CN104630177A - Method for utilizing human butyrylcholinesterase minigene to express recombinant human butyrylcholinesterase in mammary gland - Google Patents

Abstract

The present invention provides a method for utilizing human butyrylcholinesterase minigene to express recombinant human butyrylcholinesterase in mammary gland. According to the method, the human butyrylcholinesterase minigene is adopted to completely replace the target gene on the artificial chromosome of the mammal mammary gland specific expression protein by using the recombinant technology, such that the exogenous gene acquires the complete regulation sequence highly expressing the target gene in the mammary gland; under the premise of no influence on transcription and translation of the butyrylcholinesterase gene, the size of the human butyrylcholinesterase gene is reduced through the modification on the artificial chromosome so as to obtain the human butyrylcholinesterase minigene; and the obtained recombinant artificial chromosome is transformed into the mammal so as to express the recombinant human butyrylcholinesterase in the animal mammary gland. According to the present invention, the disadvantages that the position effect of the exogenous gene expression and easy silencing of the cDNA expression exogenous gene are overcome, the in vitro recombination operation is easy to perform, the vector construction is convenient, and the new strategy is provided for the expression of the large structure gene protein.

Description

A kind of method utilizing hBCHE Mini-gene to express recombinant human BuCh lipase in mammary gland

Technical field

The present invention relates to genetically engineered field, particularly relate to a kind of method utilizing hBCHE Mini-gene to express recombinant human BuCh lipase in mammary gland.

Background technology

Butyrylcholine esterase, also known as pseudocholinesterase (BCHE), belongs to serine ester enzyme family.It is mainly distributed in serum and liver in vivo, also has a small amount of existence in muscle and cerebral tissue.This albumen is the natural toxinicide in human body, can be hydrolyzed many ester classes, peptide class and amides, and participate in the metabolic process of some drugs, it also has the effect of Promote cell's growth.

BCHE is better to BuCh and benzoylcholine specificity, can also be combined specifically, and participate in metabolism and the bio-transformation of some ester compounds with organophosphorus toxicants or sterilant, as Cocaine, and succinylcholine etc.The materials such as the organophosphorus toxicants that BCHE enters through digestive tube or respiratory tract to external world have detoxification.Lack the activity of BuChE in BCHE gene mutation body people colony or active to reduce, when need BCHE carry out the esters medicine of metabolism or poisonous substance enter body time, because metabolic disturbance causes these photosynthetic matter accumulations, there is serious clinical symptom.In body, a large amount of BCHE supplementing normal activity can prevent or give treatment to.

Pseudocholinesterase scholar is again exploring the poisoning biological control approach of organophosphorus toxicants in recent years, selects some Blood proteins bioscrubbing agent preventive administrations, is namely eliminated before making toxic agent arrival target organ in blood flow.The advantage applying this kind of bioscrubbing agent is, when dosage is enough, poisoner can not occur toxicity symptom completely, exempts the many miseries of patient.Scavenging agent is organism self component, has no side effect.And BCHE has very high reactivity and selectivity to multiple organo phosphorous compounds, Half-life in vivo is longer, and about about 1 week, single injection can protect the long period.BCHE is the soluble proteins composition in blood plasma, and injection natural human BCHE can not produce detrimentally affect to human body, is more satisfactory protective enzymes.

Although we can obtain butyrylcholine esterase by large-scale purification technique from human plasma, the production of what the supply due to human blood was limited and serious limit butyrylcholine esterase.The suppression of butyrylcholine esterase to nerve poisons such as organophosphoruss plays a role with the stoichiometry of 1:1, therefore will effectively prevent the phenomenon of organophosphate poisoning and treatment organophosphate poisoning symptom just to need a large amount of butyrylcholine esterases.Compared with other organophosphorus bioscrubbing agent, butyrylcholine esterase has the advantages such as broad spectrum, relatively long transformation period and less side effect.The system expressing recombinant protein in galactophore of transgenic animal is very ripe, and a large amount of recombinant proteins, comprises immune antibody, and tethelin and thrombin can be expressed in mammary gland, and are secreted in milk.Therefore utilize breeding transgenic livestock to secrete in milk optimal selection that recombinant protein Restruction hBCHE becomes us.But hBCHE gene size is about 80kb, by very low to the efficiency of arresting in carrier PBR322 for BCHE gene (initiator codon is about 59kb to terminator codon) restructuring, operate more difficult to this gene.

