High-flux sequence is re-started, until quality requirement reaches Q20 standards, Q20 standards, which are met in table 2, " to be sequenced wrong to be specific The requirement of the probability of base "≤0.33%.The high-flux sequence fragment for being up to quality requirement is compared to all 2232 tests Region, remove after comparing the unsuccessful and infull sequencing fragment of genotype detection, remaining all sequencing fragments are referred to as piece is sequenced Section group.The incomplete sequencing fragment of genotype detection refers to could not be by table 1 shown in " positions of the SNP in reference gene group " The reason for all SNP sites detect sequencing fragment, and genotype detection is not complete is that sequencing fragment is too short, compares unsuccessful reason It is that sequencing fragment is mostly non-specific amplification product.

8th, analysis sequencing fragment group, obtains variety and genetype to be measured and hybrid strain genotype, method is as follows；

Sequencing fragment group is compared and arrives all test zones, and counts the sequencing segments in each test zone, is removed The test zone of segments≤1000 is sequenced, remaining test zone is the successful test zone of detection.In the present embodiment, 2030 successful test zones of detection are obtained altogether.The fragment for comparing test zone is referred to as the sequencing fragment of the test zone, The base composition that the position in table 1 shown in " positions of the SNP in reference gene group " is extracted from sequencing fragment is referred to as the sequencing The genotype of fragment.The frequency of genotype refers to be sequenced in fragment group, and the sequencing segments for representing the genotype accounts for the genotype The ratio of the sequencing fragment sum of place test zone.The genotype of frequency >=30% is referred to as variety and genetype to be measured.It is general next To say, in the sample extracted, for the amount of hybrid not higher than 15%, sequencing mistake is no more than 1%, and the two is total no more than 16%, Therefore, for homozygous site, variety and genetype to be measured only has one kind, and its frequency should be more than 84%, and for heterozygosis position Point for, variety and genetype to be measured has 2 kinds, its ratio should be more than 42%, therefore, it is specified that variety and genetype to be measured frequency >= 30%, it can exclude because being contaminated with hybrid strain in the wrong and to be measured kind of sequencing and to the interference of variety and genetype to be measured.Hybrid strain base Because type refers to the potential hybrid strain genotype of frequency >=0.02%, wherein, all genotype of potential hybrid strain genotype and kind to be measured Between distinguishing base quantity >=2 or distinguishing base in have insertion or the missing of discontinuous base.Hybrid strain VDA genotypes Principle is：In high-flux sequence, insertion or missing errors are extremely rare, and 2 fixed distinguishing bases caused by mistake is sequenced Probability as little as (1%/3) 2=0.0011%, and require hybrid strain genotype frequency >=0.02%, under the limitation of these conditions, even if It is 30000 sequencing depth, because the probability that sequencing mistake produces certain hybrid strain genotype is only that 0.0001% (computational methods are shown in Table 2).0.02% frequency meets most strict DUS testing standards at present, i.e., as little as 2 hybrid detected from 10,000 seeds. If distinguishing base quantity=1, whole test zones can all produce the hybrid strain genotype (computational methods are shown in Table 2) of mistake, if During distinguishing base quantity >=3, hybrid strain genotype quantity is drastically reduced, it is difficult to accurate to calculate hybrid strain rate R, therefore, distinguishing base The threshold value of quantity >=2 is optimal.

For example, in fragment group is sequenced, the sequencing fragment sum in the 1st sequencing region is 33180 articles, have ACCC, CGTT, CCCC, GCCC ... totally 41 kinds of genotype, represent these genotype sequencing segments distinguish 16709,16334,2,2 Bar ..., the frequency of these genotype is 16709/33180=50.36%, 16334/33180=49.23%, 2/33180= 0.006%th, 2/33180=0.006% ....By the definition of variety and genetype to be measured and hybrid strain genotype, ACCC and CGTT should This is to be measured variety and genetype of the kind to be measured in the 1st test zone, and other genotype are genotype caused by sequencing mistake. In the special test zone of hybrid, female genotype differs with male parent gene type, female genotype and all nucleus hybrid strain product The genotype of kind is different, and male parent gene type is also different from the genotype of all nucleus hybrid strain kinds；Female genotype is to treat Survey in kind, the genotype identical genotype with female parent；Male parent gene type be kind to be measured in, it is identical with the genotype of male parent Genotype.1st test zone, female genotype CGTT differs with male parent gene type ACCC, and female genotype and father This genotype is different with the genotype of all nucleus hybrid strain kinds (in the present embodiment, no hybrid strain kind), therefore, the 1st survey It is also the special test zone of hybrid to try region.Hybrid strain karyogene type refers to that hybrid strain genotype is karyogene type, hybrid strain matter genotype It is matter genotype to refer to hybrid strain genotype.By this definition, first test zone is without hybrid strain genotype, therefore, also without hybrid strain core Genotype or hybrid strain matter genotype.By identical method, judge and obtain treating for whole 2030 successful test zones of detection Variety and genetype, the special test zone of hybrid, hybrid strain genotype and its frequency are surveyed, and the hybrid strain genotype for judging to obtain is hybrid strain Karyogene type or hybrid strain matter genotype.As a result show：In the present embodiment, no hybrid strain genotype, share 153 hybrids and specifically survey Try region.

The standard sample detection method in the present embodiment is following is a brief introduction of, 1 seed is taken from kind to be measured, is broadcast After planting and growing up to seedling, pressed using the blade of seedling and extract genomic DNA with kind identical method to be measured, the DNA is referred to as treating Survey the standard sample of kind.With kind to be measured simultaneously and by same procedure it is parallel structure standard sample high-throughput sequencing library simultaneously High-flux sequence.Wherein, the genotype of frequency >=30% is referred to as standard sample genotype, the frequency of standard sample hybrid strain genotype >=0.02% and quantity >=2 of the distinguishing base between standard sample genotype or distinguishing base in have discontinuous base insert Enter or lack.The standard sample genotype in successful test zone is each detected by with kind identical method to be measured, acquisition With standard sample hybrid strain genotype.If standard sample genotype and variety and genetype identical test zone to be measured account for standard sample The ratio of successful test zone is detected more than 90% with kind to be measured, then standard sample is correct, otherwise, again from product to be tested 1 seed is taken in kind, repeats above procedure, until obtaining correct standard sample.By the hybrid strain gene of correct standard sample Type obtains identical hybrid strain genotype, removed in kind to be measured compared with the hybrid strain genotype of the corresponding test zone of kind to be measured The identical hybrid strain genotype, correct kind hybrid strain genotype to be measured are retained and are used for subsequent analysis.Arrange above Apply and eliminate the hybrid strain genotype caused by Systematic selection mistake, Systematic selection mistake is mainly the special knot of gene order PCR selectivity mistake amplifications caused by structure.It should be noted that：When database is wide in variety, different cultivars base can be represented extensively It during because of type, can require that hybrid strain genotype is identical with some genotype of database kind, can equally play and standard sample Identical function, in this case, it is possible to which not examination criteria sample, reaches the purpose for mitigating workload.In the present embodiment, because Hybrid strain genotype is not detected, so, the problem of removing wrong hybrid strain genotype is also not present.

