CN104805119A - Novel endogenous gene expression substituting lentivirus vector and construction method thereof - Google Patents
Novel endogenous gene expression substituting lentivirus vector and construction method thereof Download PDFInfo
- Publication number
- CN104805119A CN104805119A CN201410034811.3A CN201410034811A CN104805119A CN 104805119 A CN104805119 A CN 104805119A CN 201410034811 A CN201410034811 A CN 201410034811A CN 104805119 A CN104805119 A CN 104805119A
- Authority
- CN
- China
- Prior art keywords
- egfp
- ef1a
- shrna
- carrier
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a novel endogenous gene expression substituting lentivirus vector. According to the present invention, a U6 promoter is inserted between the 5' LTR and the 3' LTR of lentivirus so as to perform transcription of a segment of a shRNA sequence, and the shRNA insertion region contains double restriction enzyme cutting sites such as BamHI and XhoI so as to insert the shRNA sequence after annealing; an EFla promoter is used for transcriptional expression of a Flag tag fused exogenous gene, the Flag tag is fused on the N terminal of the exogenous gene, and the multiple cloning site contains three restriction enzyme cutting sites such as HpaI, EcoRI and NheI3 so as to insert the exogenous gene, wherein the HpaI is the blunt-ended restriction enzyme cutting site so as to ensure insertion of any genes; IRES is used for starting the EGFP reporter gene; and the production of two proteins through the one RNA transcripted from the EFla can be achieved. In addition, the disadvantages of the conventional vectors are overcome, and the fast and efficient intracellular genetically modified way is provided.
Description
Technical field
The present invention relates to a kind of lentiviral vectors, the lentiviral vectors that especially a kind of novel alternative native gene is expressed and construction process thereof.
Background technology
Lentiviral vectors is by human immunodeficiency virus (Human immunodeficiency virus, HIV) transform, it eliminates the pathogenic of HIV to greatest extent, and can not self-replacation, with the foreign gene of synthetic and the viral coat of artificial modified.The advantage of lentiviral vectors is 1) various kinds of cell system can be infected, comprise the cell in division and non-division period; 2) minimum toxicity and immune response; 3) be incorporated into expeditiously in host genome, form stable exogenous gene expression, be applicable to very much setting up stable transgenic mice and people ES clone.
The main method of conventional gene research is imported in cell by foreign gene to make its process LAN, or make its low expression by gene knockout and RNA interference method, then the phenotypic alternation that occurs of analysis of cells and organism and inherent changes in gene expression, thus infer the function and efficacy of gene.Nowadays along with human genome map completes substantially, follow-up study emphasis has moved on to protein level from gene level, it is found that the rear modification of albumen and suddenlys change more complicated than genome, also more important.The conventional engineered gene of simple process LAN can not eliminate the interference of native gene, and simple RNA interference can not study concrete which amino acid playing an important role in this albumen.If carry out RNA interference and the engineered gene of process LAN simultaneously, ordinary method needs, by two-step approach successively interference and process LAN gene, to operate very loaded down with trivial details.If this gene pairs cell survival is of crucial importance, often cannot be disturbed or the intermediate product of process LAN, whole experiment cannot be carried out.
Summary of the invention
The present invention will solve the shortcoming of above-mentioned prior art, the lentiviral vectors providing a kind of single stage method efficiently to replace genes within cells and construction process thereof.
The present invention solves the technical scheme that its technical problem adopts: the lentiviral vectors that this novel alternative native gene is expressed has following structure: adopt carrier pLL3.7, pUC18 and lv-Lin28-GFP (Shanghai Si Dansai) as original plasmid, in the middle of slow virus 5 ' and 3 ' LTR, insert U6 promotor be used for transcribing one section of shRNA sequence, shRNA contains insert district BamHI and XhoI double enzyme site, can insert the shRNA sequence after annealing; EF1a promoter transcription expresses the foreign gene of Flag tag fusion, Flag tag fusion is held at the N of foreign gene, multiple clone site contains HpaI, EcoRI and NheI3 kind restriction enzyme site for inserting foreign gene, and wherein HpaI is that flat terminal enzyme is cut, and ensures that any gene can insert; IRES expresses EGFP reporter gene for starting; Realize a RNA transcribed by EF1a and can produce two albumen, be i.e. process LAN foreign protein and EGFP.