In prior art, the expression of macrostructure gene protein is cDNA and expresses.For the manipulation in vitro of large fragment gene, depend on recombinant technology, routine in vitro large fragment reorganization operation is generally at 10-40kb.Therefore, arresting of 80kb fragment is more difficult technically, even if success, successful efficiency is also low-down.The present invention, by modifying hBCHE gene, reduces gene size, is easy to vitro recombination operation, is convenient to the structure of carrier.

In order to the shortcoming that the position effect and cDNA expression alien gene that overcome exogenous gene expression are easily silenced, genomic gene and long segment control region is adopted to build the main policies that foreign recombinant proteins expression vector becomes vector construction.Genomic gene after this carrier have employed modification on the one hand replaces cDNA to express, adopt the expression of the control region regulation and control hBCHE of human lactoferrin BAC on the other hand, ensure that the stable integration of foreign gene and entail offspring, reducing the probability that foreign gene is silenced.

The present invention utilizes large domestic animal galactophore biological reactor production butyrylcholine esterase to lay the first stone by being established as of this mouse model from now on, also will greatly promote the research of relative disease and function simultaneously.

Summary of the invention

In order to solve problems of the prior art, the object of this invention is to provide one and being easy to vitro recombination operation, being convenient to the structure of carrier, and the expression method of the butyrylcholine esterase gene be not easily silenced.

In order to realize the object of the invention, the invention provides a kind of method utilizing hBCHE Mini-gene to express recombinant human BuCh lipase in mammary gland, it adopts recombinant technology by the target gene on the artificial chromosome of mammiferous for complete for hBCHE gene replacement mammary gland specific expression protein, makes hBCHE gene obtain the regulating and controlling sequence of complete mammary gland high expression target gene; Under the prerequisite of transcribing and translating not affecting butyrylcholine esterase gene, by the modification to artificial chromosome, reduce the size of hBCHE gene, obtain hBCHE Mini-gene; The Recombinant Artificial karyomit(e) of acquisition is proceeded in Mammals, makes hBCHE Mini-gene in animal's mammary gland, express recombinant human BuCh lipase.

Aforesaid method, described artificial chromosome is yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) or P1 karyomit(e) (PAC) etc., preferred BAC.

Aforesaid method, described being modified to the method for the neo resistant gene of 1.9kb by homologous recombination artificial chromosome, replaces the 39.5kb fragment in the intron 2 of hBCHE genomic dna, obtains hBCHE Mini-gene.Although modify genomic gene, but still remain part of intron, make gene structure relatively complete, do not affect transcribing and translating of butyrylcholine esterase, and the recombinant protein of expressing has biologic activity.

As preferably, described Mammals is ox, sheep, rabbit and pig.

As preferably, described Mammals is ox.

Object of the present invention can also be further achieved by the following technical measures.

According to a preferred embodiment of the present invention, the present invention replaces hBCHE genomic dna intron 2 39.3kb fragment by neo resistance screening gene, obtain butyrylcholine esterase Mini-gene, build mammary gland-specific expression vector, prepare transgene mouse model, in mammary gland of mouse, express butyrylcholine esterase.

Beneficial effect of the present invention is:

The present invention utilizes first and modifies Post genome hBCHE genetic expression recombinant human butyrylcholine esterase, and the expression for macrostructure gene protein provides new strategy.

Accompanying drawing explanation

Fig. 1 is the structure schema of hBCHE mammary gland-specific expression vector pBAC-hLF-hBCHE-neo of the present invention.

Fig. 2 arrests carrier enzyme to cut qualification result in the embodiment of the present invention 1.

Fig. 3 is that in the embodiment of the present invention 1, hBCHE BAC carrier modified PCR detects.

Fig. 4 is that in the embodiment of the present invention 1, No. 10 bacterium recombinant plasmid Asc1 enzymes cut qualification result;

Wherein, M:1kb Marker; 8,9: negative control; The object band that 10:10 bacterium recombinant plasmid Asc1 enzyme is cut.

