CN104789568B - A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection - Google Patents
A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection Download PDFInfo
- Publication number
- CN104789568B CN104789568B CN201510125778.XA CN201510125778A CN104789568B CN 104789568 B CN104789568 B CN 104789568B CN 201510125778 A CN201510125778 A CN 201510125778A CN 104789568 B CN104789568 B CN 104789568B
- Authority
- CN
- China
- Prior art keywords
- cell
- screening
- library
- irido virus
- normal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection.In every wheel screening process, the step of introducing counter-selection twice, the single-stranded DNA banks of previous round are combined with normal cell first, to remove the non-specific ssDNA combined with normal lithosporic fry cell, then by supernatant with being combined screening by the cell of grouper irido virus infection, the isolated ssDNA from the cell infected by grouper irido virus, then combined again with normal cell, isolated supernatant.Prepare single-stranded DNA library in PCR amplifications library.Repeat the screening process of the above, compared with the normal cell number of first round screening, the number of normal cell in screening process is improved 26 times, with the library of first round screening compared with the binding time of cell, in subsequent screening process, library increases to 1h with normal cell binding time from 0.5h, and library foreshortens to 0.5h with virus infected cell binding time from 1h, to improve the screening efficiency often taken turns.
Description
Technical field：
The invention belongs to biology field, and in particular to one kind can be used for cellular level and the horizontal upper grouper of tissue
The DNA aptamers of irido virus (SGIV) infection detection and its screening technique and application.
Background technology：
Aptamer is a kind of new detection obtained by aglucon phyletic evolution technology (SELEX) screening of index concentration
And treatment tool.The aglucon phyletic evolution technology of index concentration is the biological libraries of a kind of wide concerned new detection and treatment
Technology.It is about 10 using artificial synthesized, capacity14~1015Random oligonucleotide library combined with target substance, through excessive
Wheel screening obtains the aptamer of target substance.The aptamer obtained using the technology screening is had and monoclonal antibody phase
When high specific and high-affinity, because screening is the chemical process that carries out in vitro, so from metal ion, organic dyestuff
Etc. simple system, to complex systems such as virus, cell, tissues, screening object can be used as, and aptamer is not immune
Originality, denaturation caused by temperature change is reversible, and the short expense of screening time is low, and obtained aptamer is readily synthesized and repaiied
Decorations.Therefore, aptamer not only there are bright prospects in new drug development field and noticeable, its biology in major disease
Medical basic research, medical diagnosis on disease field also show that wide application prospect.
China is aquaculture big country, and grouper is one of most rare marine fish, has high economic value.
However, being broken out in recent years in grouper and popular irido virus etc. has seriously threatened the sea-farming of grouper, cause
Huge economic loss.At present in the world in the method master of aquatic animal disease, including grouper irido virus quick diagnosis
To include the conventional method based on bacteriology, virology, parasitology and histopathology, the immunology detection side based on antibody
Method, Serologic detection technology and Protocols in Molecular Biology for the antibody of specified pathogen etc..These methods respectively have advantage
Simultaneously there is also wretched insufficiency, so must put forth effort to develop, new, specificity is stronger, sensitivity is higher, it is easier to operate
Aptamer come detect and control grouper irido virus (SGIV) infect.
The content of the invention：
First purpose of the present invention be to provide a kind of high specific, high sensitivity, non-immunogenicity, stable easily modification,
The DNA aptamers for being used to detect grouper irido virus infection be easy to synthesize and preserved.
The DNA aptamers for being used to detect grouper irido virus infection of the present invention, its nucleotide sequence such as SEQ
ID NO：Shown in 1, the mark for detection is combined with described nucleotide sequence.
Above-mentioned DNA aptamers, any position on its nucleotide sequence can be phosphorylated, methylate, amination,
Thinization or isotopologue.
The described mark that is used to detect is preferably：Fluorescein isothiocynate (FITC), carboxyl tetramethylrhodamine
(TAMRA), biotin, digoxin, fluorescent material, nano luminescent material, polyethylene glycol, peptide fragment, albumen, folic acid or enzyme mark.
Above-mentioned DNA aptamers, whether through part substitution or after modification, all have and former aptamer
Essentially identical or similar molecular structure, physicochemical property and function, it can be used in grouper irido virus (SGIV) detection.