9th, by variety and genetype to be measured compared with the genotype of the different cultivars in database, approximate kind, variation are obtained Site and variant sites rate, method are as follows：

If in the test, the genotype of kind to be measured and database kind is referred to as to treat without missing, the test zone Survey the shared test zone of kind and the database kind.In shared test zone, if kind to be measured and database kind Genotype is incomplete same, then the test zone where the genotype is referred to as the difference position of kind to be measured and the database kind Point, corresponding genotype Differential genotype each other, the number of the number/shared test zone in difference site rate=difference site. The approximate kind that the minimum kind of difference bit rate is referred to as kind to be measured is obtained from database, corresponding difference site is referred to as making a variation Site, the number of number/shared test zone of variant sites rate=variant sites.

In the present embodiment, " Jin Ke 1A " shared test zone number is for kind to be measured and the 1st kind of database 2025.In the 1st shared test zone, kind to be measured with " Jin Ke 1A " genotype is respectively CGTT/ACCC and CGTT, two Person is incomplete same, therefore, the 1st shared test zone be kind to be measured with " Jin Ke 1A " difference site, CGTT/ACCC with ACCC is kind to be measured and " Jin Ke 1A " Differential genotype.By identical method, by all shared test zones, product to be tested Kind is with " compared with Jin Ke 1A " genotype, finding to share 152 difference sites, difference site rate=152/2025=7.51%.Press Identical method, kind to be measured and all 1137 interracial difference sites rate in database are obtained, and obtain difference site The minimum kind of rate is " Jin Ke 1A/R7723 ", only 1 difference site, it (is shown in Table for the non-universal test zone of numbering 10 1), difference site rate is 0.05%.Therefore, " Jin Ke 1A/R7723 " be kind to be measured approximate kind, the variation of kind to be measured Site rate is 0.05%.

Tenth, by hybrid strain genotype compared with the genotype of the different cultivars in database, after obtaining hybrid strain kind, calculate miscellaneous Strain rate, method are as follows：

Obtain hybrid strain kind：The kind that hybrid strain kind is present in database, and the potential hybrid strain genotype of hybrid strain kind Having the number of the test zone of phase homogenic type to account for hybrid strain kind between hybrid strain genotype has the test of potential hybrid strain genotype Total ratio >=60% in region, wherein, the distinguishing base between all genotype of potential hybrid strain genotype and kind to be measured Quantity >=2 or distinguishing base in have insertion or the missing of discontinuous base.Hybrid strain kind be divided into nucleus hybrid strain kind and Cytoplasm hybrid strain kind, wherein, nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained, cytoplasm merely with karyogene type Hybrid strain kind refers to calculate the hybrid strain kind obtained merely with matter genotype.For example, it is assumed that the genotype of the kind in database Respectively AA, AA, AA/TT, AA/TT, AA/TT, AA/TT and AA when, the corresponding genotype of kind to be measured be respectively AA, AA/TT, TT, AA, TT/CC, GG/CC and during-A, corresponding potential hybrid strain genotype is：Nothing, nothing, AA, TT, AA, AA/TT and AA.Typically Heterozygous genotypes are not present in homozygous kind, but only a few site there may be, in addition, hybrid strain is mostly cenospecies, heterozygous sites More typically, various possible situations are listed therefore.Parameter 60% can ensure that whole hybrid strain kind detection probabilities are 100% and deposited It is 0% in the probability of the hybrid strain kind of erroneous judgement, the determination method of the parameter value is shown in Table 2.

In the present embodiment, due to not detecting hybrid strain genotype, therefore, also without hybrid strain kind.Special hybrid strain gene Type refers to the hybrid strain genotype that only a hybrid strain kind is all, and it includes special hybrid strain karyogene type and special hybrid strain matter gene Type；Special hybrid strain karyogene type refers to the hybrid strain karyogene type that only a nucleus hybrid strain kind is all, special hybrid strain matter base Because type refers to the hybrid strain matter genotype that only a cytoplasm hybrid strain kind is all.In the present embodiment, due to without hybrid strain kind, because This, also without special hybrid strain genotype.

Calculate hybrid strain rate R principles

Hybrid strain rate R=R1+R2-R3-R4+Rm, wherein：Its In, n1 is the number of nucleus hybrid strain kind, and t1 is all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds Number, i1j1 be after all special hybrid strain karyogene types of the i-th 1 nucleus hybrid strain kinds sort from low to high by its frequency, The special hybrid strain karyogene type of jth 1, R1i1j1 are the frequency of the i-th 1j1 special hybrid strain karyogene types；R1 is by hybrid strain core base Because of the summation of the hybrid strain rate of the nucleus hybrid strain kind of type calculating, the hybrid strain rate of nucleus hybrid strain kind is to remove nucleus hybrid strain In kind after the frequency of the special hybrid strain karyogene type of minimum 80% and highest 10%, remaining special hybrid strain karyogene type 2 times of average value of frequency；Wherein, t2 is except nucleus hybrid strain kind is gathered around The number of outside some hybrid strain karyogene types and frequency >=0.17% hybrid strain karyogene type, i2 are except nucleus hybrid strain kind After all hybrid strain karyogene types outside the hybrid strain karyogene type possessed sort from low to high by its frequency, the i-th 2 hybrid strain core bases Because of type, R2i2 is the frequency of the i-th 2 hybrid strain karyogene types；R2 is to utilize the hybrid strain karyogene possessed except nucleus hybrid strain kind The hybrid strain rate that type calculates, it is 80% He minimum in the frequency for remove the hybrid strain karyogene type possessed except nucleus hybrid strain kind After the value of highest 10%, 2 times of the average value of surplus value；Its In, n2 is the number of cytoplasm hybrid strain kind, and R3i3 is the hybrid strain rate of the i-th 3 cytoplasm hybrid strain kinds, and t3 is the i-th 3 cells The number of all special hybrid strain matter genotype of matter hybrid strain kind, i3j3 are all of the i-th 3 cytoplasm hybrid strain kinds After special hybrid strain matter genotype sorts from low to high by its frequency, the special hybrid strain matter genotype of jth 3, R3i3j3 the The frequency of i3j3 special hybrid strain matter genotype；R3 is by the miscellaneous of the cytoplasm hybrid strain kind of hybrid strain matter genotype calculating The summation of strain rate, the hybrid strain rate of cytoplasm hybrid strain kind are to remove 80% and highest minimum in cytoplasm hybrid strain kind After the frequency of 10% special hybrid strain matter genotype, the average value of the frequency of remaining special hybrid strain matter genotype；Wherein, t4 is in addition to the hybrid strain matter genotype that cytoplasm hybrid strain kind possesses And the hybrid strain matter genotype of frequency >=0.17% number, i4 be the hybrid strain matter genotype that possesses except cytoplasm hybrid strain kind it After outer all hybrid strain matter genotype sort from low to high by its frequency, the i-th 4 hybrid strain matter genotype, R4i4 is miscellaneous for the i-th 4 The frequency of strain matter genotype；R4 is the hybrid strain rate for utilizing the hybrid strain matter genotype possessed except cytoplasm hybrid strain kind to calculate, and it is After the value for removing 80% and highest 10% minimum in the frequency of the hybrid strain matter genotype possessed except cytoplasm hybrid strain kind, remain The average value of residual value；Wherein, t5 is the number of the special test zone of hybrid；I5 is the i-th 5 The special test zone of hybrid；Rmi5 is in the i-th 5 special test zone of hybrid, the frequency of female genotype；Rfi5 is the i-th 5 In the special test zone of hybrid, the frequency of male parent gene type；The hybrid strain rate of the maternal selfings of Rm, it is the special test zone of hybrid In, the average value of the frequency of female genotype and the difference of the frequency of male parent gene type；Int () is bracket function, returns to bracket In number integer part.