Fig. 5 is the result that in the embodiment of the present invention 1, PCR identifies LF-BCHE-neo-BAC.

Fig. 6 is transgenic mice preparation flow figure in the embodiment of the present invention 2.

Fig. 7 be in the embodiment of the present invention 2 F0 for mouse PCR qualification result;

Wherein, M:100bp Marker; 1-12:F0 is for mouse; P: plasmid; B: water.

Fig. 8 is that in the embodiment of the present invention 2, southern blot identifies positive transgenic mouse results;

Wherein, 1,5,10:1,5,10 copies; NC: negative transgenic mice.

Fig. 9 is that in the embodiment of the present invention 2, RT-PCR detects the expression of results of rhBCHE in transgenic mice is respectively organized;

Wherein, M:100bp Marker; H: the heart; Li: liver; Sp: spleen; Lu: lung; K: kidney; St: stomach; I: intestines; Mu: muscle; Ma: mammary gland; WT-Ma: wild-type mice mammary tissue.

Figure 10 is the detected result that in the embodiment of the present invention 3, in Western hybridization check transgenic mouse milk, rhBCHE expresses;

Wherein, PC1:1 μ g hBCHE sterling; PC1.5:1.5 μ g hBCHE sterling; NC: wild-type mice milk sample; Swimming lane 1-4 is respectively: No. 4 milk sample 1 μ L, No. 5 milk sample 1 μ L, No. 4 milk sample 2 μ L, No. 5 milk sample 2 μ L.

Figure 11 is the non-reduced electrophoresis detection result of non denatured in the embodiment of the present invention 3;

Wherein, PC: hBCHE sterling; NC: wild-type mice milk sample.

Embodiment

Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.

In following embodiment, method therefor is ordinary method if no special instructions, and agents useful for same all can obtain from commercial channels.

The bacterial strain used in following examples, carrier, reagent and source thereof:

DH5 α is preserved by this laboratory; Recombinant bacterial strain SW102 is so kind as to give by Biological resources branch of NIH; HBCHE BAC(RP11-491K7) purchased from ATCC; Human milk iron BAC is preserved by this laboratory; Plasmid pRcCMV-BCHE is presented by Nebraska,USA university Oksana professor Lockridge; Prokaryotic expression carrier pBR322, carrier pMD19--T are all purchased from Takara company (article No. be respectively 3050 and D104A); Primer synthesis and sequencing by Beijing Liuhe Huada Genomics Technology Co., Ltd because completing; Taq enzyme, T4DNA ligase enzyme, restriction enzyme are all purchased from Biolabs company; Laboratory animal is Kun ming white mouse, purchased from Beijing Experimental Animal Center; Plasmid purification and recovery test kit are Omega Products.

The conventional molecular biological laboratory operating procedures such as enzyme is cut, connect, reclaim, transform, pcr amplification refer to " molecular cloning (third edition) ".

The structure of embodiment 1 mammary gland specifically expressing hBCHE carrier pBAC-hLF-hBCHE-neo

1. the construction strategy of hBCHE mammary gland-specific expression vector pBAC-hLF-hBCHE-neo

1.1 structures of arresting carrier pBR322-hLF-hBCHE

Respectively with hLF BAC and hBCHE BAC for template, amplification homologous recombination operates homology arm used, respectively 4 sections of homology arm PCR primer is connected into pMD19-T carrier and sequence verification is correct.By fusion DNA vaccine method, four sections of homology arms are linked in sequence into a fragment by HA-hLF-F, HA-hBCHE-F, HA-hBCHE-R and HA-hLF-R, and link in pBR322 skeleton carrier by NdeI and HindIII double digestion, obtain and arrest carrier pBR322-hLF-hBCHE.

1.2. the modification of hBCHE BAC carrier

HBCHE genomic dna is about 80kb, carries out homologous recombination behaviour to the DNA fragmentation of 80kb size, and the efficiency of arresting operation especially can be lower, and technical difficulty is larger.In order to better complete the structure of hBCHE expression vector, first to modify hBCHEBAC.Neo gene is replaced the intron 2 fragment of 39.3kb by the method for homologous recombination, obtain pBAC-hBCHE-neo, add antibiotic-screening mark on the one hand, decrease the size of whole goal gene on the other hand, facilitate subsequent operations.With plasmid pL452 for template, amplify the 1.9kb neo gene with homology arm.