Second object of the present invention provides a kind of screening technique of above-mentioned DNA aptamers, it is characterised in that including
Following steps：
(1) following random single-stranded DNA banks and primer, are synthesized：
Random library Library50：
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC
5 ' primers：5’-FITC-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers：5’-TAMRA-GACGCTTACTCAGGTGTGACTCG-3’；
3 ' primers：5’-Biotin-GAGACTTCATCTGCGTCCTTCG-3’；
(2), Cell-SELEX screening processes：Normal grouper splenocyte GS cells are infected with grouper irido virus,
Cell continues to cultivate 48h, with buffer solution infected GS cells is washed after removing culture medium, by the random library in step (1)
On ice, hatching combination 0.5h obtains supernatant with normal GS cells first after dissolving, then enters supernatant and infected GS cells
Row hatching combination 1h, liquid is removed after the completion of incubation and washs GS cells with buffer solution, then by the GS cells after washing in 85
~94 DEG C of 2~10min of heating, centrifugation obtain supernatant 1, by supernatant 1 and normal GS cells in hatching combination on ice, with obtaining
The identical method of supernatant 1 obtains supernatant 2, as by the specific nucleic acid aptamers library of the GS cells of irido virus infection；
(3), amplified library：The specific nucleic acid obtained using screening in the primer pair step (2) of the synthesis in step (1)
Performing PCR amplification is entered in aptamers library, obtains amplified production double-stranded DNA；
(4), the preparation in the single-stranded libraries of DNA：By the magnetic bead of streptavidin mark with the double-stranded DNA in step (3) normal
Temperature is lower to be incubated, and using the affinity interaction of streptavidin on the mark and magnetic bead on double-stranded DNA, double-stranded DNA is attached into magnetic bead
Surface, in magnetic bead add alkaline reaction after, recovery obtain supernatant, by supernatant by except salt plug be collected into it is mono- containing DNA
The solution in chain library；
(5) multi-turns screen, is repeated：The single-stranded libraries of DNA collected in step (4) are replaced to the random library in step (2),
Above step (2)-(4) are repeated at least 14 times, compared with the normal cell number of first round screening, by normal GS in screening process
The number of cell improves 2-6 times, with the library of first round screening compared with the binding time of cell, in subsequent screening process
In, library increases to 1h with normal GS cells binding time from 0.5h, and library is shortened with virus infected cell binding time from 1h
To 0.5h, to improve the screening efficiency often taken turns, that is, the DNA aptamers for detecting grouper irido virus infection are obtained.
It is preferred that the culture medium described in step (2) is L15 culture mediums.
It is preferred that the buffer solution described in step (2) is PBS.
It is preferred that the PCR amplifications described in step (3), its amplification system is 1000 μ l：10 × buffer 100 μ l, dNTP
(2.5mM) 80 μ l, the μ l of template 100, the μ l of 5 ' primer 30,3 ' primer, 30 μ l, rTaq enzyme 10 μ l, dsH2The μ l of O 650, amplification program
For：94 DEG C of 2min, 94 DEG C of 1min, 60 DEG C of 30sec, 72 DEG C of 1min, circulated by 12 wheels, 72 DEG C of 5min.
Recovery described in step (4) obtains supernatant, is preferably reclaimed by magnetic separation rack.
Third object of the present invention is to provide a kind of kit for being used to detect grouper irido virus infection, its feature
It is, contains above-mentioned SEQ ID NO：DNA aptamers shown in 1.
Fourth object of the present invention is to provide the above-mentioned DNA aptamers for being used to detect grouper irido virus infection
Application in the infection detection of grouper irido virus is carried out.
The present invention by the single-stranded library of random dna first with normal cell after being incubated on ice, the supernatant 1 that is recovered to it is sick
Poison infection GS cells be incubated on ice, collecting infecting cell is high-temperature denatured be recovered to supernatant 2 after, again with normal cell on ice
It is incubated, so as to remove the non-specific single stranded DNA combined with normal cell to greatest extent, realizes the purpose for improving screening efficiency.