The female parent that hybrid strain in kind to be measured comes from reproductive process is selfed, flyings pollination mixes and mechanical admixture, its In, female parent is the main source of hybrid strain variet complexity from giving flyings pollination to mix.Female parent selfing refers to produce in hybrid seed During, the female parent as sterile line should not be selfed generation seed originally, but due to maternal part fertility restorer, generate kind Son, so as to form hybrid.Flyings pollination, which mixes, refers to that the pollen of hybrid strain kind passes to kind to be measured by wind-force etc. and pollinated The hybrid seed of formation, flyings pollination can not possibly introduce cytoplasm, therefore can only cause hybrid strain karyogene type, and its hybrid strain rate is miscellaneous 2 times of strain karyogene type frequency.Mechanical admixture refers to that hybrid strain variety seeds are directly mixed in kind to be measured, while introduces cell Core and cytoplasm, while hybrid strain karyogene type and hybrid strain matter genotype are formed, its hybrid strain rate should be the frequency of hybrid strain matter genotype Rate.In hybrid strain rate R calculation formula, the hybrid strain rate of mechanical admixture has been over-evaluated 1 times by R1+R2, needs to correct, after correction for R1 +R2-R3-R4.It is a technical barrier to distinguish mechanical admixture with flyings pollination to mix, and the present invention solves this problem.

In hybrid strain rate R calculation formula, the hybrid strain rate of nucleus hybrid strain kind is all 2 × hybrid strain karyogene type frequency, Its reason is as follows：Diploid or allopolyploid plant are 2 copies, therefore, hybrid strain in the test zone of nuclear genome Rate is 2 times of corresponding hybrid strain karyogene type frequency.If the test zone of the nuclear genome of N parts copy must be selected, Then coefficient should be adjusted to N, if copy number is indefinite, make N=2 processing, if wrong, it will when calculating R, by removing 80% The mode of low extremum excludes them.

In hybrid strain rate R calculation formula, merely with 10% of hybrid strain genotype frequency value in centre count Calculate, its principle is：The different hybrid strain genotype of same hybrid strain kind are determined by the hybrid strain rate of the hybrid strain kind, so the phase of frequency Prestige value is equal, and the difference between frequency is expanded by PCR, the error during high-flux sequence causes.Pass through hybrid strain genotype Definition and kind standard sample to be measured, these improper values are eliminated substantially, removes 10% extremum and is enough to remove pole Deviate the test zone of true hybrid strain rate on a small quantity.Why remove the 80% of minimum, and it is maximum then only remove 10%, principle is such as Under：(1) worst error source is sequencing mistake, and it is very low that hybrid strain genotype frequency caused by mistake is sequenced；(2) except hybrid strain product In the frequency of hybrid strain genotype outside kind, high level is more likely the common hybrid strain genotype of different hybrid strains, is represent real Hybrid strain rate.

In R2 and R4 calculation formula, it is desirable to which frequency >=0.17% of hybrid strain genotype, its principle are as follows：Work as database In kind number and detection site when reaching 10000,149 hybrid strain genotype erroneous judgements will be averagely produced, when setting hybrid strain During genotype frequency >=0.17%, probability >=99.98% (projectional technique is shown in Table 2) of the hybrid strain genotype of no erroneous judgement just can be accurate Really calculate the value to R2 and R4.It has been the limit in reality that kind number in database and detection site, which reach 10000, because This, the threshold value of frequency >=0.17% of hybrid strain genotype goes for various situations.R2 and R4 introducing so that energy of the present invention It is 0 enough in database kind, i.e., in the case that no database is supported, calculates hybrid strain rate R.Especially, if hybrid strain kind A institute There is hybrid strain genotype to be possessed by hybrid strain kind B and other hybrid strain kinds, thus, hybrid strain kind A is without special hybrid strain genotype.This When, when calculating hybrid strain rate R, hybrid strain kind A and hybrid strain kind B hybrid strain rate are not calculated, and calculate hybrid strain kind AB hybrid strain Rate.Hybrid strain kind AB hybrid strain VDA genotypes are：Hybrid strain genotype common to hybrid strain kind A and hybrid strain kind B.

Hybrid strain rate R calculation formula is general formula, and kind to be measured typically only mixes a kind of hybrid strain kind in reality, by The all very big and process specification in cenospecies production area, so, the possibility of flyings pollination and mechanical admixture is all very low, up to Female parent selfing forms hybrid, and the present embodiment is such case.

Calculate hybrid strain rate R hypothesis example

Table 3 assumes a hybrid strain rate calculated examples, to become apparent from illustrating hybrid strain rate R calculating process.

Table 3 assumes example to calculate one of hybrid strain rate R

In table 3, nucleus hybrid strain kind common A and B two, so n1=2, cytoplasm hybrid strain kind number only C mono-, so N2=1.By the definition of special hybrid strain karyogene type, the special hybrid strain karyogene type for obtaining hybrid strain kind A is that numbering is No. 1-10 Hybrid strain karyogene type AA, TT, TCC, GG, AC, TTC, TCCC, GGC, ACC and AG, so, t1=10, they frequency difference For 0.10%, 1.20%, 0.10%, 0.10%, 0.02%, 0.10%, 0.10%, 0.10%, 0.10% and 0.10%, to this It is R11111=0.02%, R11121=0.02%, R11131 after 10 special hybrid strain karyogene type frequencies sort from low to high =0.10%, R11141=0.10%, R11151=0.10%, R11161=0.10%, R11171=0.10%, R11181= 0.10%th, R11191=0.10% and R111101=1.20%.From j 1=Int (0.8 × t1)+1=Int (0.8 × 10)+1 =9 to j 1=t1-Int (0.1 × t1)=10-Int (0.1 × 10)+1=9 R111j1 value is R11191=0.10%, So nucleus hybrid strain kind A hybrid strain rate isIn the same way, nucleus is obtained Hybrid strain kind B hybrid strain rate is Thus, nucleus hybrid strain kind is obtainedIn a similar manner, R2=0.02%, cytoplasm hybrid strain product are obtained The hybrid strain rate of kindR4=0.04%.In the 1st special test zone of hybrid, Rmi5 =52.36%, Rfi5=46.34%, therefore, the maternal selfing rate calculated using the special test zone of the 1st hybrid is 52.36%-46.34%=6.02%, by identical method, calculate in other several special test zones of hybrid, female parent selfing Rate is 3.94%, 6.06%, 6.22% and 7.54%, therefore in the hypothesis example, final maternal selfing rate is：Rm= (6.02%+3.94%+6.06%+6.22%+7.54%)/5=5.96%.Therefore, hybrid strain rate R=R1+ in the hypothesis example R2-R3-R4+Rm=0.60%+0.02%-0.10%-0.04%+5.96%=6.44%.