Primer is: ld-bche-neo-F(5 ' -CAAGATATGTGGGTTATTATATTACCCGTAGCTGTAAAATATTTTATTCCTTCTCA ACATCAGCATAAATTTCTGCTCAAGGaGCCCAATTCCGATCATA-3 ') and ld-bche-neo-R(5 '- gTAGAAACTAACAAGTACAGCTGCTGGAGGCTGGATATTAAACCAGGAGAACCGAT GGTCTGATTCAGTACAGCAAtCCGCTCTAGAACTAGTGGATGTAAGCCAGTTATCTCACTAA-3 '), underscore is labeled as homology arm.PCR primer electric shock after cutting glue and reclaiming proceeds in the SW102 bacterial strain containing hBCHE BAC carrier, after there is homologous recombination, obtain pBAC-hBCHE-neo carrier, the insertion point of Neo on hBCHE BAC is that intron 25 ' holds 1.62kb place, and replace the DNA fragmentation of 39.3kb, i.e. hBCHE Mini-gene.

1.3.pBR322-hBCHE-neo the structure of carrier

Arrest carrier with NotI enzyme linearizing PBR322, after cutting glue recovery, electric shock proceeds in the SW102 bacterial strain containing hBCHE-neo BAC carrier, after there is homologous recombination, obtains pBR322-hBCHE-neo carrier.

1.4.pBAC-hLF-hBCHE-neo the structure of carrier

Cut the hBCHE-neo fragment obtained with newborn iron homology arm by AscI enzyme, after cutting glue recovery, electric shock proceeds in the SW102 bacterial strain containing hLF BAC carrier, after there is homologous recombination, obtains pBAC-hLF-hBCHE-neo carrier.

The building process of above hBCHE mammary gland-specific expression vector pBAC-hLF-hBCHE-neo as shown in Figure 1.

2. recombinant technology experimental procedure

2.1.BAC extraction

BAC extraction step adopts the method that test kit (NucleoBond BAC100Kit) provides.Slightly put forward the step of BAC according to test kit, add P1, P2 and P3, then use the isopropanol precipitating of 0.7 times of volume, the BAC slightly carried can be used for the electroporated of bacterium.

2.2.SW102 the electric transformed competence colibacillus preparation of bacterial strain

Concrete steps are: a. initial incubation, picking mono-clonal, add in the sterile tube containing 5ml LB substratum, 32 DEG C, 220rpm, incubated overnight; B. enlarged culturing, transfers in the sterilizing triangular flask containing 50ml LB substratum by incubated overnight liquid in the ratio of 1:70,32 DEG C, 220rpm, when OD600 reaches 0.4, stops cultivating; C. bacterium liquid is divided into 2 parts, first part in 42 DEG C of (strictly) water-baths, 220rpm, oscillation incubation 15min; Second part is contrast, 32 DEG C of water-baths, 220rpm, oscillation incubation 15min; D. 2 parts of bacterium liquid are cooled more than 10min fast in ice-water bath, afterwards in 4 DEG C, the centrifugal 10min of 5000rpm; E. abandon supernatant, again pipe is placed in ice-water bath, add the ddH2O of 1ml precooling on ice, rotate resuspended gently, then add the ddH2O of 10ml precooling, put upside down mixing fast, 4 DEG C, the centrifugal 5min of 5000rpm; F. abandon supernatant, again pipe is placed in ice-water bath, add 10% glycerine of 1ml precooling on ice, rotate resuspended gently, then add 10% glycerine of 10ml precooling, put upside down mixing fast, 4 DEG C, the centrifugal 5min of 5000rpm; G. abandon supernatant, add 10% glycerine of 100 ~ 200 μ L precoolings, resuspended precipitation; H. packing, adds 40 μ L in the tubule of every 0.5ml, after liquid nitrogen flash freezer ,-80 DEG C of preservations, for subsequent use.