Compared with prior art, the advantage of the invention is that：The present invention screens what is obtained by the cell SELEX of optimization
Aptamer, there is higher affinity and specificity compared with existing protein antibodies, but also there is protein antibodies institute
The characteristics of not possessing, including non-immunogenicity；Molecular weight is small, is easy to iii vitro chemical to synthesize；It is easy to the difference to aptamer
Position is modified and substituted；Sequence is stable and easy to transport and preserved；Short preparation period, favorable reproducibility；It is easy to mark etc..Using
It is simple to operate rapid when the aptamer of the present invention carries out the infection detection of grouper irido virus, can be in cellular level
With the infection that irido virus is detected in tissue level, dissociation constant is applied to related inspection within nanomolar range
Test agent box.This is significant for the quick detection of irido virus infection, has in the detection field of irido virus infection
Good application prospect.
Brief description of the drawings：
Fig. 1 is the 9th wheel that flow cytomery fluorescein isothiocynate (FITC) marks in the embodiment of the present invention, 10
Wheel, 11 wheels, 12 wheels, 13 wheels, 14 wheel screening libraries and the combination situation by the GS cells of irido virus infection, wherein, A is infection
SGIV GS target cells, B are normal GS control cells；
Fig. 2 is that flow cytomery screens obtained fluorescein isothiocynate (FITC) mark in the embodiment of the present invention
The aptamer of sequence 1 and the testing result by the GS cell binding abilities of irido virus infection；
Fig. 3 is the aptamer and quilt of the sequence 1 that carboxyl tetramethylrhodamine (TAMRA) marks in the embodiment of the present invention
The GS cells of irido virus infection, (two groups of pictures in figure, the left side is light field to normal GS cell dyeings fluorescence intensity comparison in difference
Imaging, the right is the imaging of fluorescence channel, is the information of different passages in same photo)；
Fig. 4 is the aptamer and quilt of the sequence 1 that carboxyl tetramethylrhodamine (TAMRA) marks in the embodiment of the present invention
Grouper liver organization, the normal grouper liver organization fluorescent staining strength difference of irido virus infection compare (two in figure
Group picture, the left side is the imaging of light field, and the right is the imaging of fluorescence channel, is the information of different passages in same photo).
Embodiment：
Following examples are to further explanation of the invention, rather than limitation of the present invention.In following examples
Experimental method is conventional method unless otherwise specified.Experiment material in following examples is from normal unless otherwise specified
Obtained by the biochemical reagents company purchase of rule.
Embodiment 1：
1st, the random single-stranded DNA banks and primer shown in following sequence are synthesized
Random library Library50：
5’-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC
5 ' primers：5’-FITC-GACGCTTACTCAGGTGTGACTCG-3’；
5 ' primers：5’-TAMRA-GACGCTTACTCAGGTGTGACTCG-3’；
3 ' primers：5’-Biotin-GAGACTTCATCTGCGTCCTTCG-3’；
2nd, Cell-SELEX screenings obtain specific recognition by the aptamer of the SGIV GS cells infected
10% hyclone culture GS cells are added in 2.1L15 culture mediums to confluent cultures bottom of bottle 95%, in blake bottle
Grouper irido virus (SGIV) is added, grouper irido virus infects normal grouper splenocyte GS cells, continues to cultivate
After 48h, the culture medium in the blake bottle for the cell being infected is removed, infected GS cells are washed with 15ml PBS；
2.2 are dissolved in the above-mentioned random libraries of 10nmol in 300 μ l binding buffer, 95 DEG C of water bath with thermostatic control 5min,
Then it is rapidly inserted into ice, ice bath 10min, 1mL is supplemented to binding buffer, by the random library after processing and 2.1
The middle GS cells by SGIV infection are incubated 1h on ice；
After the completion of 2.3 hatching combinations, the liquid in blake bottle is removed, cell in blake bottle is washed with 10mL PBS；With
Cell is scraped and mixed in 1mL PBS by cell scraper, and cell is mixed into liquid is transferred in EP pipes, 94 DEG C of water bath with thermostatic control 5min,
Supernatant is collected by centrifugation in 12000g, as infects the specific nucleic acid aptamers storehouse of SGIV GS cells.
3rd, PCR amplifications screening library
The specific nucleic acid aptamers storehouse of the GS cells for the infection SGIV that 200 μ l screen to obtain is taken to enter performing PCR amplification, specifically
Expanding bar program is：94 DEG C of 2min, 94 DEG C of 1min, 60 DEG C of 30sec, 72 DEG C of 1min, circulated by 12 wheels, 72 DEG C of 5min.First
The supernatant obtained after wheel screening, to be completely used for expanding into performing PCR, obtain amplified production.