With reference to above-mentioned hypothesis example, the hybrid strain rate R in the present embodiment is calculated：In the present embodiment, no hybrid strain kind and miscellaneous Pnca gene type, and in addition to the hybrid strain genotype that hybrid strain kind possesses, no frequency is more than 0.17% hybrid strain genotype, therefore, R1, R2, R3 and R4 are 0, thus, R=Rm.In the 1st hybrid test zone, Rmi5=50.36%, Rfi5= 49.23%, therefore, the maternal selfing rate calculated using the 1st test zone is 50.36%-49.23%=1.13%, by phase With method, calculate the special test zone of all 152 hybrids in, maternal selfing rate be 1.13%, 1.02%, 1.03%....., defined by Rm, their average value calculated after calculating the maternal selfing rate of the special test zone of these hybrids, Obtain R=Rm=1.09% in the present embodiment

11, using variant sites, variant sites rate and hybrid strain rate, the specificity of kind to be measured, uniformity and steady are judged Qualitative, method is as follows：

Wherein, SD is threshold value selected when judging specific, and M is to judge threshold selected when uniformity and stability Value.The method for judging varietY specificity to be measured, uniformity and stability is：When variant sites rate >=SD or non-universal test zones When variant sites be present, kind to be measured has specificity, and as variant sites rate ＜ SD and variant sites are not present in non-universal survey When trying region, kind to be measured is without specificity；As hybrid strain rate≤M of kind to be measured, kind to be measured has uniformity and steady Qualitative, when the hybrid strain rate of kind to be measured is more than ＞ M, kind to be measured does not have uniformity and stability.With M values, SD values It is according to the factors such as breeding level, desired Stringency, mark characteristic, artificially determines.In the present embodiment, SD is selected With 1% standard.

In the present embodiment, variant sites rate is 0.05%<SD=1%, but (numbering is No. 10 to non-universal test zone Test zone) variant sites (being shown in Table 1) be present, therefore, judge that kind to be measured has specificity；The hybrid strain rate of kind to be measured 1.09% ＞ M=1%, therefore, judge that kind to be measured does not have uniformity and stability.

Further, after varietY specificity to be measured, uniformity and stability is judged, the accuracy of judgement is estimated Meter, method are as follows：

Specific accuracy calculates：When variant sites are not present in non-universal test zone, if judging, kind to be measured has Specificity, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD, TRUE)；If judge kind to be measured not With specificity, the correct probability >=BINOM.DIST (SD*TRN, TRN, OD, TRUE) of conclusion, wherein, TRN is successfully to detect Test zone number, OD is variant sites rate, and BI NOM.DIST are the function in excel 2010, its application method with Definition in excel 2010 is identical, and what it was returned is the probability of binomial distribution.What above-mentioned probability actually calculated is：When sentencing Disconnected when having specific, variant sites rate is more than SD probability；When judging that kind to be measured does not have specific, variant sites rate Probability less than SD, successful test zone is detected by being obtained after analyzing sequencing fragment group.

This implementation does not judge the specificity of kind to be measured using variant sites rate, therefore, is not calculating specific conclusion just True probability.

Uniformity calculates with stability accuracy

The correct probability of conclusion for judging the uniformity and stability of kind to be measured is：When kind to be measured have uniformity and During stability, correct probability >=BINOM.DIST (M*SN, SN, R, TRUE) * BINOM.DIST of conclusion (Σ SeN*M, Σ SeN, R,TRUE)；When kind to be measured does not have uniformity and stability, the correct probability >=BINOM.DIST of conclusion ((1-M) * SN, SN, (1-R), TRUE) * BINOM.DIST (Σ SeN* (1-M), Σ SeN, 1-R, TRUE), wherein, M for judge uniformity and surely Selected threshold value when qualitative, Σ SeN are all sequencings for being used for test zone where calculating the frequency of hybrid strain rate R genotype The summation of fragment, BINOM.DIST (M*SN, SN, R, TRUE) are that kind to be measured has carried out SN sampling, the hybrid strain being actually pumped Rate R is less than threshold value M probability, and BINOM.DIST (Σ SeN*M, Σ SeN, R, TRUE) meaning is：Kind to be measured is carried out SeN sampling of Σ, the hybrid strain rate R being actually pumped are less than threshold value M probability；BINOM.DIST((1-M)*SN,SN,(1-R), TRUE SN sampling) has been carried out for kind to be measured, the hybrid strain rate R being actually pumped is more than threshold value M probability, BINOM.DIST (Σ SeN* (1-M), Σ SeN, 1-R, TRUE) meaning be：SeN sampling of Σ, the hybrid strain being actually pumped have been carried out to kind to be measured Rate R is more than threshold value M probability.Σ SeN are after removing 80% minimum value and 10% maximum, are remained miscellaneous for calculating The summation of the test fragment of the test zone of strain rate.Judge that the accuracy of uniformity and stability is depending entirely on hybrid strain rate just True rate, and the positive rate of hybrid strain rate really depends on the accuracy of following three steps：First, kind sampling accuracy to be measured, second, The accuracy of detection hybrid strain kind, the 3rd from extraction sample, utilize the hybrid strain kind of detection to calculate the accuracy of hybrid strain rate.Cause This, the accuracy for judging kind uniformity and stability to be measured is the product of the step accuracy of the above three.Because even the present invention exists Under the conditions of most stringent of, the accuracy of detection hybrid strain kind also controls more than 99.9%, is actually mostly close to 100% 's.Therefore, the product of the accuracy of the first step and the 3rd step can be estimated as by judging the accuracy of kind uniformity and stability to be measured, It is respectively the value that former and later two functions are calculated in above-mentioned formula.For example, BINOM.DIST (M*SN, SN, R, TRUE) meaning Justice is：Kind to be measured has carried out SN sampling, and the hybrid strain rate R being actually pumped is less than threshold value M probability；For calculating kind to be measured Each sequencing fragment of hybrid strain rate, has substantially also quite carried out single sample, therefore, BINOM.DIST to kind to be measured The meaning of (Σ SeN*M, Σ SeN, R, TRUE) is：SeN sampling of Σ, the hybrid strain rate R being actually pumped have been carried out to kind to be measured Less than threshold value M probability.

In the present embodiment, the site for hybrid strain rate R is 153 special test zones of hybrid strain, and its sequencing total amount is 4403423, also that is, 30000 samples being pumped have been carried out with 4403423 sampling again, so big amount of sampling Error is fairly small.In the present embodiment, judge that kind to be measured does not have uniformity and stability, therefore, the judgement conclusion is just True probability >=BINOM.DIST ((1-M) * SN, SN, (1-R), TR UE) * BINOM.DIST (Σ SeN* (1-M), Σ SeN, 1- R, TRUE)=BINOM.DIST ((1-1%) * 30000,30000, (1-1.09%), TRUE) * BINOM.DIST (4403423* (1-1%), 4403423,1-1.09%, TRUE)=93.84%.It can be seen that uniformity and stability of this implementation to kind to be measured Judgement be very accurate.