2.3.BAC or DNA fragmentation electricity transform

Specific procedure is: a. gets 40 μ L competent cells and mixes with 5 μ L BAC solution or PCR primer, is transferred to the sufficient 0.2cm of ice bath and shocks by electricity in cup, can not form bubble; B. the water around electric shock cup is dried, be placed in electric shock tank, start the electric shock program of bacterium; C. electroporated end, adds 0.8ml SOC substratum, uses rifle sucking-off, be placed in 1.5ml centrifuge tube in electric shock cup, 32 DEG C of water-baths vibration renewal cultivation 2 hours; D. coat containing on corresponding antibiotic LB plate, overnight incubation in 32 DEG C of incubators; E.PCR and Cracking method qualification positive colony.

2.4. with the design of the PCR long segment primer of homology arm

General structure with the long segment primer of homology arm is: hold at 5 ' of common PCR primers and respectively to bring ~ the homologous sequence of 50bp, and can introduce the sequences such as restriction enzyme site between homology arm and general primer.The design of modifying BAC homology arm is as follows: the 5 ' end choosing target sequence is close to about 50bp sequence as 5 ' homology arm, is added to 5 ' end of a general primer; 3 ' the end choosing target sequence is close to about 50bp sequence, gets the 5 ' end that its reverse complementary sequence is added to another general primer, as 3 ' homology arm.

3. experimental result and analysis

3.1. the structure of carrier is arrested

Respectively with hLF BAC and hBCHE BAC for template, amplification homologous recombination operate homology arm used, amplimer is as shown in table 1.Respectively 4 sections of homology arm PCR primer are connected into pMD19-T carrier and sequence verification is correct.

The primer of correlation detection in table 1 experiment

By fusion DNA vaccine method, four sections of homology arms are linked in sequence into a fragment by HA-hLF-F, HA-hBCHE-F, HA-hBCHE-R and HA-hLF-R, primer is hLF-5-F/BCHE-3-R, adopt NEB high-fidelity enzyme Fusion to increase, obtain the object fragment of 1.2kb.Glue recovery is connected into pMD19-T carrier and sequence verification is correct.Linked in pBR322 skeleton carrier by NdeI and HindIII double digestion, and adopt NdeI/HindIII double digestion to identify (as shown in Figure 2).

3.2.neo the acquisition of element

Neo gene has neomycin resistance and Ka Na resistance in prokaryotic cell prokaryocyte, has G418 resistance in eukaryotic cell, can be used as the selective mechanisms gene of final carrier.Because PL452 plasmid there being the neo fragment of 1.9kb, therefore adopting PL452 plasmid as template, carrying out pcr amplification with ld-bhce-neo-F/ld-bhce-neo-R primer (see table 1), PCR reaction conditions is: 94 DEG C of 5min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 2min, 72 DEG C of 7min, 35Cycels.PCR result obtains the band that is slightly smaller than 2kb, can judge that it is neo fragment.Adopt PCR primer to reclaim test kit and reclaim neo fragment, with Dpn1 digestions PL452 plasmid backbone, repeat afterwards to reclaim, surveying its DNA concentration is 158ng/ μ L again.

3.3. the modification of hBCHE BAC carrier

The object of this step neo fragment is recombinated to replace the intron 2 fragment of 39.3kb in BChE gene, obtains BCHE-neo BAC.Adopt electricity to turn competence making method, the BCHE-BAC slightly carried is transferred in sw-102 recombinant bacterium.Make the competence of BCHE-sw-102, the neo fragment PCR of 7 μ l is reclaimed product electricity and go in the BCHE-sw-102 competence of 60 μ l.Draw appropriate conversion after product coated plate (paraxin and kantlex).24h is cultivated in 32 DEG C of baking ovens.Heavily cultivate with the line of toothpick picking list bacterium colony, in 32 DEG C of baking ovens, cultivate 24h.

Positive colony is detected by three butt junction primers.This step is divided into three parts, to increase total length (3.165kb) with d-bh-tidujietou-5-f/ld-bh-tidujietou-3-r; With ld-bh-tidujietou-5-f/ld-bh-tidujietou-5-r increase 5 ＇ hold object band (975bp); Primer ld-bh-tidujietou-3-f/ld-bh-tidujietou-3-r increase 3 ＇ hold object band (996bp).Carry out gel electrophoresis, detected result respectively as shown in Figure 3.