4th, the preparation in the single-stranded libraries of DNA
The double-stranded DNA of the magnetic bead of 100 μ l streptavidins mark and PCR amplifications gained in step 3 is incubated at normal temperatures
30min, using the affinity interaction of streptavidin on the biotin and magnetic bead on double-stranded DNA, double-stranded DNA is attached to magnetic bead table
Face, EP pipes are placed on magnetic separator and remove supernatant, washed magnetic bead with 1mLPBS, then add 400ul in EP pipes
200mM NaOH solutions, normal-temperature reaction 15min, reclaim to obtain supernatant using magnetic separation rack；Except the salt plug sterile washings of 10mL
After washing, supernatant is added and removes salt plug, is dripped off naturally by Action of Gravity Field.1mL sterilized waters are added, are collected into containing the single-stranded texts of DNA
The solution in storehouse.
5th, as above repeated screening
The single-stranded libraries of the DNA obtained in step 4 are replaced into the random library in step (2), the sun shown in repeat step 2-4
Property screening process, PCR amplifications and single-stranded DNA banks producing process 14 times.
6th, negative screening
It is control with normal GS cells in being screened after the second wheel and the second wheel, screening after step 5 is obtained
The single-stranded libraries of DNA carry out negative screening to improve screening efficiency.Specifically negative screening process is：Culture GS cells to be paved with training
Bottom of bottle is supported, cell is washed with 15ml PBS；By screen obtain DNA library dissolving, after 95 DEG C of waters bath with thermostatic control, ice baths, it is and premenstrual
State the normal GS cells after processing and 0.5h is incubated on ice, the solution after cell incubation is collected after the completion of incubation；Then it is this is molten
Liquid carries out ice bath combination 1h with the GS cells infected by SGIV；The GS cells for infecting SGIV are heated through 85~94 DEG C of waters bath with thermostatic control
After supernatant 1 is collected by centrifugation in 2~10min, 12000g, then by this supernatant 1 and normal GS cells of another bottle after aforementioned processing
1h is incubated on ice, the supernatant 2 being collected into is the core of the GS cells of the high specific identification infection SGIV by counter-selection twice
Sour aptamers.
7th, 15 wheel screening
It is prepared by the supernatant solution that will be collected into step 6, the single-stranded DNA banks of PCR amplifications and step 4 by step 3
Afterwards, it is repeated in carrying out the process of step 6, step 2, step 3 and step 4, using library obtained by Flow cytometry to sense
The enhancing situation of SGIV GS cell recognition abilities is contaminated, compared with the normal cell number of first round screening, by screening process
The number of normal GS cells improves 2-6 times, with the library of first round screening compared with the binding time of cell, in subsequent screening
During, library increases to 1h, library and virus infected cell binding time from 1h with normal GS cells binding time from 0.5h
0.5h is foreshortened to, to improve the screening efficiency often taken turns, until after 15 wheel screenings, GS cell recognition energy of the library to infected SGIV
Power reaches most strong.By gained amplified production after cloning and sequencing is analyzed, finally give the present embodiment 1 can be used for detecting SGIV
The aptamer of infection, sequence such as SEQ ID NO：Shown in 1.
8th, the enrichment condition in Flow cytometry screening process amplifying nucleic acid aptamers library is utilized
The GS cells for infecting SGIV are handled with without enzymic digestion liquid, 1000g is centrifuged off supernatant, with 5mLPBS centrifuge washings
Three times.By the 9th wheel of 300nM fluorescein isothiocynates (FITC) mark, 10 wheels, 11 wheels, 12 wheels, 13 wheels, 14 wheel screening libraries
Be dissolved in 1mL binding buffer, then with the cell after above-mentioned processing in hatching combination 30min on ice, 1000g from
The heart removes supernatant, and, most cell is mixed in 500 μ l PBS at last, for flow cytomery with 5mLPBS centrifuge washings three times.
Using the cell combined with Library as control 1,2 are compareed with being combined into for normal GS cells with each wheel library, testing result is as schemed
Shown in 1.As a result, it was confirmed that this is by 14 screenings taken turns, and obtained screening library has stronger to the GS target cells for infecting SGIV
Specific recognition capability (Figure 1A), and to normal GS control cells without identification (Figure 1B).