Result verification

Press《New variety of plant specificity, uniformity and stability test guide-rice》In method plant and observe and treat Rice varieties and its approximate kind are surveyed, finds the high sense bacterial leaf-blight of rice varieties to be measured, approximate kind then high resistance to hoja blanca. 《New variety of plant specificity, uniformity and stability test guide-rice》Middle regulation：At least in a character with approximate product When kind has obvious and reproducible difference, you can judge that the kind to be measured of application possesses specificity.Therefore, rice to be measured is judged Kind has specificity.In experimentation, planted altogether 400 plants of kinds to be measured and approximate kind (200 plants of cells, totally 2 Individual repetition), 10 plants of special-shaped strains are found,《New variety of plant specificity, uniformity and stability test guide-rice》Middle regulation： When sample size is 400~471 plants, 8 plants of special-shaped strains are at most allowed for.Therefore, judge kind to be measured without consistent Property.It is generally believed that not having uniformity, just do not have stability yet.It is indicated above that to the special of kind to be measured in the present embodiment The judgement of property, stability and uniformity is correct.

Embodiment two, measure corn variety ' G95/1102' specificity, uniformity and stability

The corn variety to be measured that the present embodiment provides is corn variety " G95/1102 ", and corn variety " G95/1102 " is jade Rice kind " 1102 " and the cross combination of " G95 ", above kind are kind known to disclosure.Determine the special of the corn variety Property, uniformity are similar with embodiment one with the method for stability, therefore, only describe difference.

First, by with method embodiment one kind, obtain the variant sites between different corn varieties.

The method for obtaining the genome sequence of different corn varieties is as follows：

The genome sequence of the different corn varieties of the present embodiment shows two kinds of sources, and the first is Chia etc. to 103 jade The high-flux sequence sequence of the genome of rice kind, pertinent literature information are as follows：Chia JM et al.Maize HapMap2identifies extant variation from a genome in flux.Nat Genet.2012,44 (7):803-7.The genome sequence of 103 corn varieties is published in NCBI Short Read Archive (http:// Www.ncbi.nlm.nih.gov/sra), reception number is SRA051245；Second is by Chia etc. the above-mentioned article delivered To " G95 ", " 1102 " and cenospecies, " height relies 145 " to carry out high-flux sequence to the method for middle offer.The present embodiment obtains altogether The high-flux sequence sequence of the genome of 106 corn varieties.

Further, by with method embodiment one kind, utilize different cultivars genome sequence obtain variant sites.

Software (version number 0.4) is compared by the genome of this 106 corn varieties using Frederick Sanger High-flux sequence sequence compares " B73 " maize cell core reference gene group (version respectively：AGPv1, download address：http:// Www.ncbi.nlm.nih.gov) and in cytoplasm reference gene group, the cytoplasm reference gene group refers to base including mitochondria Because of group and chloroplaset reference gene group, it is in NCBI (National Center for Biotechnology Information, US National Biotechnology Information center) on reception number be respectively NC_007982.1 and NC_ 001666.2.During contrast, Insert Fragment length is set to 500bp, and other specification is set as default value.The Ssaha Pileup of use Software kit (version number 0.5) identifies the SNP site of each corn variety.The present embodiment is common between all 106 corn varieties 53855606 SNP sites are obtained, wherein 9005 SNP sites are located on cytoplasmic skeleton, remaining SNP site is positioned at thin On karyon genome.

2nd, the test zone of corn variety to be measured is determined by variant sites, test zone includes universal test region, extremely Small part variant sites are included in universal test region, and its method includes：

By with method embodiment one kind, determine universal test region

First, centered on each SNP site of acquisition, respectively extend 99bp and 100bp to the left and right, form 200bp change Different window.According to the 53855606 of acquisition SNP sites, 53855606 variation windows can be obtained, calculates and obtains all The discrimination of 53855606 variation windows simultaneously therefrom chooses 8000 variations for being located at discrimination maximum in nuclear genome Window and 100 maximum variation windows of discrimination in cytoplasmic skeleton.Check one by one positioned at nuclear genome In 8000 variation windows, each distance to make a variation between window and next variation window, if distance is more than 500K (1K=1000 Individual base), then abandon reexamining after the less variation window of wherein discrimination, up to the adjacent distance for looking into variation window is big Untill 500K.Selection 500K criterion distance be because Maize genome size be about 2300M (ten thousand bases of 1M=100), By final selected 2400 based on the universal test region of nuclear genome, the interregional distance of average universal test is about 1M, but due to few variant sites such as some specific regions such as centromeres, therefore, average distance should be less than 1M.More than pressing Method, 5030 variation windows for being located at nuclear genome are have selected, they are located at area in cytoplasmic skeleton with what is obtained Totally 5130 variation windows pass through test zone to 100 maximum variation windows of indexing as selected together.

In the present embodiment, because corn variety to be measured is come by pinpointing transformation, need to examine without non-universal site Survey, therefore, universal test region nothing but.

3rd, by with method embodiment one kind, prepare the primer in amplification assay region, the primer includes universal test area Domain primer, it is specific as follows：

Primer acquisition process is by identical with the method for embodiment one.From all 5130 universal test regions, design and into Work(demonstrates 2506 pairs of multiple PCR primers, for expanding corresponding 2506 universal test regions.Verify multiple PCR primer Method is identical with the method for embodiment one, and 2506 universal test regions of above-mentioned successful design multiple PCR primer are as final For the universal test region of corn variety to be measured detection, meanwhile, each kind in the database of structure also contains above-mentioned 2506 universal test regions, wherein, 34 universal test regions are located on cytoplasmic skeleton, remaining 2472 general surveys Examination region is located on nuclear genome.

Corn variety to be measured in the present embodiment is due to no non-universal test zone, therefore, universal test region nothing but Primer.

This example obtains 2506 universal test region primers and 0 non-universal test zone primer, corresponding to them Amplification region is the test zone of corn variety to be measured.The genotype of 2506 test zones of the structure comprising 106 kinds and The database of its SNP positional information, partial results are shown in Table 4.

Table 4 is database variety and genetype and its position, Maize Genotypes to be measured, hybrid strain genotype and its frequency Certain embodiments

Symbol in table 4 is identical with the symbolic significance in table 1.

5th, after the amount of sampling SN for determining corn variety to be measured, random sampling mixes and extracts the DNA of mixing sample, method It is as follows：

By with the identical method of embodiment one, calculating corn variety amount of sampling to be measured should >=4000.In the present embodiment, select 6000 germinations have been taken, have been placed in after randomly selecting the mixing of 5000 buds being substantially equal to the magnitudes in mortar, have been pressed and embodiment One identical method, extract and obtain the DNA of corn variety mixing sample to be measured, and the DNA of acquisition is quantified, will be quantitative Corn variety DNA to be measured afterwards is diluted to 10.00ng/ μ l.

By with the identical method of embodiment one, the high-throughput sequencing library in structure universal test region, in the present embodiment, Because of the high-throughput sequencing library in universal test region nothing but, therefore, the high-throughput sequencing library in the universal test region of structure is The high-throughput sequencing library for all test zones for being 100pM for concentration.

7th, high-flux sequence is carried out to high-throughput sequencing library, obtains that fragment group is sequenced.

By with the identical method of embodiment one, determine high-flux sequence depth CF be >=2237 times.By with the phase of embodiment one Same method, high-flux sequence is carried out using high-throughput sequencing library, high-flux sequence flux is arranged to average coverage test area 30000 times of domain.

By with the identical method of embodiment one, a large amount sequencing result is pre-processed.

8th, analysis sequencing fragment group, obtains Maize Genotypes to be measured and hybrid strain genotype, method is as follows；

By with the identical method of embodiment one, altogether obtain 44 special test zones of hybrid, 61 hybrid strain genotype simultaneously point Their frequency Ji Suan not obtained.Found by with the identical method of embodiment one, progress standard sample detection：In standard sample There is no hybrid strain genotype, so, the problem of removing wrong hybrid strain genotype is also not present.

9th, by Maize Genotypes to be measured compared with the genotype of the different cultivars in database, obtain approximate kind, Variant sites and variant sites rate, method are as follows：

By " high to rely 145 " the approximate kinds for being corn variety to be measured, corn to be measured with the identical method of embodiment one, acquisition The variant sites rate of kind is 1.91%.

By with the identical method of embodiment one, obtain BKN017:MZ is nucleus hybrid strain kind, and all 61 hybrid strain bases Because type is present in BKN017:In MZ.In the present embodiment, acellular matter hybrid strain kind.

Assume example (table 3) by with the identical method of embodiment one, reference, calculate the hybrid strain rate R in the present embodiment：At this In embodiment, nucleus hybrid strain kind BKN017 be present:MZ, acellular matter hybrid strain kind, and remove the hybrid strain that hybrid strain kind possesses Outside genotype, no frequency is more than 0.17% hybrid strain genotype, and therefore, R2, R3 and R4 are 0, thus, R=R1+Rm.By In only one hybrid strain kind, therefore, all 61 hybrid strain genotype are special hybrid strain genotype, and their frequency is respectively 1.03%, 1.02%........, remove after maximum of which 10% calculates average value afterwards with minimum 80% and be multiplied by 2, meter Calculate the R1=2.07% obtained.In the 1st special test zone of hybrid, Rmi5=48.88%, Rfi5=48.84%, because This, the maternal selfing rate calculated using the 1st test zone is 48.88%-48.84%=0.04%, by identical method, meter Calculate in the special test zone of all 44 hybrids, maternal selfing rate be 0.04%, 0.05%, 0.03%....., defined by Rm, Their average value is calculated after calculating the maternal selfing rate of the special test zone of these hybrids, obtains Rm=in the present embodiment 0.04%.Therefore, in the present embodiment, R=R1+Rm=2.07%+0.04%=2.11%.

11, by with the identical method of embodiment one, using variant sites, variant sites rate and hybrid strain rate, judge to be measured Specificity, uniformity and the stability of corn variety, method are as follows：

In the present embodiment, variant sites rate is 1.91%>SD=1%, therefore, it is special to judge that corn variety to be measured has Property；The hybrid strain rate 2.11% of corn variety to be measured<M=3%, therefore, judge that corn variety to be measured has uniformity and stability.

Further, by with the identical method of embodiment one, judge corn variety to be measured specificity, uniformity with stably After property, the accuracy of judgement is estimated, method is as follows：

In this implementation, the specificity of corn variety to be measured is judged using variant sites rate, and judges corn variety to be measured With specificity, therefore, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD, TRUE)= BINOM.DIST ((1-1%) * 2465,2465,1-1.91%, TRUE)=99.99%.As can be seen here, the present embodiment is to special Property judge the correct probability of conclusion be very big.

By with the identical method of embodiment one, calculate the accuracy of uniformity and determination of stability

In the present embodiment, the site for hybrid strain rate R is the special test zone of 44 hybrid strains and 61 special hybrid strain genes The test zone of type, it is 3513478 that total amount, which is sequenced, in it, also that is, being carried out again to 5000 samples being pumped 3513478 sampling, the error of so big amount of sampling is fairly small.In the present embodiment, judge that corn variety to be measured has Uniformity and stability, therefore, correct probability >=BINOM.DIST (M*SN, SN, R, the TRUE) * of the judgement conclusion BINOM.DIST (Σ SeN*M, Σ SeN, R, TRUE)=BIN OM.DIST (3%*5000,5000,2.11%, TRUE) * BINOM.DIST (3513478*3%, 3513478,2.11%, TRUE)=100.00%.It can be seen that this implementation is to corn product to be measured The judgement of the uniformity and stability of kind is very accurate.

Result verification

Press《New variety of plant specificity, uniformity and stability test guide-corn》In method plant and observe and treat Corn variety and its approximate kind are surveyed, find corn variety to be measured exists significantly on multiple test characters with approximate kind Difference.《New variety of plant specificity, uniformity and stability test guide-corn》Middle regulation：At least in a character with When approximate kind has obvious and reproducible difference, you can judge that the corn variety to be measured of application possesses specificity.Therefore, sentence Fixed corn variety to be measured has specificity.In experimentation, 40 plants of kinds to be measured and approximate kind (20 plants one has been planted altogether Cell, totally 2 repetitions), 1 plant of special-shaped strain is found,《New variety of plant specificity, uniformity and stability test guide-corn》 Middle regulation：When sample size is 40 plants, 3 special-shaped strains are at most allowed for, thus judge that kind to be measured has uniformity. 《New variety of plant specificity, uniformity and stability test guide-corn》Middle regulation：If a kind possesses uniformity, Then it is believed that the kind possesses stability.Thus judge, kind to be measured also has stability.Experiment shows more than：This reality It is correct to apply the judgement in example to the specificity of kind to be measured, stability and uniformity.

The embodiment of the present invention is expanded by high-flux sequence and more sites, realizes large sample sampling and the kind of kind to be measured Between individual test zone large sample sampling, recycle and define hybrid strain genotype, define cytoplasm hybrid strain kind and define hybrid strain The comprehensive means such as rate calculation formula, successfully realize specificity that is accurate, quick, intactly judging kind to be measured, stability With the target of uniformity, it has the technical effect that what existing DUS method of testings did not all reach.What the present invention detected is PCR primer, can Easily according to case flexible design primer, to detect non-universal test zone.By taking the embodiment of the present invention one as an example, for For 30000 individual amount of samplings for traditional DUS measuring technologies, work is big, can not complete, for example, field DUS is tested In, 30000 plants of rice of sampling need to plant more than 2 mu of rice field, and need to plant 2 years, and annual every plant of rice need to be investigated more than 70 Individual character., it is necessary to be 30000 DNA extractions, 30000*2231 PCR respectively in widely used SSR molecules DUS tests (assuming that as the present embodiment, have detected 2231 universal test regions) is detected with 30000*2231 PCR primer.Therefore, Because workload is excessive, existing molecule DUS tests there all are not measuring stability and uniformity, although DUS test detections in field are consistent Property and stability, but sampling samples amount, all below 1000 plants, 30000 plants of rice and the present embodiment has been sampled, its accuracy shows It is so higher.Why the present embodiment can increase amount of sampling, be because all 30000 samples are used as a sample after all mixing Processing, and field DUS test and comparisons, workload is equivalent to being reduced to 1/30000；Further, all 2231 universal tests Mixed once amplification is all only done in region and high-flux sequence detects, and SSR molecule DUS test and comparisons, workload equivalent to It is reduced to 1/ (30000*2231).Therefore, the present invention realizes large sample and more sites in the case where workload significantly mitigates Detection, make DUS tests not only accurate but also simple.Database variety and genetype is base group in the embodiment of the present invention one simultaneously Into very standard detects same breed under different experimental conditions, can obtain identical gene in the present inventive method Type, accordingly, it is not necessary under different conditions repeat DUS test, therefore, the embodiment of the present invention can directly with database kind base Because type compares, the approximate kind of kind to be measured is objectively selected.And existing DUS measuring technologies are not up to standard, kind to be measured with Approximate kind abreast carries out DUS tests simultaneously, just reliable conclusion can be obtained, in order to mitigate workload, it has to by by product Kind power applicant provide approximate kind, if approximate kind mistake, there may be the legal consequence of erroneous grants.