Comprehensive three pairs of primer amplification results above, by 1,2,3,4,5,6,11,12,14, No. 16, clone delivers to the order-checking of Hua Da genome company, and correctly, sequencing result is shown in annex for No. 2, sequencing result and No. 16.Adopt No. 16 as the bacterial classification of next step operation.

3.4.PBR322-BCHE-neo vector construction

Arresting vector linearization fragment for obtaining PBR322, cutting PBR322 and arresting carrier, digested overnight 24h with Not1 enzyme, glue reclaims linearized fragment, and reclaiming fragment concentrations is 114.7ng/ μ l.

Make sw-102-BCHE-neo(16 bacterium) competence, be spread evenly across resistant panel (ammonia benzyl and kantlex), in 32 DEG C of baking ovens, cultivate 24h.Heavily cultivate with the line of toothpick picking list bacterium colony, in 32 DEG C of baking ovens, cultivate 24h.

Picking No. 10 bacterium colonies, put into LB liquid nutrient medium, and 32 DEG C of incubator overnight are cultivated, and when its OD600 is about 0.5, extract plasmid, electrophoresis detection, the about 23kb of object band, therefore detected result are correct.

Also need that Asc1 enzyme is carried out to No. 10 bacterium recombinant plasmids cut detection for verifying that whether homologous recombination is successfully built into pBR322-BCHE-neo carrier, due to enzyme cut after fragment length be 19.7kb, therefore qualification result is correct, as shown in Figure 4.

3.5. LF-BCHE-neo-BAC is obtained

Cut glue and reclaim BCHE-neo fragment, surveying its concentration is 88.7ng/ μ l, is connected to pMD-19T carrier, and deliver to the order-checking of Hua Da genome company, sequencing result comparison is correct.

The competence of preparation LF-sw102, by method before by BCHE-neo homologous recombination in the competence BAC of LF-sw102, to be spread evenly across on resistance LB solid medium (kantlex and paraxin Double) 32 DEG C to cultivate 24 hours, to choose single bacterium colony and rule 32 DEG C and heavily cultivate 24 hours.

Design detects primer, and a little 1-10 bacterium of picking carries out bacterium colony PCR, then carries out detected through gel electrophoresis.In order to obtain more believable detected result, therefore devise corresponding primer for its first exon, second exon and the 3rd exon and detect.Detected result as shown in Figure 5.

Therefore select 5-10 clone deliver to Hua Da genome company order-checking, all correct through sequence alignment.

So far, successfully pBAC-hLF-hBChE-neo carrier is obtained.

The foundation of embodiment 2 hBCHE transgene mouse model and detection

1. transgenic mice is produced in microinjection

Transgenic mice preparation process is see " Mouse Embryo experiment guide " (work such as A. Na Ji, 2004, Science Press), and innovation of the present invention is to inject mouse with annular BAC, and has high transgene efficiency the same as linear BAC.Transgenic mice preparation flow as shown in Figure 6.

Produce transgenic mice with microinjection, for common small segment carrier, linear ratio annular integration efficiency is high, therefore the expression vector enzyme built will be cut into and linearly just can carry out microinjection.And the BAC carrier of large fragment, because its structure is large, after linearizing in removal process, is easy to rupture, if do not reclaimed, transgene efficiency high equally can be obtained, greatly will improve success ratio and save the working hour.In our experiment, be born 12 mouse altogether, and have 2 positives, transgene efficiency is 16.67%.Between 5 ~ 20% of common transgene efficiency.Result shows, annular BAC has high transgene efficiency the same as linear BAC.

2. the PCR of transgenic mice detects

Get the tail tissue sample of transgenic mice in 2 ~ 3 week age, extract genome (for conventional DNA recovery method).With the genome extracted for template, with F1/R1 primer (see table 2) at positive mice, react for negative control with the PCR that common mouse (nontransgenic mice) genome is template, the reaction being template with carrier pBAC-hLF-hBCHE-neo is positive control.Amplification condition is 94 DEG C, 30sec; 60 DEG C, 30sec; 72 DEG C, 60sec; 35 circulations, 1.0% agarose electrophoresis observations, result as shown in Figure 7.Fig. 7 shows, and PCR detects 2 positive mice in 12 mouse in F0 generation, is No. 4 and No. 5.