9th, it is adapted to using the nucleic acid of four fluorescein isothiocynate (FITC) marks in Flow cytometry the present embodiment
Combination effect and its specificity of the body to infection SGIV GS cells
The hatching combination process of the processing of cell, cell and aptamer is as noted above, the detection of flow cytometry
As a result as shown in Fig. 2 as a result, it was confirmed that the aptamer of sequence 1 have to target cell infection SGIV GS cells it is stronger
Specific recognition capability.
10th, fluorescence microscope detects the nucleic acid adaptation of four carboxyl tetramethylrhodamine (TAMRA) marks in the present embodiment
The combination effect and its specificity of body and infection SGIV GS cells
GS cells are cultivated on cover glass in six orifice plates, continues to cultivate 48h after accessing SGIV, obtains infection SGIV GS
Cell, normal GS cells are cultivated on another cover glass as control, culture medium is removed, cell is washed with 10mL PBS.
Add the 1mL binding buffer containing the aptamer in the above-mentioned the present embodiment of 300nM, ice bath combination 30min.Instead
After should terminating, supernatant is removed, after slightly drying, cover glass is placed on slide and quenched with anti-fluorescence with 10mL PBSs three times
Go out agent mounting, observation.As shown in figure 3, the aptamer of sequence 1 has specific binding energy to the GS cells for infecting SGIV
Power, and ability is almost not bound with to normal GS cells, the result is consistent with the testing result of flow cytometer.
11st, the specific binding of grouper liver organization of the aptamer to being infected by irido virus is tested
The aptamer of sequence 1 marked with carboxyl tetramethylrhodamine (TAMRA), the grouper liver to infecting SGIV
Tissue freezing section carries out specific binding detection, by the combination of aptamer and normal grouper liver organization frozen section
As a result as control.Frozen section is washed 3 times with 100mL PBS first, section and 200 μ l are contained into 300nM TAMRA marks
The binding buffer incubations at room temperature of the aptamer of note combine 60min, and then tissue is placed on shaking table and uses 100mL
PBS is washed, and the dyeing for compareing normal structure is identical with washing methods.After tissue is slightly dried, with anti-fluorescence quenching mounting,
Fluorescence microscopy Microscopic observation.As shown in figure 4, grouper liver organization of the aptamer to infecting SGIV shown in sequence 1
With stronger specific binding capacity, and ability is almost not bound with to normal grouper liver organization.This is with infecting SGIV
Lithosporic fry cell fluorescence microscope result it is consistent with flow cytomery result.
Claims (4)
1. a kind of DNA aptamers for being used to detect grouper irido virus infection, its nucleotide sequence such as SEQ ID NO：1
It is shown, the mark for detection is combined with described nucleotide sequence.
2. the DNA aptamers according to claim 1 for being used to detect grouper irido virus infection, its feature exist
In the described mark for being used to detect is tetramethylrhodamine, biotin, digoxin, fluorescent material, nano luminescent material
Material, polyethylene glycol, peptide fragment, albumen, folic acid or enzyme mark.
3. the DNA aptamers according to claim 2 for being used to detect grouper irido virus infection, its feature exist
In described fluorescent material is fluorescein isothiocynate.