The construction process of the lentiviral vectors that this novel alternative native gene is expressed is as follows:
1) structure of pUC-EF1a-IRES-EGFP carrier: EF1a-IRES-EGFP element is cloned, the EF1a-IRES-EGFP EcoRI and PstI double digestion that obtain will be cloned, select pUC18 as original plasmid, with EcoRI and PstI double digestion, be connected reclaiming the plasmid obtained with the EF1a-IRES-EGFP element that enzyme cuts;
2) structure of pLL3.7-CQ carrier: the forward and reverse primer ENZYf1 of design and synthesis (5 '-TGGATCCGCGCGGTGACC-3 ') and ENZYr1 (5 '-TCGAGGGTCACCGCGCGGATCCA-3 ') for the formation of shRNA insertion point, the annealing of forward and reverse double-strand, select lentiviral vectors pLL3.7 as original plasmid, with HpaI and XhoI double digestion, the carrier that annealed product and enzyme cut is connected;
3) structure of pUC-Flag-EGFP carrier: the forward and reverse primers F lagF of design and synthesis (5 '-GATCAGCCACCATGGACTACAAGGACGACGATGACAAGGTTAACGAATTCG-3 ') and FlagR (5 '-CTAGCGAATTCGTTAACCTTGTCATCGTCGTCCTTGTAGTCCATGGTGGCT-3 ') for the formation of the multiple clone site with Flag label, the annealing of forward and reverse double-strand, select pUC-EF1a-IRES-EGFP as original plasmid, with BamHI and NheI double digestion, the carrier that annealed product and enzyme cut is connected;
4) structure of pLenti-FlagN-shRNA carrier: EF1a-Flag-EGFP element is cloned, PCR clones the EF1a-Flag-EGFP element Nsil enzyme obtained and cuts above, select lentiviral vectors pLL3.7-CQ as original plasmid, with NsiI and PvuII double digestion, being connected reclaiming the plasmid that obtains with the EF1a-Flag-EGFP element that enzyme cuts, finally obtaining all correct carrier of insertion sequence and direction and pLenti-FlagN-shRNA.
Inventing useful effect is: native gene is carried out RNA interference by shRNA perturbation technique by the present invention, can process LAN external source through same gene transformation again simultaneously, realize with original gene in engineered gene substitution organism, this carrier is lentiviral vectors, can high effective integration in host cell, long-term efficient performance gene substitution function, overcomes the shortcoming of carrier in the past, provides the means of a kind of genes within cells fast and efficiently transformation.
Accompanying drawing explanation
Fig. 1 is the structural representation of pLenti-FlagN-shRNA;
Fig. 2 be by virus infection after NCCIT at fluorescence microscopy Microscopic observation with to take pictures schematic diagram;
Fig. 3 is that Western Blot detects the interference of endogenous Oct4 and the expression schematic diagram of external source Oct4.
Embodiment
Below in conjunction with accompanying drawing, the invention will be further described:
As shown in Figure 1, lentiviral vectors pLenti-FlagN-shRNA of the present invention has following structure: slow virus 5 ' and the middle U6 promotor of inserting of 3 ' LTR are used for transcribing one section of shRNA sequence, the shRNA sequence after annealing, containing BamHI and XhoI double enzyme site, can be inserted in shRNA insert district (ggatccgcgcggtgaccctcgag).EF1a promoter transcription expresses the foreign gene of Flag tag fusion, Flag tag fusion is held at the N of foreign gene, multiple clone site (GTTAACGAATTCGCTAGC) containing HpaI, EcoRI and NheI3 kind restriction enzyme site for inserting foreign gene, wherein HpaI is that flat terminal enzyme is cut, and ensures that any gene can insert.IRES (Internal ribosome entry site, IRES) internal ribosome that is otherwise known as enters sequence, expressing EGFP reporter gene for starting, realizing a RNA transcribed by EF1a and can produce two albumen---process LAN foreign protein and EGFP.