The foregoing is only presently preferred embodiments of the present invention, be not intended to limit the invention, it is all the present invention spirit and Within principle, any modification, equivalent substitution and improvements made etc., it should be included in the scope of the protection.

Claims

1. a kind of method of specificity for determining hybrid plant new varieties, uniformity and stability, it is characterised in that methods described Including：

The test zone of the kind to be measured is determined by the variant sites, the test zone includes universal test region, At least partly described variant sites are included in the universal test region, are passed throughCalculate discrimination Value, wherein, a is the kind sum being detected in variation window area, and bi is i-th kind of genotype in the variation window area Kind number, and bi>1, k is the number of the genotype comprising more than a kind, and the variation window area is with each monokaryon Centered on thuja acid variant sites, 1/2 conduct for respectively extending sequence length to be measured to the both sides in the single nucleotide variations site is examined The window of survey；The universal test region is the 6800 variation windows or nucleus base that discrimination is maximum on cytoplasmic skeleton The upper discrimination is maximum and equally distributed 200 variations window because organizing, wherein, the genotype is in the test zone The combination in multiple single nucleotide variations sites；

Structure includes database of the different cultivars in the genotype of all test zones；

After the amount of sampling SN for determining the kind to be measured, random sampling mixes and extracts the DNA of mixing sample, the amount of sampling SN Meet following condition：BINOM.INV (SN, M, 0.95)/SN≤1.15*M, wherein BINOM.INV are the letter in excel 2010 Number, to judge threshold value selected when the uniformity and stability, the condition implication that the amount of sampling SN meets is M：Even if The hybrid strain rate only exceeds the 15% of threshold value M, and the amount of sampling can correctly judge the product to be tested in the case where 95% probability ensures The stability and uniformity of kind；

Expanded using the DNA of mixing sample described in the primer pair, obtain the amplified production of the test zone, the expansion Volume increase thing is used to build high-throughput sequencing library；

High-flux sequence is carried out to the high-throughput sequencing library, obtains that fragment group, the depth CF of the high-flux sequence is sequenced Meet following condition：BINOM.DIST (10,10, BINOM.DIST (8,20, BINOM.DIST (0, CF, 0.1%, TRUE), TRUE), FALSE) >=99.9%, 1-BINOM.DIST (10000,10000,1-BINOM.DIST (8,20,1-BINOM.DIST (99.99%*CF, CF, 99.9989%, TRUE), TRUE), FALSE)≤0.1% and BINOM.DIST (10* (1-M) * CF, 10*CF, 1-110%*M, TRUE) >=95.0%, wherein, C F are the depth of the high-flux sequence, and M is described consistent to judge Property and selected threshold value during stability, BINOM.DIST be the function in excel 2010, the depth of the high-flux sequence CF meet condition implication be：In the hybrid strain rate as little as 0.1%, the hybrid strain kind for 10 and the hybrid strain kind and institute Under conditions of stating product to be tested inter-species averagely only 20 difference sites, the detection determined by the depth CF of the high-flux sequence is complete Probability >=99.9% of hybrid strain kind described in portion；The database kind for 10000 and the hybrid strain kind with it is described Under conditions of product to be tested inter-species averagely only has 20 difference sites, the presence determined by the depth CF of the high-flux sequence is judged by accident Probability≤0.1% of the hybrid strain kind；In the hybrid strain kind be 10 and true hybrid strain rate is exceeded only when judging specific Selected threshold value 10% when, by the depth CF of the high-flux sequence determine to stability and the judgement conclusion of uniformity Correct probability >=95.0%；

By the variety and genetype to be measured compared with the genotype of the different cultivars in the database, obtain described to be measured Approximate kind, variant sites and the variant sites rate of kind；

By the hybrid strain genotype compared with the genotype of the different cultivars in the database, after obtaining hybrid strain kind, Calculate hybrid strain rate；

Using the variant sites, the variant sites rate and the hybrid strain rate, the varietY specificity to be measured, uniformity are judged And stability.

2. according to the method for claim 1, it is characterised in that the test zone also includes non-universal test zone, institute Stating primer also includes non-universal test zone primer.

3. according to the method for claim 2, it is characterised in that the non-universal test zone primer include the first primer and Second primer, first primer include the first forward primer and the first reverse primer, and it is positive that second primer includes second Primer and the second reverse primer, first primer and second primer carry out respectively individually amplification obtain two it is described non-through With the amplified production of test zone, the amplified production mixed in equal amounts of two non-universal test zones is used to build independent expansion The high-throughput sequencing library of increasing；

5 ' end connections of first forward primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1, described first is reverse 5 ' end connections in primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2；

5 ' end connections of second forward primer are just like SEQ ID NO in sequence table:Sequence 2 shown in 2, described second is reverse 5 ' end connections of primer are just like SEQ ID NO in sequence table:Sequence 1 shown in 1.

4. according to the method for claim 2, it is characterised in that utilize the variant sites, the variant sites rate and institute Hybrid strain rate is stated, judging the method for the varietY specificity to be measured, uniformity and stability includes：

When the variant sites be present in the variant sites rate >=non-universal test zones of SD or described, the kind tool to be measured There is specificity, it is described as the variant sites rate ＜ SD and when the variant sites are not present in the non-universal test zone For kind to be measured without specificity, wherein SD is threshold value selected when judging specific；

As the hybrid strain rate≤M of the kind to be measured, the kind to be measured has uniformity and stability, when described to be measured When the hybrid strain rate of kind is more than ＞ M, the kind to be measured does not have uniformity and stability, and M is to judge the uniformity With threshold value selected during stability；

The hybrid strain rate R=R1+R2-R3-R4+Rm, wherein：

Wherein, n1 is the number of nucleus hybrid strain kind, and t1 is the i-th 1 The number of all special hybrid strain karyogene types of the nucleus hybrid strain kind, i1j1 are the i-th 1 nucleus hybrid strain kinds All special hybrid strain karyogene types sorted from low to high by frequency after, the special hybrid strain karyogene type of jth 1, R1i1j1 is the frequency of the i-th 1j1 special hybrid strain karyogene types；R1 is the nucleus calculated by hybrid strain karyogene type The summation of the hybrid strain rate of hybrid strain kind, the hybrid strain rate of the nucleus hybrid strain kind are to remove in the nucleus hybrid strain kind most After the frequency of the special hybrid strain karyogene type of low 80% and highest 10%, the remaining special hybrid strain karyogene type 2 times of average value of frequency；

Wherein, t2 is the hybrid strain core base possessed except the nucleus hybrid strain kind Because of the number of the hybrid strain karyogene type outside type and frequency >=0.17%, i2 is except the nucleus hybrid strain kind possesses The hybrid strain karyogene type outside all hybrid strain karyogene types sorted from low to high by frequency after, the i-th 2 are described miscellaneous Strain karyogene type, R2i2 are the frequency of the i-th 2 hybrid strain karyogene types；R2 is utilized except the nucleus hybrid strain kind is gathered around The hybrid strain rate that the hybrid strain karyogene type that has calculates, R2 be remove except the nucleus hybrid strain kind possess it is described miscellaneous In the frequency of strain karyogene type after the value of minimum 80% and highest 10%, 2 times of the average value of surplus value；

Wherein, n2 is the number of cytoplasm hybrid strain kind, and R3i3 is the i-th 3 The hybrid strain rate of the individual cytoplasm hybrid strain kind, t3 are all special hybrid strain matter genes of the i-th 3 cytoplasm hybrid strain kinds The number of type, i3j3 be the i-th 3 cytoplasm hybrid strain kinds all special hybrid strain matter genotype by frequency by it is low to After height sequence, the special hybrid strain matter genotype of jth 3, R3i3j3 is the frequency of the i-th 3j3 special hybrid strain matter genotype Rate；R3 is by the summation of the hybrid strain rate of the cytoplasm hybrid strain kind of hybrid strain matter genotype calculating, the cytoplasm hybrid strain product The hybrid strain rate of kind is to remove the special hybrid strain matter base of 80% and highest 10% minimum in the cytoplasm hybrid strain kind After the frequency of type, the average value of the frequency of the remaining special hybrid strain matter genotype；

Wherein, t4 is the hybrid strain matter base possessed except the cytoplasm hybrid strain kind Because of the number of the hybrid strain matter genotype outside type and frequency >=0.17%, i4 is except the cytoplasm hybrid strain kind possesses The hybrid strain matter genotype outside all hybrid strain matter genotype sorted from low to high by frequency after, the i-th 4 are described miscellaneous Strain matter genotype, R4i4 are the frequency of the i-th 4 hybrid strain matter genotype；R4 is utilized except the cytoplasm hybrid strain kind is gathered around The hybrid strain rate that the hybrid strain matter genotype having calculates, R4 is to remove the hybrid strain matter possessed except the cytoplasm hybrid strain kind In the frequency of genotype after the value of minimum 80% and highest 10%, the average value of surplus value；

Wherein, t5 is the number of the special test zone of hybrid；I5 is special for the i-th 5 hybrids Test zone；Rmi5 is in the i-th 5 special test zone of hybrid, the frequency of female genotype；Rfi5 is described in the i-th 5 In the special test zone of hybrid, the frequency of male parent gene type；Rm is the hybrid strain rate of maternal selfing, and Rm is that the hybrid is special In test zone, the average value of the frequency of the female genotype and the difference of the frequency of the male parent gene type；

Int () is bracket function；

The nucleus hybrid strain kind refers to calculate the hybrid strain kind obtained, the cytoplasm hybrid strain merely with karyogene type Kind refers to calculate the hybrid strain kind obtained merely with matter genotype；The special hybrid strain karyogene type refers to only one All hybrid strain karyogene types of the nucleus hybrid strain kind；The special hybrid strain matter genotype refers to only described in one All hybrid strain matter genotype of cytoplasm hybrid strain kind；The hybrid strain karyogene type refers to that the hybrid strain genotype is described Karyogene type；The hybrid strain matter genotype refers to that the hybrid strain genotype is the matter genotype；Specifically tested in the hybrid In region, the female genotype differs with the male parent gene type, and the female genotype and all nucleus are miscellaneous The genotype of strain kind is different, and the male parent gene type is also different from the genotype of all nucleus hybrid strain kinds；Institute It is the genotype identical genotype with female parent in the kind to be measured to state female genotype；The male parent gene type is described In kind to be measured, the genotype identical genotype with male parent；

The karyogene type refers to the genotype on nuclear genome；The matter genotype refers to be located at cytoplasmic skeleton On genotype.

5. according to the method for claim 4, it is characterised in that methods described also includes treating described in judgement in the following ways The correct probability of conclusion of uniformity and stability for surveying kind is：When the kind to be measured has uniformity and stability, Correct probability >=BINOM.DIST (M*SN, SN, R, TRUE) * BINOM.DIST of conclusion (∑ SeN*M, ∑ SeN, R, TRUE)； When the kind to be measured does not have the uniformity and stability, the correct probability >=BINOM.DIST of conclusion ((1-M) * SN, SN,(1-R),TRUE)*BINOM.DIST(∑SeN*(1-M),∑SeN,1-R,TRUE)；Wherein, M is to judge the uniformity With threshold value selected during stability, ∑ SeN is used for institute where calculating the frequency of the genotype of the hybrid strain rate R to be all The summation of the sequencing fragment of test zone is stated, BINOM.DIST (M*SN, SN, R, TRUE) is that the kind to be measured has been carried out SN times Sampling, probability of the hybrid strain rate R being actually pumped less than the threshold value M, BINOM.DIST (∑ SeN*M, ∑ SeN, R, TRUE meaning) is：SeN sampling of ∑ is carried out to the kind to be measured, the hybrid strain rate R being actually pumped is less than threshold value M Probability；BINOM.DIST ((1-M) * SN, SN, (1-R), TRUE) has carried out SN time for the kind to be measured and sampled, and actually takes out The hybrid strain rate R obtained is more than the probability of the threshold value M, BINOM.DIST (∑ SeN* (1-M), ∑ SeN, 1-R, TRUE) meaning Justice is：SeN sampling of ∑ is carried out to the kind to be measured, the hybrid strain rate R being actually pumped is more than threshold value M probability, institute The frequency for stating genotype refers in the sequencing fragment group that the sequencing segments for representing the genotype is accounted for where the genotype The ratio of the sequencing fragment sum of the test zone.

6. according to the method for claim 4, it is characterised in that when the change dystopy is not present in the non-universal test zone During point, if it is specific to judge that the kind to be measured has, the correct probability >=BINOM.DIST of conclusion ((1-SD) * TRN, TRN, 1-OD,TRUE)；If it is specific to judge that the kind to be measured does not have, the correct probability >=BINOM.DIST of conclusion (SD*TRN, TRN, OD, TRUE), wherein, TRN is the number for detecting successful test zone, and OD is the variant sites rate, BINOM.DIST For the function in excel 2010, the correct probability of conclusion is expressed as when judging that the kind to be measured has specific, The variant sites rate is more than SD probability, and when judging that the kind to be measured does not have specific, the variant sites rate is small In SD probability, the successful test zone of detection after analyzing the sequencing fragment group by obtaining.

7. according to the method for claim 1, it is characterised in that obtaining the method for the hybrid strain kind includes：The hybrid strain Kind is the kind being present in the database, and the potential hybrid strain genotype of the hybrid strain kind and the hybrid strain genotype Between have phase homogenic type the number of the test zone account for the hybrid strain kind there is the described of the potential hybrid strain genotype Total ratio >=60% of test zone；The hybrid strain genotype refers to the potential hybrid strain genotype of frequency >=0.02%；

Quantity >=2 or described of distinguishing base between all genotype of the potential hybrid strain genotype and the kind to be measured There are insertion or the missing of discontinuous base in distinguishing base.