4. a kind of kit for being used to detect grouper irido virus infection, it is characterised in that containing described in claim 1
DNA aptamers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510125778.XA CN104789568B (en) | 2015-03-20 | 2015-03-20 | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510125778.XA CN104789568B (en) | 2015-03-20 | 2015-03-20 | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104789568A CN104789568A (en) | 2015-07-22 |
| CN104789568B true CN104789568B (en) | 2017-11-21 |
Family
ID=53554762
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510125778.XA Active CN104789568B (en) | 2015-03-20 | 2015-03-20 | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104789568B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105785024A (en) * | 2016-04-22 | 2016-07-20 | 中国科学院南海海洋研究所 | Aptamer-based enzyme-linked immunosorbent assay method for detecting iridovirus infection of groupers |
| CN106916821B (en) * | 2017-04-11 | 2020-12-22 | 中国科学院南海海洋研究所 | ssDNA nucleic acid aptamer and application thereof |
| CN109161547B (en) * | 2018-09-20 | 2021-11-09 | 广西科学院 | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus |
| CN110257387B (en) * | 2019-07-04 | 2022-10-28 | 广西科学院 | Aptamer for identifying grass carp hemorrhagic disease virus as well as construction method and application thereof |
| CN111073892B (en) * | 2019-10-30 | 2023-11-17 | 广西科学院 | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof |
| CN110643611B (en) * | 2019-10-30 | 2022-10-28 | 广西科学院 | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus |
| CN111363748B (en) * | 2020-02-07 | 2022-12-20 | 广西科学院 | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus |
| CN111363749B (en) * | 2020-02-07 | 2022-12-20 | 广西科学院 | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2218875C (en) * | 1991-07-23 | 2000-11-07 | The Research Foundation Of State University Of New York | Improvements in the in situ pcr |
| CA2073630C (en) * | 1991-08-30 | 2007-12-11 | Atsushi Ohshima | Method for synthesizing single-stranded stem-loop dnas, the products and uses therefor |
| CN1827778A (en) * | 2005-03-02 | 2006-09-06 | 国家海洋局第三海洋研究所 | Real-time fluorescence quantitative PCR detection method for fish iridovirus |
| CN101173317A (en) * | 2007-09-26 | 2008-05-07 | 中山大学 | Method for rapidly detecting grouper irido virus |
| CN102727879B (en) * | 2012-07-11 | 2013-12-25 | 中国科学院南海海洋研究所 | Spinner bottle production method of inactivated singapore grouper iridovirus (SGIV) vaccine |
-
2015
- 2015-03-20 CN CN201510125778.XA patent/CN104789568B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| Isolation and characterization of a new class of DNA aptamers specific binding to Singapore grouper iridovirus (SGIV) with antiviral activities;Pengfei Li.;《Virus Research》;20140421;第147页右栏第3段、第149页右栏第2段、表1及图3 * |
| 狂犬病毒核酸适配体的筛选及其生物学活性鉴定;梁红茹;《中国博士学位论文全文数据库 农业科技辑》;20130716;摘要、第26-27页及第38-47页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104789568A (en) | 2015-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104789569B (en) | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection | |
| CN104789696B (en) | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection | |
| CN104789568B (en) | A kind of DNA aptamers and its screening technique and application for being used to detect grouper irido virus infection | |
| CN108034659A (en) | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application | |
| CN111073892B (en) | Nucleic acid aptamer for identifying garrupa iridovirus infected cells, construction method and application thereof | |
| CN110643611B (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN111073891B (en) | Aptamer for detecting grouper iridovirus as well as construction method and application thereof | |
| CN107858358A (en) | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application | |
| CN102766693B (en) | Nucleic acid aptamer for detecting human hepatoma cell line SMMC-7721 as well as screening method and application thereof | |
| CN109161547B (en) | Nucleic acid aptamer and application thereof in detection of pathogenic vibrio alginolyticus | |
| CN105385691A (en) | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit | |
| CN107858359A (en) | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application | |
| CN113215167A (en) | Aptamer and application thereof in detection of cells infected by iridovirus of micropterus salmoides | |
| CN109136229B (en) | Aptamer for specifically recognizing trachinotus ovatus-derived nervous necrosis virus and application thereof | |
| CN104789570B (en) | A kind of DNA aptamers for being used to detect grouper irido virus infection and its screening technique and application | |
| CN106916821A (en) | A kind of ssDNA aptamers and its application | |
| CN103103182A (en) | Haliotis discus hannai microsatellite molecular marker and preparation method thereof | |
| CN107937404A (en) | A kind of aptamer and its application in identification, detection vibrio alginolyticus | |
| CN109207480A (en) | Aptamer and its application of the specificity for egg-shaped pompano nervous necrosis virus | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN109161548B (en) | Aptamer and application thereof in detection of trachinotus ovatus-derived nervous necrosis virus | |
| CN114657184A (en) | Multivalent aptamer functionalized DNA nano-structure probe and preparation method and application thereof | |
| CN111454956B (en) | Nucleic acid aptamer for Chinese soft-shelled turtle iridovirus as well as construction method and application thereof | |
| CN111363748B (en) | Aptamer, construction method thereof and application thereof in detection of Chinese softshell turtle rainbow virus | |
| CN111363749B (en) | Nucleic acid aptamer for detecting Chinese softshell turtle iridovirus as well as construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |