CN104694560A - Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof - Google Patents
Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof Download PDFInfo
- Publication number
- CN104694560A CN104694560A CN201310651365.6A CN201310651365A CN104694560A CN 104694560 A CN104694560 A CN 104694560A CN 201310651365 A CN201310651365 A CN 201310651365A CN 104694560 A CN104694560 A CN 104694560A
- Authority
- CN
- China
- Prior art keywords
- disulfide
- polynucleotide sequence
- trpdi2
- disulfide bond
- isomerase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof. The disulfide bond isomerase gene separated from Trichoderma reesei has a polynucleotide sequence of (a) (b) or (c): (a) a polynucleotide sequence shown as SEQ ID No.1; (b) a polynucleotide sequence complementary with the polynucleotide sequence in (a) according to the principle of complementary base pairing; and (c) a cDNA sequence of the polynucleotide sequence (a)shown in the SEQ ID NO.1 or (b) polynucleotide sequence: a polynucleotide sequence shown in SEQ ID NO.2. The invention also obtains disulfide isomerase the from the encoding of the disulfide bond isomerase gene separated from the Trichoderma reesei and verifies the application of disulfide isomerase.
Description
Technical field
The present invention relates to biochemical industry and microbiological genetic engineering field, particularly a kind of disulfide isomerase gene Trpdi2 coming from Trichodermareesei and uses thereof.
Background technology
Due to cellulase resource and cellulase production ability thereof, filamentous fungus has been a great concern in the past few decades, but along with development that is industrial and biological medicine, people wish to utilize the filamentous fungus with powerful secretion capacity as cell factory, more efficiently produce endogenous and foreign protein.
Relative to other expressed receptor, filamentous fungus has greater advantage as the expressed receptor of foreign protein.Relative to prokaryotic expression host, filamentous fungus can carry out as post translational processing processes such as disulfide formation, glycosylation, proteolytic enzyme cuttings to foreign protein; Relative to yeast, the glycosylation of filamentous fungus and Mammals closer to, yeast can be avoided for the excessive glycosylation of foreign protein; Relative to the high biological expression system such as mammalian cell, insect, filamentous fungus have fast growth, cost lower, be easier to the advantages (Zhong Yaohua etc., 2010) such as formation scale.Industrial filamentous fungus such as Trichodermareesei, aspergillus niger and aspergillus oryzae etc. have been regarded as the bacterial strain of GRAS (GenerallyRecognized as Safe) and foodstuff additive scope by U.S. food and drug administration in addition, ensure that its security as host strain (Zhang Jianjun etc., 2009; Liu Dehui etc., 2010).
Wherein, Trichodermareesei is as the bacterial strain of industrial widespread use, oneself protein secretion can reach 100g/L, but as host expresses foreign protein, output just maintains a milligram level, this mainly owing to transcribing, translating, the multilevel factor such as posttranslational modification and secretion limits (Nevalainen etc., 2005) of causing.In order to overcome these restrictions, people have also carried out a few thing, mainly concentrate on and use strong promoter, increase gene copy number, with in the operation of the transcriptional level such as native gene amalgamation and expression, although result display product has increase to a certain degree, but limited raising degree also represents that transcriptional level is not main limiting factor, current main research starts to turn to the rear process of translation.
To in the process be secreted into outside born of the same parents after self and foreign protein are translated, the quality monitoring of protein can be subject to, only have the protein correctly folding and have correct structure could by successful secretion (Saloheimo etc., 2012).And being formed in protein folding procedure of disulfide linkage is of crucial importance.Disulfide linkage is in protein and peptide chain or covalently bound key between interchain two halfcystines, its formation is the important step in oxidized form protein folding and ripening process, it can improve the stability of protein, reduce proteolytic enzyme to the degraded of protein, and have material impact to the structure and biological activity of protein.Disulfide linkage is mainly divided into three kinds to the Influencing Mechanism of protein active: 1. the halfcystine forming disulfide linkage is the avtive spot of enzyme, and its redox state determines the catalyzed reaction of enzyme; 2. disulfide linkage is near reactive site, affects enzymic activity by the whereabouts affecting enzyme active center group; 3. pass through the specific conformation of disulfide linkage Protein requirement with assurance function (Wang Liang etc., 2011).A lot of evidence confirms that disulfide linkage can spontaneous formation in vitro, but its speed is reacted far below in body, because the forming process of disulfide linkage is under the katalysis of enzyme in body, is realized by the transmission of electronics between halfcystine and disulfide linkage.The disulfide bond isomerase system be present in endoplasmic reticulum is responsible for the disulfide formation in Trichodermareesei, and the maturation for Trichoderma reesei proteins matter is very important.
When great expression is endogenous or foreign protein time, Trichodermareesei translation after process load overweight, cause the relative shortage of endoplasmic reticulum toolenzyme enzyme amount, the false folding of albumen can be caused to assemble.And by expressing disulfide isomerase gene, the ability of disulfide formation in protein maturation process can be improved, final foreign protein output (Sha etc., 2013 of increasing; Mukaiyama etc., 2010).So identify, clone the disulfide isomerase gene of high vigor, can be the ability of increase trichoderma reesei expression foreign protein, and the activity of external recovery disulfide linkage indispensable protein provide instrument.
Summary of the invention
An object of the present invention is to provide a kind of disulfide bond isomerase base Trpdi2 coming from Trichodermareesei.
Two of object of the present invention is to provide containing the above-mentioned expression vector and the recombinant host cell that come from the disulfide isomerase gene Trpdi2 of Trichodermareesei.
Three of object of the present invention is to provide the purposes of the disulfide bond isomerase coded by disulfide isomerase gene Trpdi2 coming from Trichodermareesei.
The invention discloses a kind of disulfide isomerase gene be separated from (Trichoderma reesei) Trichodermareesei, it is characterized in that, its polynucleotide sequence is for shown in (a) or (b):
Polynucleotide sequence shown in (a) SEQ ID No.1;
B () and polynucleotide sequence in (a) are according to the polynucleotide sequence of base pair complementarity principle complementation.
Preferably, its polynucleotide sequence is also for shown in (c):
The sequence of the cDNA of the polynucleotide sequence (a) shown in (c) SEQ ID NO.1 or (b) middle polynucleotide sequence: be the polynucleotide sequence shown in SEQ ID NO.2.
A kind of by as claimed in claim 1 from the disulfide bond isomerase coded by the disulfide isomerase gene that (Trichoderma reesei) Trichodermareesei is separated.
Preferably, its aminoacid sequence of described disulfide bond isomerase is the aminoacid sequence shown in SEQ ID NO.3.
A kind of expression vector containing, for example the disulfide isomerase gene be separated from (Trichoderma reesei) Trichodermareesei according to claim 1.Described expression vector be expression alien gene in bacterium or fungi recombinant expression vector and containing the recombinant host bacterial strain of this recombinant expression vector or transformant; This recombinant expression vector comprises: promotor, disulfide isomerase gene polynucleotide sequence of the present invention and terminator; Wherein, disulfide isomerase gene polynucleotide sequence is positioned at promotor downstream, and terminator is positioned at the downstream of exogenous gene sequence to be transcribed.
A kind of recombinant host cell of the expression vector containing disulfide isomerase gene described in claim 1.
Preferably, described disulfide bond isomerase is improving the application of endogenous or exogenous protein expression.
Preferably, described disulfide bond isomerase is in application that is stable and that recover in disulfide linkage indispensable enzyme activity.
The invention has the beneficial effects as follows that the present invention utilizes biological method to comprise protein expression in vitro and protein-active and measures to demonstrate in Trichodermareesei and have one to have the gene Trpdi2 of vital role to disulfide formation, and specify that the polynucleotide sequence of gene Trpdi2, and the polynucleotide sequence of its cDNA, and provide the aminoacid sequence of the disulfide bond isomerase of the disulfide isomerase gene coding coming from Trichodermareesei; Described disulfide bond isomerase can the disulfide formation of catalysis different sources albumen in vitro, is a kind of novel disulfide bond isomerase.Described disulfide bond isomerase can also be used to external recovery or keeps the activity of disulfide linkage indispensable enzyme, and may be used for the output improving trichoderma reesei expression foreign protein.
The term definition arrived involved in the present invention
Unless otherwise defined, otherwise all technology used herein and scientific terminology all have with those skilled in the art usually understand identical implication.Although any method, device and the material similar or equivalent with person described herein can be used in practice of the present invention or test, preferred method, device and material are described now.
Term " base pair complementarity principle " means in DNA molecular structure, the distance had between fixing number and DNA two chains due to the hydrogen bond between base remains unchanged, make base pairing must follow certain rule, certain and the Thymine (T, thymus pyrimidine) of Here it is Adenine (A, VITAMIN B4) matches, Guanine (G, guanine) certain and Cytosine (C, cytosine(Cyt)) matches, and vice versa.
Term " expression vector " means on the basis of cloning vector basic framework, increase Expression element (as promotor, RBS, terminator etc.), enables the carrier that goal gene is expressed.If expression vector pKK223-3 is a coli expression carrier with typical expression structure.Its basic framework is Plasmid replication origins from pBR322 and pUC and ampicillin resistance gene.In Expression element, have a heterozygosis tac strong promoter and terminator, have RBS site (if utilize this site, requiring interval 5-13bp between ATG) in promotor downstream, multiple clone site thereafter can load the target gene that will express.Goal gene in the present invention is the cDNA of polynucleotide sequence in the polynucleotide sequence (a) shown in SEQ ID NO.1 or (b).
Term " recombinant host cell " means the recipient cell of the plasmid vector comprising strong promoter RPL of the present invention and the terminator corresponding with it, and no matter use which kind of method to carry out inserting to produce recipient cell, such as directly draw, transduce or other method known in affiliated field.
Term " polynucleotide " means the deoxyribonucleotide of sub-thread or bifilar form, dezyribonucleoside (DNA), ribonucleoside or ribonucleotide (RNA) and polymkeric substance thereof.As described in the present invention disulfide isomerase gene " DNA " or " cDNA " and etc.Except nonspecific restriction, otherwise the nucleic acid of the known analogue containing natural nucleotide contained in described term, and described analogue has the binding characteristic that is similar to reference nucleic acid and carries out metabolism in the mode of the Nucleotide being similar to natural generation.Unless other specific restriction, otherwise described term also means oligonucleotide analogs, and it comprises PNA (peptide nucleic acid(PNA)), DNA analogue used in antisense technology (thiophosphatephosphorothioate, phosphamide acid esters etc.).Unless otherwise, otherwise the specific nucleic acid sequence sequence that also impliedly contains its conservative varient (including, but is not limited to degenerate codon replace) of modifying and complementary sequence and clearly specify.Particularly, the 3rd sequence replaced through mixing base and/or deoxyinosine residue by producing one of them or more than one selected (or all) codon replaces to realize degenerate codon (people such as Batzer, Nucleic Acid Res.19:5081 (1991); The people such as Ohtsuka, J.Biol.Chem.260:2605-2608 (1985); With people such as Cassol, (1992); The people such as Rossolini, Mol Cell.Probes8:91-98 (1994)).Wherein, the cDNA of the disulfide isomerase gene mentioned in the present invention is the RNA reverse transcription obtained after transcribing by the DNA of disulfide isomerase gene.
Term " amino acid " means the fundamental unit forming protein, gives protein specific molecular morphosis, makes his molecule have biochemical activity.Protein is bioactive molecule important in organism, comprises the metabolic ferment of catalysis and enzyme.Different amino acid dehydrating condensations forms peptide (original segments of protein), is proteinogenous precursor.
Term " intrinsic protein ", " foreign protein " and " albumen " mean the polymkeric substance of amino-acid residue.It is the aminoacid polymers of non-naturally encoded amino acids that described term is applicable to natural generation aminoacid polymers and one of them or more than one amino-acid residue.
Accompanying drawing explanation
The electropherogram that Fig. 1 is disulfide isomerase gene Trpdi2 and expresses for Trpdi2.
Fig. 2 is that the disulfide bond isomerase of disulfide isomerase gene Trpdi2 after e. coli bl21 (DE3) abduction delivering and ni-sepharose purification is at SDS polyacrylate hydrogel electrophorogram.
Fig. 3 is disulfide bond isomerase determination of activity result.
Fig. 4 is that different concns DTT process is to Trichodermareesei Mierocrystalline cellulose excision enzyme CBH1 activity influence.
Fig. 5 is the activation recovering result figure of disulfide bond isomerase to the Trichodermareesei Mierocrystalline cellulose excision enzyme CBH1 of reduction inactivation.
Embodiment
Below in conjunction with accompanying drawing, the present invention is described in further detail, can implement according to this with reference to specification sheets word to make those skilled in the art.
Embodiment 1: the clone of disulfide isomerase gene
(1) clone of Trpdi2 genomic dna
According to the sequence information as SEQ ID:1 in Trichodermareesei data (http://genome.jgi-psf.org/Trire2/Trire2.home.html), design relevant primer, described primer sequence is:
Trpdi2-F：ATGGTCTTGATCAAGAGCCTC，
Trpdi2-R：TCACAGCTCGTCCTTCTGG，
The QM9414 strain gene group DNA preserved with-20 DEG C, for template, carries out pcr amplification and obtains full length gene DNA fragmentation, and be cloned into pGEM-T carrier.
Wherein, PCR reaction system is:
PCR reaction conditions is:
(2) clone of Trpdi2cDNA
The QM9414 bacterial strain cDNA preserved with-80 DEG C, for template, obtains cDNA fragment with Trpdi2-F and Trpdi2-R for primer carries out pcr amplification, and is cloned into pGEM-T carrier.
Wherein,
PCR reaction system is:
PCR reaction conditions is:
Embodiment 2: the expression of disulfide bond isomerase and determination of activity
(1) expression vector establishment of disulfide isomerase gene Trpdi2
According to the primer of disulfide isomerase gene Trpdi2 sequences Design end with restriction enzyme site, the QM9414 bacterial strain cDNA preserved with-80 DEG C is for template, carry out pcr amplification and obtain the DNA fragmentation containing disulfide isomerase gene Trpdi2 sequence cDNA, the DNA fragmentation utilizing NcoI and BamHI double digestion to reclaim and the pET-24d carrier of this Laboratories Accession, as shown in Figure 1.Two endonuclease bamhis are reclaimed to connect and obtains expression vector, by the expression vector transformation of E. coli DH5 α obtained.The bacillus coli DH 5 alpha of conversion is carried out order-checking to detect, obtaining checking order detecting proves to transform correct DH5 α, extracts plasmid transformation escherichia coli BL21 (DE3).In Fig. 1, Trpdi2 represents the disulfide isomerase gene after double digestion, and pET-24d is the expression vector of double digestion.
Wherein, the condition of contact of construction of expression vector is:
(2) expression of disulfide bond isomerase TrPDI2
Picking contains the positive single bacterium colony of BL21 of pET24d-Trpdi2 plasmid, is seeded to 5mL and contains in the LB substratum of kantlex, 37 DEG C of concussion overnight incubation; Get 1mL bacterium liquid to be seeded to 100mL and to contain in the LB substratum of kantlex, 37 DEG C of concussions are cultured to OD600=0.6-0.8; Add IPTG to final concentration 0.2mM, 16 DEG C, 150rpm shaking culture 8h.
(3) purifying of disulfide bond isomerase TrPDI2
Above-mentioned concussion is cultivated the LB substratum of the BL21 Positive E. coli containing pET24d-Trpdi2 plasmid of 8h through collected by centrifugation BL21 thalline, the broken BL21 thalline of high pressure crusher, centrifugal rear separation of supernatant and precipitation, and supernatant liquor and precipitation are carried out polyacrylamide gel electrophoresis SDS-PAGE respectively, the position of testing goal protein disulfide bond isomerase is more concentrated in supernatant liquor.Afterwards supernatant liquor was carried out ni-sepharose purification target protein as sample, used the elutriant gradient elution target protein of different concns imidazoles afterwards, and carried out concentrated collection after obtaining pure protein and obtain target protein.As shown in Figure 2, for sample, stream wear the electrophorogram of target protein in liquid and different concns imidazole elution, wherein, sample is supernatant liquor, it is that supernatant liquor flows through and crosses post liquid after nickel post that stream wears liquid, and concentration is respectively the imidazole elution of 20mM, 50mM, 100mM, 150mM and 200mM, as shown in Figure 2, target protein molecular weight is 40kDa, in the imidazole elution of sample, percolation liquid and different concns, target protein content is all higher, and only containing target protein in different concns imidazole elution, reach the object of purifying target protein.
(4) disulfide bond isomerase TrPDI2 determination of activity
5mg RNaseA is dissolved in 1mL6M Guanidinium hydrochloride, 0.14M DTT solution, normal temperature is placed to spend the night and is carried out the process of reduction inactivation to RNaseA, RNaseA albumen after process carries out purifying by desalting column, when there is reductive glutathione, Sleep-promoting factor B and substrate cCMP, measure the change of A296, the renaturation degree of reflection RNaseA, measures PDI2 to the reactive behavior of RNaseA.As shown in Figure 3, left side is the TrPDI2 protein sample sds polyacrylamide gel electrophoresis figure for determination of activity experiment, right side is the disulfide bond isomerase Activity determination result of TrPDI2, wherein the curve representation of Fig. 3 is along with the carrying out reacted, reaction solution in the change of 296nm absorbancy, the degree of to be substrate cCMP by activated ribonuclease A effect the generate product of reaction.As shown in Figure 3, do not add TrPDI2 and reduce the RNaseA of inactivation and substantially there is no activity, and add TrPDI2 can the activity of recuperation section RNaseA, illustrate that TrPDI2 has the activity of disulfide bond isomerase.
Embodiment 3: disulfide bond isomerase is for the impact of exoglucanase activity
(1) disulfide linkage is on the impact of exoglucanase CBH1 protein-active
With Trichodermareesei fermented liquid for sample, by DEAE protein chromatographic column separating purification to CBH1 pure protein.With the DTT process CBH1 of different concns, measure the CBH1 protein-active of process after 1,2,3,4,5,6 and 18 hours, determination of activity is with the active reaction to substrate pNPC.As shown in Figure 4, left side is the sds polyacrylamide gel electrophoresis figure of the CBH1 protein sample of purifying, right side is the CBH1 Activity Results figure after DTT process different time, the pNPC enzymic activity of the CBH1 wherein after three curve representation process different times, along with the treatment time of DTT, CBH1 enzymic activity declines; Along with the increase of DTT concentration for the treatment of, CBH1 enzymic activity declines quicker.The disulfide linkage of CBH1 active site of protein is very important for the maintenance of its enzymic activity as shown in Figure 4.
(2) disulfide bond isomerase is for the activation recovering of inactivation CBH1
Utilize 6M Guanidinium hydrochloride, 0.14M DTT carries out inactivation process to CBH1 pure protein, and utilize desalting column purifying inactivating protein.With the CBH1 of the system process inactivation of TrPDI2 determination of activity, and measure the protein-active after process 4,8,12,16,20,24,28,32 and 36h.As shown in Figure 5, add TrPDI2 and partly can recover to reduce completely the CBH1 protein-active (CBH1 of reduction inactivation can't detect enzymic activity) of inactivation, as shown in Figure 5, TrPDI2 can recover the loss of activity of the CBH1 albumen caused due to the fracture of disulfide linkage.
RNaseA and the CBH1 two kinds of enzymes related in embodiment 2 and embodiment 3 all define quantity disulfide linkage not etc. when forming space structure, and it maintains the active disulfide linkage needing correct formation, therefore all belong to the necessary enzyme of disulfide linkage, the activation recovering of disulfide bond isomerase TrPDI2 of the present invention to these two kinds of enzymes all has certain effect, and demonstrates TrPDI2 of the present invention and can be applicable to stable and recover disulfide linkage indispensable enzyme activity.
Although embodiment of the present invention are open as above, but it is not restricted to listed in specification sheets and embodiment utilization, it can be applied to various applicable the field of the invention completely, for those skilled in the art, can easily realize other amendment, therefore do not deviating under the universal that claim and equivalency range limit, the present invention is not limited to specific details and illustrates here and the legend described.
Claims (8)
1. the disulfide isomerase gene be separated from Trichodermareesei (Trichoderma reesei), is characterized in that, its polynucleotide sequence is for shown in (a) or (b):
Polynucleotide sequence shown in (a) SEQ ID No.1;
B () and polynucleotide sequence in (a) are according to the polynucleotide sequence of base pair complementarity principle complementation.
2. the disulfide isomerase gene be separated from (Trichoderma reesei) Trichodermareesei as claimed in claim 1, it is characterized in that, its polynucleotide sequence is also for shown in (c):
The sequence of the cDNA of the polynucleotide sequence (a) shown in (c) SEQ ID NO.1 or (b) middle polynucleotide sequence: be the polynucleotide sequence shown in SEQ ID NO.2.
3. one kind by as claimed in claim 1 from the disulfide bond isomerase coded by the disulfide isomerase gene that (Trichoderma reesei) Trichodermareesei is separated.
4. disulfide bond isomerase as claimed in claim 3, it is characterized in that, its aminoacid sequence is the aminoacid sequence shown in SEQ ID NO.3.
5. the expression vector containing, for example the disulfide isomerase gene be separated from (Trichoderma reesei) Trichodermareesei according to claim 1.
6. the recombinant host cell of the expression vector containing disulfide isomerase gene described in claim 1.
7. disulfide bond isomerase as claimed in claim 3, is characterized in that, it is improving the application of endogenous or exogenous protein expression.
8. disulfide bond isomerase as claimed in claim 3, is characterized in that, it is in application that is stable and recovery disulfide linkage indispensable enzyme activity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310651365.6A CN104694560A (en) | 2013-12-04 | 2013-12-04 | Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310651365.6A CN104694560A (en) | 2013-12-04 | 2013-12-04 | Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104694560A true CN104694560A (en) | 2015-06-10 |
Family
ID=53342113
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310651365.6A Pending CN104694560A (en) | 2013-12-04 | 2013-12-04 | Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104694560A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10927360B1 (en) | 2019-08-07 | 2021-02-23 | Clara Foods Co. | Compositions comprising digestive enzymes |
| US11160299B2 (en) | 2019-07-11 | 2021-11-02 | Clara Foods Co. | Protein compositions and consumable products thereof |
| US11279748B2 (en) | 2014-11-11 | 2022-03-22 | Clara Foods Co. | Recombinant animal-free food compositions and methods of making them |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100144013A1 (en) * | 2007-03-21 | 2010-06-10 | Frits Goedegebuur | Over expression of foldases and chaperones improves protein production |
| CN101842479A (en) * | 2007-11-01 | 2010-09-22 | 丹尼斯科美国公司 | Signal sequences and co-expressed chaperones for improving protein production in a host cell |
-
2013
- 2013-12-04 CN CN201310651365.6A patent/CN104694560A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100144013A1 (en) * | 2007-03-21 | 2010-06-10 | Frits Goedegebuur | Over expression of foldases and chaperones improves protein production |
| CN101842479A (en) * | 2007-11-01 | 2010-09-22 | 丹尼斯科美国公司 | Signal sequences and co-expressed chaperones for improving protein production in a host cell |
Non-Patent Citations (4)
| Title |
|---|
| GOEDEGEBUUR,F.: "AGY16063.1", 《GENBANK》 * |
| HIROYUKI MUKAIYAMA 等: "Overexpression of protein disulfide isomerases enhances secretion of recombinant human transferrin in Schizosaccharomyces pombe", 《APPL MICROBIOL BIOTECHNOL》 * |
| UNIPROT: "G0R756，ER-resident thioredoxin protein", 《EBI》 * |
| 熊向华 等: "二硫键异构酶", 《中国生物工程杂志》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11279748B2 (en) | 2014-11-11 | 2022-03-22 | Clara Foods Co. | Recombinant animal-free food compositions and methods of making them |
| US11160299B2 (en) | 2019-07-11 | 2021-11-02 | Clara Foods Co. | Protein compositions and consumable products thereof |
| US11800887B2 (en) | 2019-07-11 | 2023-10-31 | Clara Foods Co. | Protein compositions and consumable products thereof |
| US11974592B1 (en) | 2019-07-11 | 2024-05-07 | Clara Foods Co. | Protein compositions and consumable products thereof |
| US10927360B1 (en) | 2019-08-07 | 2021-02-23 | Clara Foods Co. | Compositions comprising digestive enzymes |
| US11142754B2 (en) | 2019-08-07 | 2021-10-12 | Clara Foods Co. | Compositions comprising digestive enzymes |
| US11649445B2 (en) | 2019-08-07 | 2023-05-16 | Clara Foods Co. | Compositions comprising digestive enzymes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103709236B (en) | Signal peptide capable of improving secretion efficiency, and applications thereof | |
| US10557130B2 (en) | Arginine deiminase mutant and methods of using the same | |
| CN116355881B (en) | Beta-xylosidase mutant D395G with improved acid tolerance and application thereof | |
| CN103160487A (en) | Heparinase I fusion protein | |
| CN111690627B (en) | Endo-1, 3-fucoidan and application thereof | |
| CN111893126A (en) | Alkaline protease gene, alkaline protease, preparation method and application thereof | |
| Chen et al. | Heterologous expression and characterization of Penicillium citrinum nuclease P1 in Aspergillus niger and its application in the production of nucleotides | |
| CN104694560A (en) | Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof | |
| CN116497005A (en) | Beta-xylosidase mutant K130GK137G with reduced heat tolerance and application thereof | |
| CN107603994B (en) | Kappa-carrageenase and gene and application thereof | |
| CN112980865A (en) | Construction method of recombinant human-like collagen engineering bacteria | |
| CN116555233A (en) | Thermostable beta-xylosidase mutant E179GD182G and application thereof | |
| CN106939315B (en) | Preparation method and application of oxalate decarboxylase | |
| CN113969290B (en) | Deep sea bacteria-derived alpha-glucosidase QsGH97a and encoding gene and application thereof | |
| Madhavan et al. | Secreted expression of an active human interferon‐beta (HuIFNβ) in Kluyveromyces lactis | |
| CN113462678B (en) | Glutamic acid decarboxylase mutant | |
| CN108998462B (en) | Escherichia coli expression system of manganese ion-containing recombinant protein and application method thereof | |
| CN111471669A (en) | Heparin lyase mutant and recombinant expression method thereof | |
| CN1312183C (en) | Heparinase I fusion protein and genes encoding same and expression method thereof | |
| CN104774813A (en) | Leucine dehydrogenase as well as preparation method and application thereof | |
| CN104480125B (en) | Trachinotus ovatus thioredoxin gene | |
| CN102653768B (en) | GH (Glycoside hydrolases) 18th family chitinase gene cloning method | |
| AU2007333395A1 (en) | Improved expression system for recombinant human arginase I | |
| WO2014177021A1 (en) | Strong secretory signal peptide enhancing small peptide motif and use thereof | |
| Esipov et al. | Production of thymosin α1 via non‐enzymatic acetylation of the recombinant precursor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Dongyuan Inventor after: Wang Guokun Inventor after: Lv Pin Inventor after: He Ronglin Inventor after: Chen Shulin Inventor before: Zhang Dongyuan |
|
| COR | Change of bibliographic data | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150610 |
|
| RJ01 | Rejection of invention patent application after publication |