The PCR primer of table 2 transgenic mice qualification

3. the Southern blotting of transgenic mice detects

By the F0 of PCR test positive generation 2 transgenic mices, strand tail tissue also extracts genome, get about 10 μ g EcoRI endonuclease digestion, the wild-type mice genome cut with EcoRI enzyme is negative control, it is positive control that the pBAC-hLF-hBCHE-Neo that EcoRI enzyme is cut injects carrier segments, hybridization probe is the PCR primer (see table 2) of primers F 1/R1, and length is 758bp, is marked by digoxin (DIG).By various sample low pressure electrophoresis at a slow speed, adopt alkali transfer method that DNA is transferred to nylon membrane from agarose, one side nylon membrane being had DNA inwardly, is rolled into tubular and puts into hybrid pipe, add prehybridization solution, be not shorter than 1 hour in 65 DEG C of prehybridizations, add the probe marked through the DIG of heat denatured, hybridize 12 ~ 16 hours for 65 DEG C, wrap with preservative film after washing film, put in magazine, in darkroom, press X-ray, observations.Southern blotting result is as Fig. 7, and result shows positive mice Southern blotting detected result (see figure 8) consistent with PCR detected result.

4. the RT-PCR of transgenic mice detects

The mammary gland in lactation period and the total serum IgE of each tissue (heart, liver, spleen, lung, kidney, stomach, intestines) is extracted with Trizol reagent, get 1 μ g total serum IgE and carry out reverse transcription, cDNA reverse transcription obtained is as template, increase to merge primer for BCHE-774-F and BCHE-774-R (see table 2), amplified production is the DNA fragmentation of 774bp.With the housekeeping gene GAPDH of mouse for contrast (530bp).Result shows, people's BuCh lipase high expression in mammary gland, in the tissues such as the heart, liver, spleen, lung, kidney, stomach, intestines, muscle and wild-type mice mammary gland, do not express (see figure 9).

The mensuration of recombinant human butyrylcholine esterase in embodiment 3 transgenic mice milk sample

1. the Western blotting of transgenic mice milk sample detects

Gather F0 generation 4,5 and F1 generation 7,9, No. 11 mouse often newborn, negative mice milk is as negative control.Milk gathers for one week after mouse birth, before collection, female mouse is separated more than 3 hours with newborn mouse, and to the pitocin of abdominal injection doses.Full milk and the milk sample through the process of degreasing demargarinate albumen, carry out electrophoresis with the SDS-PAGE gel of 10%.Bio-Rad wet walk around film instrument 350mA, transferring film 80min is utilized after electrophoresis.After transferring film completes, close with 5% skim-milk and spend the night, then the anti-human primary antibodie of rabbit (1:500 dilution) carries out hatching 1h, TBST washes film 3 × 10min, then the goat-anti rabbit two anti-(1:20000 dilution) of HRP mark hatches 1h, and TBST washes film 3 × 10min, finally carries out BCL colour developing.As shown in Figure 10, No. 4 female mouse have expressed recombinant human butyrylcholine esterase to result.Recombinant human BuCh lipase size is about 85kDa.

2. the non-reduced electrophoresis of non denatured

Copper ferrocyanide method is a kind of method checking butyrylcholine esterase enzymic activity in vitro.The hydrolysis of butyryl sulphur choline salt can be produced sulphur choline by fourth Pseudocholinesterase, and sulphur choline makes the hexacyanoferrate be reduced to yellow prussiate, and the latter and cupric ion are combined into copper ferrocyanide and in brown precipitate, prove the existence of enzymic activity with this.Therefore by after the non-reduced glue protein electrophoresis of non denatured, add color reaction Incubating Solution reaction 2-6h, observe the brown band that gel is formed and can judge butyrylcholine esterase multimeric forms and whether there is reactive behavior.As shown in figure 11, we find the activity that recombinant human butyrylcholine esterase contained in F0 generation and F1 generation mouse milk sample all can react for BuCh iodide with S, and demonstrate the tetramer identical with sterling size and dimer band, illustrate what recombinant human butyrylcholine esterase in mouse milk mainly existed with the tetramer and dimeric forms, and in vitro there is enzymic activity.

3. recombinant human butyrylcholine esterase content analysis in milk

In transgenic mouse milk, the content of recombinant human butyrylcholine esterase adopts Ellman method to measure.Adopt the sterling preparation standard curve of the hBCHE bought.40 μ L milk samples after degreasing dilution or sterling with contain 1mM sulfur iodide and react for the 0.1M phosphoric acid buffer of BuCh and 0.5mM5,5'-dithio two (2-nitrobenzoic acid), at pH7.0, at 25 DEG C, assaying reaction system is in the absorption value of 412nm.After measured, primary No. 4 mouse expression amounts are 159.07 ± 27.79mg/L, and its offspring No. 7 and No. 9 expression amounts are respectively 76.32 ± 11.78mg/L and 124.17 ± 38.02mg/L.The content of butyrylcholine esterase of recombinating in transgenic mouse milk be the 38-80 of content (2mg/L) in human blood doubly (see table 3).

Table 3 is recombinated the expression of butyrylcholine esterase in transgenic mouse milk

Embodiment 4 utilizes breeding transgenic livestock to express recombinant human butyrylcholine esterase

Breeding transgenic livestock preparation method can adopt the methods such as microinjection, somatic cell clone method, sperm-mediated gene transfer, and breeding transgenic livestock comprises transgenic cattle, transgenic sheep, transgene rabbit and transgenic pig etc.The preferred somatic cell clone legal system of the present invention for transgenic dairy, but is not limited to somatic cell clone method, is also not limited to the preparation of transgenic dairy.The pBAC-hLF-hBChE-neo carrier that embodiment builds is proceeded to milk cow fetal cell, clone embryos is prepared by nuclear transfer technology, transgenic cloned embryos is moved into gestation in cow uteri of becoming pregnant, after full-term, Molecular Detection is carried out to the clened cows of birth, obtain the transgenic dairy (concrete steps are with reference to Chinese patent ZL03160031.X) integrating pBAC-hLF-hBChE-neo.After transgenic dairy sexual maturity, it is bred, collect milk sample after calving and carry out the detection of recombinant human butyrylcholine esterase expression level, result shows, recombinant human butyrylcholine esterase expression amount can reach 0.1-0.5mg/ml, shows that the pBAC-hLF-hBChE-neo carrier constructed by embodiment 1 is adapted at expressing recombinant human butyrylcholine esterase in breeding transgenic livestock.

Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.

Claims (6)

1. utilize hBCHE Mini-gene in mammary gland, express a method for recombinant human BuCh lipase, it is characterized in that:

It adopts recombinant technology by the target gene on the artificial chromosome of mammiferous for complete for hBCHE gene replacement mammary gland specific expression protein, makes hBCHE gene obtain the regulating and controlling sequence of complete mammary gland high expression target gene;

Under the prerequisite of transcribing and translating not affecting butyrylcholine esterase gene, by the modification to artificial chromosome, reduce the size of hBCHE gene, obtain hBCHE Mini-gene;

The Recombinant Artificial karyomit(e) of acquisition is proceeded in Mammals, makes hBCHE Mini-gene in animal's mammary gland, express recombinant human BuCh lipase.

2. the method for claim 1, is characterized in that, described artificial chromosome is yeast artificial chromosome, bacterial artificial chromosome or P1 karyomit(e).

3. method as claimed in claim 2, it is characterized in that, described artificial chromosome is bacterial artificial chromosome.

4. the method as described in any one of claim 1-3, it is characterized in that, being modified to the method for neo gene by homologous recombination artificial chromosome, replaces the intron 2 fragment of hBCHE genomic dna, obtains hBCHE Mini-gene.

5. method as claimed in claim 4, it is characterized in that, described Mammals is ox, sheep, rabbit and pig.

6. method as claimed in claim 5, it is characterized in that, described Mammals is ox.