This lentiviral vectors builds by the following method:
1) structure of pUC-EF1a-IRES-EGFP carrier
1.1.EF1a-IRES-EGFP the clone of element
Select lentiviral vectors lv-Lin28-GFP as original plasmid, according to its primers linF1 (5 '-G
gAATTCaCAAATGGCAGTATTCATCCACAA-3 ') and linR1 (5 '-AAA
cTGCAGcGGCAGGCGGGGAGGC-3 ').Then using lv-Lin28-GFP as pcr template, linF1 and linRI is primer, carries out pcr amplification with high-fidelity pfu enzyme.PCR thermocycling program is as follows: 94 DEG C of sex change 5min, 30 amplification cycles (72 DEG C extend 6min for 94 DEG C of sex change 30s, 64 DEG C of annealing 30s), last 72 DEG C of insulation 10min.
PCR primer leakage of electricity is swum, and reclaims the band of about 3K, i.e. EF1a-IRES-EGFP with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
1.2. the EF1a-IRES-EGFP EcoRI obtained is cloned above and PstI enzyme is cut
Following composition is added respectively in a 1.5ml centrifuge tube
37 DEG C of reaction 10min.80 DEG C of heat inactivation 20min.Product is stored in-20 DEG C.
1.3. select pUC18 as original plasmid, with EcoRI and PstI double digestion
Following composition is added respectively in a 1.5ml centrifuge tube:
37 DEG C of reaction 10min.
Digestion products leakage of electricity is swum, and reclaims the band of about 3.5K with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
1.4. be connected reclaiming the plasmid obtained with the EF1a-IRES-EGFP element that enzyme cuts
Following composition is added respectively in a 1.5ml centrifuge tube:
Water-bath 22 DEG C reaction 10min.
Connect product and be stored in-20 DEG C.
Transformation of E. coli Trans5a.
Select positive colony order-checking to confirm.Correct carrier and pUC-EF1a-IRES-EGFP are inserted in final acquisition
2) structure of pLL3.7-CQ carrier
2.1. the forward and reverse primer ENZYf1 of design and synthesis (5 '-TGGATCCGCGCGGTGACC-3 ') and ENZYr1 (5 '-TCGAGGGTCACCGCGCGGATCCA-3 ') is for the formation of shRNA insertion point.
The annealing of forward and reverse double-strand:
A) forward and reverse primer, synthesizes specification sheets aseptic deionized water according to DNA respectively, is configured to the working concentration of 20 μMs.
B) boiling water bath 10-15min, puts rapidly 2-5min on ice.DNA after sex change is stored in-20 DEG C.
C) water-bath is utilized to anneal.
Following composition is added respectively in a PCR pipe:
Water-bath is heated to more than 90 DEG C, and powered-down covers tightly pot cover, allows it naturally cool to room temperature.Final annealing product is stored in-20 DEG C.
2.2. select lentiviral vectors pLL3.7 as original plasmid, with HpaI and XhoI double digestion
Following composition is added respectively in a 1.5ml centrifuge tube:
37 DEG C of reaction 10min.
Digestion products leakage of electricity is swum, and reclaims the band of about 7K with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
2.3. the carrier that annealed product and enzyme cut is connected
Following composition is added respectively in a 1.5ml centrifuge tube:
Water-bath 22 DEG C reaction 10min.
Connect product and be stored in-20 DEG C.
Transformation of E. coli Trans5a.
Select positive colony order-checking to confirm.Correct carrier and pLL3.7-CQ are inserted in final acquisition.
3) structure of pUC-Flag-EGFP carrier
3.1. the forward and reverse primers F 1agF of design and synthesis (5 '-GATCAGCCACCATGGACTACAAGGACGACGATGACAAGGTTAACGAATTCG-3 ') and FlagR (5 '-CTAGCGAATTCGTTAACCTTGTCATCGTCGTCCTTGTAGTCCATGGTGGCT-3 ') is for the formation of the multiple clone site with Flag label.
The annealing of forward and reverse double-strand:
A) forward and reverse primer, synthesizes specification sheets aseptic deionized water according to DNA respectively, is configured to the working concentration of 20 μMs.
B) boiling water bath 10-15min, puts rapidly 2-5min on ice.DNA after sex change is stored in-20 DEG C.
C) water-bath is utilized to anneal.
Following composition is added respectively in a PCR pipe:
Water-bath is heated to more than 90 DEG C, and powered-down covers tightly pot cover, allows it naturally cool to room temperature.Final annealing product is stored in-20 DEG C.
3.2. select pUC-EF1a-IRES-EGFP as original plasmid, with BamHI and NheI double digestion
Following composition is added respectively in a 1.5ml centrifuge tube:
37 DEG C of reaction 10min.
Digestion products leakage of electricity is swum, and reclaims the band of about 5K with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
3.3. the carrier that annealed product and enzyme cut is connected
Following composition is added respectively in a 1.5ml centrifuge tube:
Water-bath 22 DEG C reaction 10min.
Connect product and be stored in-20 DEG C.
Transformation of E. coli Trans5a.
Select positive colony order-checking to confirm.Correct carrier and pUC-Flag-EGFP are inserted in final acquisition.
4) structure of pLenti-FlagN-shRNA
4.1.EF1a-Flag-EGFP the clone of element
Select pUC-Flag-EGFP as original plasmid, according to its primers UCF1 (5 '-TGC
aTGCATaAGCTTGATATCGGCTCCGGT-3 ') and UCR1 (5 '-ACTAGTAATCAACCTTTGGATTAC-3 ').Then using pUC-Flag-EGFP as pcr template, UCF1 and UCR1 is primer, carries out pcr amplification with high-fidelity pfu enzyme.PCR thermocycling program is as follows: 94 DEG C of sex change 5min, 30 amplification cycles (72 DEG C extend 4min for 94 DEG C of sex change 30s, 60 DEG C of annealing 30s), last 72 DEG C of insulation 10min.
PCR primer leakage of electricity is swum, and reclaims the band of about 1.6K, i.e. EF1a-Flag-EGFP with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
4.2. clone the EF1a-Flag-EGFP Nsil enzyme obtained above to cut
Following composition is added respectively in a 1.5ml centrifuge tube:
37 DEG C of reaction 10min.80 DEG C of heat inactivation 20min.Product is stored in-20 DEG C.
4.3. select lentiviral vectors pLL3.7-CQ as original plasmid, with NsiI and PvuII double digestion
Following composition is added respectively in a 1.5ml centrifuge tube:
37 DEG C of reaction 10min.
Digestion products leakage of electricity is swum, and reclaims the band of about 5K with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
4.4. be connected reclaiming the plasmid obtained with the EF1a-Flag-EGFP element that enzyme cuts
Following composition is added respectively in a 1.5ml centrifuge tube:
Water-bath 22 DEG C reaction 10min.
Connect product and be stored in-20 DEG C.
Transformation of E. coli Trans5a.
Select positive colony order-checking to confirm.Correct carrier and pLenti-FlagN-shRNA are inserted in final acquisition.
The application case of above plasmid is as follows:
In NCCIT cell, merge by external source and have the Oct4 of Flag label to substitute endogenous Oct4
1) shRNA design and insertion vector
1.1. the shRNA sequence (TTAAGTTCTTCATTCACTAAG) being positioned at 3 ' non-translational region for Oct4 gene is designed, and synthesize corresponding primer, shOct4F1 (5 '-GATCTTAAGTTCTTCATTCACTAAGCTCGAGCTTAGTGAATGAAGAACTTAATTTT TG-3 ') and shOct4R1 (5 '-TCGACAAAAATTAAGTTCTTCATTCACTAAGCTCGAGCTTAGTGAATGAAGAACTT AA-3 ').
1.2. the annealing of forward and reverse double-strand
A) forward and reverse primer, synthesizes specification sheets aseptic deionized water according to DNA respectively, is configured to the working concentration of 20 μMs.
B) boiling water bath 10-15min, puts rapidly 2-5min on ice.DNA after sex change is stored in-20 DEG C.
C) water-bath is utilized to anneal.
Following composition is added respectively in a PCR pipe:
Water-bath is heated to more than 90 DEG C, and powered-down covers tightly pot cover, allows it naturally cool to room temperature.Final annealing product is stored in-20 DEG C.
1.3. carrier pLenti-FlagN-shRNA BamHI and XhoI double digestion
Following composition is added respectively in a 1.5ml centrifuge tube:
37 DEG C of reaction 10min.
Digestion products leakage of electricity is swum, and reclaims the band of about 7K with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
1.4. the carrier that annealed product and enzyme cut is connected, and builds the lentiviral vectors of interference Oct4
Following composition is added respectively in a 1.5ml centrifuge tube:
Water-bath 22 DEG C reaction 10min.
Connect product and be stored in-20 DEG C.
Transformation of E. coli Trans5a.
Select positive colony order-checking to confirm.
2) Oct4 gene clone and insertion vector
2.1.Oct4 the clone of (geneID:5460)
Take Oct4cDNA as template, with high-fidelity pfu enzyme, primer hOct4F1 (5 '-CG
gAATTCcGCCATGGACTACAAGGACG-3 ') and hOct4R1 (5 '-CC
gCTAGCtCAGTTTGAATGCATGGGAGA-3 ') be PCR.PCR thermocycling program is as follows: 94 DEG C of sex change 5min, 30 amplification cycles (72 DEG C extend 3min for 94 DEG C of sex change 30s, 56 DEG C of annealing 30s), last 72 DEG C of insulation 10min.
PCR primer leakage of electricity is swum, and reclaims the band of about 1.1K with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
2.2.PCR product EcoRI-NheI double digestion is reclaimed
Following composition is added respectively in a 1.5ml centrifuge tube
37 DEG C of reaction 10min.80 DEG C of heat inactivation 20min.Product is stored in-20 DEG C.
2.3. the carrier EcoRI that built of the first step and NheI double digestion.
Following composition is added respectively in a 1.5ml centrifuge tube
37 DEG C of reaction 10min.Digestion products leakage of electricity is swum, and reclaims the band of about 6.3K with Axyprep DNA Gel Extraction Kit.By measuring its ultraviolet absorption value calculating concentration.Reclaim product and be stored in-20 DEG C.
2.4.Oct4 be connected with carrier, build the lentiviral vectors substituting endogenous Oct4.
A) in a 1.5ml centrifuge tube, following composition is added respectively:
B) water-bath 22 DEG C reaction 10min.
C) connect product and be stored in-20 DEG C.
D) transformation of E. coli Trans5a.
E) select the positive colony order-checking obtained to confirm.
3) slow virus packaging and host cells infected
3.1. slow virus packaging
A) use E.Z.N.A.TM Endo-Free Plasmid Kits extracting high density without endotoxic slow virus plasmid and two helper plasmid psPAX2 and pMD2.G.
B) by slow virus plasmid, psPAX2 and pMD2.G according to mass ratio 4: 3: 1 transfection HEK293T cell, concrete operations are carried out according to Superfectin II test kit specification sheets.After transfection, 8-12h changes fresh culture.
V) 48h after transfection collects the supernatant liquor containing virus, supplements fresh culture to HEK293T cell simultaneously.The vial supernatant of collection 72h and 96h like this.
D) vial supernatant is passed through 0.45 μm of membrane filtration, removing cell and large impurity.
3.2. slow virus infection host cell
A) cultivation needs latter stage in the cell of virus infection to exponential growth, ensures that it has good growth conditions.After peptic cell, pass on new Tissue Culture Plate according to the density that normally goes down to posterity.Overnight incubation or cultivation 12h make cell fully adherent and stretch.
B) suck substratum, add vial supernatant, supplement cell culture complete medium to proper volume, add polybrene to final concentration 7-8 μ g/ml.Put into incubator and normally cultivate 4-8h.
C) suck vial supernatant, add perfect medium.Normal cultivation 2-3 days.
D) collecting cell does fluorescence microscope or other subsequent experimental.
4) gene substitution effect detection
4.1. fluorescence microscope EGFP reporter gene
Observe under NCCIT after virus infection being directly placed on inverted fluorescence microscope and take pictures, as shown in Figure 2.
4.2.Western Blot detects the interference of endogenous Oct4 and the expression of external source Oct4
A) cell SDS cell pyrolysis liquid cracking, vibration mixing, boils 10min and cell is fully broken and protein denaturation.Protein sample is kept at-80 DEG C.
B) protein sample runs SDS-Page separation.By wet robin, albumen on glue is transferred on pvdf membrane.
C) room temperature 30min closed by film 5% skimmed milk.
D) primary antibodie (anti-Oct4) of suitable proportion dilution is added, incubated at room 2-4h.
E) PBST washing at least 3 times, each 5min.
F) add suitable proportion dilution two resist, incubated at room 1-2h.
G) PBST washing at least 3 times, each 5min.
H) according to ECL Western Blotting Substrate test kit specification sheets exposure colour developing.
In Fig. 3,1 represents untreated NCCIT cell; 2 is blank well; The NCCIT cell of 3 expression virus infectiones.Result shows, and after virus infection, NCCIT cellular endogenous Oct4 expresses disturbed, and external source is with the Oct4 high expression level of Flag label, and external source Oct4 contains Flag label, and after SDS-Page is separated, its band moves certain distance than on endogenous Oct4.
In addition to the implementation, the present invention can also have other embodiments.All employings are equal to the technical scheme of replacement or equivalent transformation formation, all drop on the protection domain of application claims.
Claims (2)
1. the lentiviral vectors of a novel alternative native gene expression, it is characterized in that: this lentiviral vectors has following structure: in the middle of slow virus 5 ' and 3 ' LTR, insert U6 promotor be used for transcribing one section of shRNA sequence, shRNA contains insert district BamHI and XhoI double enzyme site, can insert the shRNA sequence after annealing; EF1a promoter transcription expresses the foreign gene of Flag tag fusion, Flag tag fusion is held at the N of foreign gene, multiple clone site contains HpaI, EcoRI and NheI3 kind restriction enzyme site for inserting foreign gene, and wherein HpaI is that flat terminal enzyme is cut, and ensures that any gene can insert; IRES expresses EGFP reporter gene for starting; Realize a RNA transcribed by EF1a and can produce two albumen, be i.e. process LAN foreign protein and EGFP.
2. the construction process of lentiviral vectors according to claim 1, the steps include:
1) structure of pUC-EF1a-IRES-EGFP carrier: EF1a-IRES-EGFP element is cloned, the EF1a-IRES-EGFP EcoRI and PstI double digestion that obtain will be cloned, select pUC18 as original plasmid, with EcoRI and PstI double digestion, be connected reclaiming the plasmid obtained with the EF1a-IRES-EGFP element that enzyme cuts;
2) structure of pLL3.7-CQ carrier: the forward and reverse primer ENZYf1 of design and synthesis, its sequence is 5 '-TGGATCCGCGCGGTGACC-3 ', and ENZYr1, its sequence is 5 '-TCGAGGGTCACCGCGCGGATCCA-3 ', for the formation of shRNA insertion point, the annealing of forward and reverse double-strand, selects lentiviral vectors pLL3.7 as original plasmid, with HpaI and XhoI double digestion, the carrier that annealed product and enzyme cut is connected;
3) structure of pUC-Flag-EGFP carrier: the forward and reverse primers F lagF of design and synthesis (5 '-GATCAGCCACCATGGACTACAAGGACGACGATGACAAGGTTAACGAATTCG-3 ') and FlagR (5 '-CTAGCGAATTCGTTAACCTTGTCATCGTCGTCCTTGTAGTCCATGGTGGCT-3 ') for the formation of the multiple clone site with Flag label, the annealing of forward and reverse double-strand, select pUC-EF1a-IRES-EGFP as original plasmid, with BamHI and NheI double digestion, the carrier that annealed product and enzyme cut is connected;
4) structure of pLenti-FlagN-shRNA carrier: EF1a-Flag-EGFP element is cloned, PCR clones the EF1a-Flag-EGFP element Nsil enzyme obtained and cuts above, select lentiviral vectors pLL3.7-CQ as original plasmid, with NsiI and PvuII double digestion, being connected reclaiming the plasmid that obtains with the EF1a-Flag-EGFP element that enzyme cuts, finally obtaining all correct carrier of insertion sequence and direction and pLenti-FlagN-shRNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410034811.3A CN104805119A (en) | 2014-01-23 | 2014-01-23 | Novel endogenous gene expression substituting lentivirus vector and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410034811.3A CN104805119A (en) | 2014-01-23 | 2014-01-23 | Novel endogenous gene expression substituting lentivirus vector and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104805119A true CN104805119A (en) | 2015-07-29 |
Family
ID=53690317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410034811.3A Pending CN104805119A (en) | 2014-01-23 | 2014-01-23 | Novel endogenous gene expression substituting lentivirus vector and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104805119A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113238053A (en) * | 2021-04-30 | 2021-08-10 | 四川大学华西医院 | Plasmid for detecting STAT3 dimerization |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007109131A3 (en) * | 2006-03-17 | 2008-11-13 | Massachusetts Inst Technology | Lentiviral vectors that provide improved expression and reduced variegation after transgenesis |
| CN103205456A (en) * | 2012-01-13 | 2013-07-17 | 中国农业科学院棉花研究所 | Plant binary expression vector |
-
2014
- 2014-01-23 CN CN201410034811.3A patent/CN104805119A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007109131A3 (en) * | 2006-03-17 | 2008-11-13 | Massachusetts Inst Technology | Lentiviral vectors that provide improved expression and reduced variegation after transgenesis |
| CN103205456A (en) * | 2012-01-13 | 2013-07-17 | 中国农业科学院棉花研究所 | Plant binary expression vector |
Non-Patent Citations (1)
| Title |
|---|
| RUBINSON DA等: "A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference", 《NATURE GENETICS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113238053A (en) * | 2021-04-30 | 2021-08-10 | 四川大学华西医院 | Plasmid for detecting STAT3 dimerization |
| CN113238053B (en) * | 2021-04-30 | 2022-05-13 | 四川大学华西医院 | Plasmid for detecting STAT3 dimerization |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502608B (en) | Construction method and application of sgRNA and ALDH2 gene-deleted cell strain for knocking out human ALDH2 gene | |
| WO2016197355A1 (en) | Crispr-cas9 method for specific knockout of swine sall1 gene and sgrna for use in targeting specifically sall1 gene | |
| WO2016197358A1 (en) | Method for specific knockout of swine fgl-2 gene using crispr-cas9 specificity, and sgrna used for specifically targeting fgl-2 gene | |
| WO2016197361A1 (en) | Method for specific knockout of swine ggta1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting ggta1 gene | |
| WO2016197360A1 (en) | Method for specific knockout of swine gfra1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting gfra1 gene | |
| WO2016197354A1 (en) | Crispr-cas9 method for specific knockout of swine pdx1 gene and sgrna for use in targeting specifically pdx1 gene | |
| WO2016197357A1 (en) | Method for specific knockout of swine sla-3 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-3 gene | |
| WO2016197356A1 (en) | Method for knockout of swine sla-2 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-2 gene | |
| RU2020121408A (en) | SynPIII PROMOTER FOR SPECIFIC GENE EXPRESSION IN RETINA PIGMENT EPITHELIUM | |
| CN103074361B (en) | Method for integrating exogenous gene into sheep listeria genome | |
| CN106755089B (en) | Cell line for expressing goat lymphocyte activating molecules and construction method and application thereof | |
| Yang et al. | Deletion of cdvB paralogous genes of Sulfolobus acidocaldarius impairs cell division | |
| CN106399356B (en) | The construction method of viral infectivity clone a kind of and its application | |
| CN104762265A (en) | Novel method for obtaining goat-induced multi-potent stem cells | |
| CN102296073A (en) | Specific target site for site-directed knockout of gene Myostatin by zinc finger nuclease | |
| CN104805119A (en) | Novel endogenous gene expression substituting lentivirus vector and construction method thereof | |
| CN104073514B (en) | A kind of method for preparing multipotent stem cells | |
| CN114181973A (en) | Self-constructed sT2 cell expression exogenous SLA-2 gene and preparation method thereof | |
| CN103352050B (en) | Method for improving cell transfection efficiency through utilization of bacterial artificial chromosome homologous recombination | |
| CN103571794B (en) | A kind of PUMA of suppression function improves the method that iPS cell sets up effect | |
| CN114214338B (en) | Porcine PIV5 full-length infectious clone and preparation method and application thereof | |
| CN109679918A (en) | A kind of preparation method of convenient and fast people's inductive pluripotent stem cells | |
| CN102965372A (en) | SiRNA interfering GDF9 gene expression and application thereof | |
| CN105420196A (en) | Construction method and application for stably expressing HPV16 E5 protein cell strain | |
| CN110669791B (en) | Method for improving expression quantity of cell antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150729 |