CN104531699B - A kind of UCOE controlling element fragments of the pig for strengthening exogenous gene expression - Google Patents

Abstract

The invention belongs to gene engineering technology field, and in particular to a kind of UCOE controlling element fragments of the pig of enhancing exogenous gene expression.The base sequence of the UCOE controlling elements fragment is as shown in sequence table.Aspect of the controlling element fragment in exogenous protein expression, by construction recombination plasmid expression vector pCpG Mini GFP UCOE, is transfected HEK293T cells, can be expressed with enhanced GFP.The present invention is using the 1.5kbUCOE fragments of people as control; the fragment that pig UCOE fragments are divided into different length using enzymatic cleavage methods and RT PCR methods; build different expression vectors; transfection HEK293T cells; the optimal UCOE fragment sequences that can strengthen exogenous gene expression, i.e., claimed gene order of the invention are filtered out by the relative expression quantity of real-time fluorescence quantitative PCR and Western blot technology for detection reporter gene GFP.

Description

A kind of UCOE controlling element fragments of the pig for strengthening exogenous gene expression

Technical field

The invention belongs to gene engineering technology field, and in particular to a kind of UCOE regulation and control of pig of enhancing exogenous gene expression Element fragment.

Background technology

Chromosome opens element（Ubiquitous chromatin opening element, UCOE）Chromosome can be changed Structure makes which keep transcriptional activity, this element mainly to include locuscontrol region（Locus control regions, LCR）With UCOE two types.LCR can only participate in the expression for adjusting transgenosis in several specific tissues.And UCOE is widely being organized The interior expression that can adjust transgenosis.In structure composition, those comprising house-keeping gene bidirectional transcription promoters and enriched The genome area surrounded without methylated CpG island because can give transgenosis stablizes high-caliber expression, be defined as UCOE.When controlling gene is expressed, UCOE is unrelated with tissue specificity and integration site, and it can change heterochromatin structure makes Which activates and is in open state, and then makes gene remain transcription and not silence.The application of controlling element UCOE there is a possibility that A series of transgene expression of carriers is improved.

Existing research it is generally acknowledged that one of principal element for causing transgene expression efficiency low is Transcriptional Silencing, this generally with Integration site peripheral chromatin is concentrated, the DNA sequence dna on CpG islands methylates and these three factors of DNA methylase inhibitor are relevant. If it is desired that foreign gene high efficient expression in host living beings cell must assure that the expression vector being incorporated in animal chromosome The chromatin environment of surrounding is not modified by epigenetics and other biological is imitated in an opening and the state of active transcription The impact that answers.Next to that from regulation and control composition such as paralinin/nuclear skeleton attachment region（S/MARs）, Chromatin Opening Elements, startup Son, enhancer etc. can realize that genes of interest efficiently, is specifically expressed in the tissue.

There are two very important applications in transgenic technology at present.One is quickly to produce recombinant protein, for molecule Study before biochemical foundation research, drug development and clinical practice.Can be with by using UCOE for example in terms of acology The common cytokine receptor γ chain genes of control（IL2RG）Expression, and confirm chain to the mouse X- SCID of this regulation and control Phenotype disease has therapeutic effect.Another kind be can faster, more easy to identify those can mass produce and stablize high-caliber treatment Learn the cloned cell line of protein.For example a large amount of hematopoietin can be produced using the CpG islands screening of controlling element UCOE CHO cloned cell lines（Hematopoietin belongs to pharmaceutical grade protein, is widely used in treating renal failure, Yi Jihua Anaemia that treatment causes etc.）.

Content of the invention

It is an object of the invention to provide the UCOE controlling element fragments of a boar, can promote or strengthen foreign gene and exist Host cell stability and high efficiency is expressed, and is to solve the problems, such as that occurring gene silencing in transgenosis proposes new method and solve way Footpath.

The technical solution used in the present invention is as follows.

A kind of UCOE controlling element fragments of the pig for strengthening exogenous gene expression, length is 957bp, the controlling element fragment Base sequence as shown in sequence table.

Application of the UCOE controlling elements fragment in terms of exogenous protein expression, can strengthen the expression of foreign protein.

The enhancing exogenous protein expression, is by construction recombination plasmid expression vector pCpG-Mini-GFP-UCOE, turns Dye HEK293T cells, enhanced GFP are expressed.

The present invention using the 1.5kbUCOE fragments of people as control, using enzymatic cleavage methods and RT-PCR method by pig UCOE pieces Section is divided into the fragment of different length, builds different expression vectors, transfects HEK293T cells, by real-time fluorescence quantitative PCR and The relative expression quantity of Western blot technology for detection reporter gene GFP is filtered out and optimal can strengthen exogenous gene expression UCOE fragment sequences, i.e., claimed gene order of the invention.

The present invention by screening after pig 957bp UCOE fragments insertion pCpG-Mini-GFP recombinant plasmids further verify UCOE fragment functions.And carry out UCOE functional verifications from the recombinant plasmid and be because that it has following some advantages, first should The eucaryon part of plasmid is obtained by NheI and NcoI double digestion pCpGfree-mcs, and reporter gene GFP passes through NheI This eucaryon part is inserted with NcoI, this part also includes a MAR sequence containing beta-globin, and it enables to foreign gene shape Into an independent chromatin ring, from the impact of heterochromatin around and position effect, strengthen the expression of foreign gene.Its Secondary, the protokaryon part of the plasmid is in the attB sites of parental plasmid minicircle and attP sites design primer amplification Obtain.From minicircle plasmids protokaryon part as transformation plasmid a part the reason for be due to parental plasmid Minicircle passes through Phi C 31 integrase and I-SceI restriction enzyme collective effects, in attB sites and attP sites Recombinate, minicircle micro-loop plasmids can be obtained.Compared with conventional plasmid, the micro-loop plasmid is little and matter without bacterium Grain skeleton, can reduce immune response risk and can eliminate heterochromatin making foreign gene in body when being conducted in host cell Interior long-term and high efficient expression.Eucaryon part obtained above and protokaryon part carry out restructuring and obtain new recombinant plasmid pCpG-Mini- GFP, it have this two-part all advantage.After 957bp UCOE fragments insert this recombinant plasmid, induced by arabinose Micro-loop plasmid pCpG-Mini-GFP-UCOE is obtained, HEK293T cells is transfected, by real-time fluorescence quantitative PCR and Western Blot technical Analysis find that the expression of the GFP of micro-loop plasmid pCpG-Mini-GFP-UCOE is higher than control group pCpG- really Mini-GFP micro-loop plasmids.This just further demonstrates the expression that the UCOE fragments after screening can strengthen foreign gene.

To sum up, the UCOE fragments of pig provided by the present invention there is material to be easy to get, the advantage of wide material sources, strengthen external source In terms of gene expression effect, effect substantially, provides preferable Research foundation for engineered popularization and application, research and development.

Description of the drawings

Fig. 1 is pig UCOE controlling element schematic diagrames, and wherein 1 is the fragment 1 positioned at 2 NsiI restriction enzyme sites, and length is 4125bp；2 is that length is 1591bp positioned at the fragment 2 of 2 NotI restriction enzyme sites；3 is positioned at NsiI and NotI restriction enzyme sites Fragment 3, length are 1317bp；8 is that length is 1217bp positioned at the fragment 8 of NsiI and NotI restriction enzyme sites；4 is positioned at 2 The fragment 4 in XbaI enzyme cutting site, length is 1897bp；9 is the fragment 9 positioned at NsiI and XbaI enzyme cutting site, and length is 377bp；10 is that length is 1851bp positioned at the fragment 10 in NsiI and XbaI enzyme cutting site；5 is positioned at NsiI and EcoRI digestions The fragment 5 in site, length is 2773bp；13 is that length is 1352bp positioned at the fragment 13 of NsiI and EcoRI restriction enzyme sites；6 are The fragment 6 in NotI and XbaI enzyme cutting site is located at, length is 957bp；14 is the fragment 14 positioned at NotI and XbaI enzyme cutting site, Length is 634bp；11 is that length is 499bp positioned at the fragment 11 of XbaI and EcoRI restriction enzyme sites；7 be positioned at NotI and The fragment 7 of EcoRI restriction enzyme sites, length is 1456bp；12 is the fragment 12 positioned at NotI and EcoRI restriction enzyme sites, and length is 135bp；

Electrophoretograms of the Fig. 2 for pig liver tissue genomic DNA；

Structures of the Fig. 3 for pGEM-T-sUCOE plasmids, wherein A is the PCR amplification figures of sUCOE, and B is pGEM-T-sUCOE matter Qualification figure of the grain through MluI digestions, M is MarkerIV；

Structures of the Fig. 4 for p1 plasmids, wherein A is electrophoretogram of the pGEM-T-sUCOE plasmids through NsiI digestions, and B is Electrophoretogram of the pDrive5-GFP-2 plasmids through NsiI digestions, C are qualification figure of the p1 plasmids through EcoRI digestions；Wherein M1 is MarkerIV, M2 are MarkerV；

Structures of the Fig. 5 for p2 plasmids, wherein A is electrophoretograms of the sUCOE through NotI digestions, and B is pDrive5-GFP-2 matter Electrophoretogram of the grain through NotI digestions, C is qualification figure of the p2 plasmids through PvuII digestions, and wherein M1 is DL5000, and M2 is MarkerIV；

Structures of the Fig. 6 for p3 plasmids, wherein A are the PCR amplification figures of sUCOE3, and B is that sUCOE3 is double through NsiI and NotI The electrophoretogram of digestion, in C, 1 is electrophoretogram of the pDrive5-GFP-2 plasmids through NsiI and NotI double digestions, and in D, 1 is p3 plasmids Qualification figure through XbaI enzyme cutting；M is DL5000；

Structures of the Fig. 7 for p4 plasmids, in wherein A, 1 is electrophoretogram of the pGEM-T-sUCOE plasmids through XbaI enzyme cutting, 2 in A It is electrophoretogram of the pDrive5-GFP-2 plasmids through XbaI enzyme cutting, B is identification of the p4 plasmids through NotI digestions, and M is DL5000；

Structures of the Fig. 8 for p5 plasmids, in wherein A, 1 is electrophoretograms of the sUCOE through NsiI and EcoRI double digestions, and in A, 2 are Electrophoretogram of the pDrive5-GFP-2 plasmids through NsiI and EcoRI double digestions, in B, 1 is identification of the p5 plasmids through XbaI enzyme cutting Figure；M is DL5000；

Structures of the Fig. 9 for p6 plasmids, in wherein A, 1 is electrophoretograms of the sUCOE through XbaI enzyme cutting, and in A, 2 is pDrive5- Electrophoretogram of the GFP-2 plasmids through NotI and XbaI double digestions, in B, 1 is qualification figure of the p6 plasmids through PvuII digestions；M is DL5000；

Structures of the Figure 10 for p7 plasmids, in wherein A, 1 is electrophoretograms of the sUCOE through EcoRI digestions, and in A, 2 are Electrophoretogram of the pDrive5-GFP-2 plasmids through NotI and EcoRI double digestions, in B, 1 is identification of the p7 plasmids through PvuII digestions Figure；M is DL5000；

Structures of the Figure 11 for p8 plasmids, wherein A is the PCR amplification figures of sUCOE8, in B 1 be sUCOE8 through NsiI and The electrophoretogram of NotI double digestions, in C, 1 is qualification figure of the p8 plasmids through SmaI digestions；M is DL5000；

Structures of the Figure 12 for p9 plasmids, wherein A are the PCR amplification figures of sUCOE9, and B is pDrive5-GFP-2 plasmids warp The electrophoretogram of EcoRI digestions, C are qualification figure of the p9 plasmids through HindIII digestions；M is DL5000；

Structures of the Figure 13 for p10 plasmids, wherein A is the PCR amplification figures of sUCOE10, and B is p10 plasmids through SmaI enzymes The identification that cuts；M is DL5000；

Structures of the Figure 14 for p11 plasmids, wherein A is the PCR amplification figures of sUCOE11, in B 1 be sUCOE11 through XbaI and The electrophoretogram of EcoRI double digestions, in B, 2 is electrophoretogram of the pDrive5-GFP-2 plasmids through XbaI and EcoRI double digestions, and C is p11 The qualification figure of number plasmid through XbaI and EcoRI double digestions；M is DL5000；

Structures of the Figure 15 for p12 plasmids, wherein A is the PCR amplification figures of sUCOE12, B be sUCOE12 through EcoRI and The electrophoretogram of NotI double digestions, C are electrophoretogram of the pDrive5-GFP-2 plasmids through EcoRI and NotI double digestions, and in D, 1 is p12 The qualification figure of number plasmid through EcoRI and NotI double digestions；M is DL5000；

Structures of the Figure 16 for p13 plasmids, wherein A is the PCR amplification figures of sUCOE13, and B is p13 plasmids through SmaI enzymes The identification that cuts；M is DL5000；

Structures of the Figure 17 for p14 plasmids, in wherein A, 1 is electrophoretograms of the sUCOE through NotI and XbaI double digestions, 2 in A It is electrophoretogram of the pDrive5-GFP-2 plasmids through NotI and XbaI double digestions, in B, 1 is mirror of the p14 plasmids through EcoRI digestions Fixed figure；M is DL5000；

Relative mRNA expression levels figures of the Figure 18 for GFP genes after 14 Transfected Recombinant Plasmid HEK293T cells of pig；

Figure 19 is Western blot result figures：The phase of GFP genes after 14 Transfected Recombinant Plasmid HEK293T cells of pig To protein expression；

Structures of the Figure 20 for pCpG-Mini-GFP-UCOE plasmids, wherein A is the PCR amplification figures of sUCOE6, and B is pCpG- Electrophoretogram of the Mini-GFP plasmids through SdaI digestions, C are qualification figure of the pCpG-Mini-GFP-UCOE plasmids through PstI digestions；M1 It is DL2000, M2 is MarkerV, and M3 is DL5000；

Digestion qualification figures of the Figure 21 for micro-loop plasmid pCpG-Mini-GFP and pCpG-Mini-GFP-UCOE, 1 in wherein A It is qualification figure of the pCpG-Mini-GFP micro-loops plasmid through BglII digestions, in A, 2 is pCpG-Mini-GFP parental plasmids through BglII The qualification figure of digestion, in B, 1 is qualification figure of the pCpG-Mini-GFP-UCOE micro-loops plasmid through BglII digestions, and in B, 2 is pCpG- Qualification figure of the Mini-GFP-UCOE parental plasmids through BglII digestions；M is MarkerV；

Figure 22 is GFP bases in micro-loop plasmid pCpG-Mini-GFP and pCpG-Mini-GFP-UCOE transfection HEK293T cells The relative mRNA expression levels figure of cause.

Specific embodiment

With reference to embodiment the present invention will be further explained explanation.

Before introducing specific embodiment, involved key instrument equipment in embodiment, experiment reagent etc. are described as follows, not It is related to content to be defined by conventional of this area instrument and equipment for using or buying, experiment reagent.

Sequence sample source：The UCOE sequential extraction procedures of pig are the liver organization of DLY ternary pigs from kind, obtain liver Be stored in after liquid nitrogen flash freezer after tissue -80 DEG C standby.

Bacterial strain and plasmid

PMD19-T carriers (article No. 6013) are purchased from Dalian treasured bioengineering Co., Ltd（Takara）；PGEM-T easy are carried Body（Article No. A1360）It is purchased from Promega companies；Thrans110 (the full formula gold in Beijing)；PDrive5-GFP-2 plasmids (Invivogen).

Key instrument equipment

Constant-temperature incubation device, Eppendorf, Germany；

Automatic high pressure autoclave, SANYO, Japan；

Thermograde PCR analyzer, Biometra, Germany；

JY600C electrophoresis apparatuses and JY-SCZ-2 electrophoresis tanks, Beijing Jun Yi east electrophoresis equipment Co., Ltd；

Labworks image acquisition and analysis software, UVP, Germany；

Micro ultraviolet specrophotometer, Thermo NANODROP 1000；

HH-S2 digital display electric-heated thermostatic water baths, Jin Yi；

LRH-150 B biochemical cultivation cases, Guangdong Medical Apparatus and Instruments Factory；

Shen energy lottery industry high precision numerical control shaking table, ChemStar experimental instruments and equipment limited；

Style clean bench on VD-850 type tables, Suzhou are purified；

5424 R of desk-type small centrifuge, Eppendorf, Germany；

Microscale sampler, Eppendorf, Germany；

Inverted biologic microscope, Feoca；

CO₂Incubator, SANYO, Japan；

Fluorescence inverted microscope, DB.

Main agents

DNase is purchased from Promega companies；

Proteinase K is purchased from Sigma companies；

Phenol chloroform isopropanol is purchased from Solarbio companies；

LA Taq（Article No. RR02AG）, DNA cut glue reclaim kit（Article No. SK8132）、Trizol（Article No. 9108Q）、 PrimeScript II 1st strand cDNA synthesis kit kits（Article No. 6210A）、EcoRI（Article No. 1040A）、NotI（Article No. 1166A）, PvuII (article No. 1243A), Hind III（Article No. 1060A）、PstI（Article No. 1073A）、 SmaI（Article No. 1085A）、NheI、NcoI、PacI、SacI、DL2000、 DL5000、DL15000 、MluI（Article No. 1071A）、、 SYRB Mix（Article No. RR420Q）、BglII（Article No. 1021A）It is purchased from Takara companies；

Restriction enzyme NsiI, SdaI, XbaI；T4 DNA ligases are NEB Products；

Small amount plasmid extraction kit is purchased from AXYGEN companies；

Non-enzymatic connection kit (ExnaseTM II, article No. C112-01), Vazyme companies；

Animal tissue's genome extracts kit（Article No. F0626）, MarkerV, MarkerIV biological purchased from Lay maple；

PBS solution, BCA determination of protein concentration kits (article No. BCA01), the purchase of 2 × SDS-PAGE electrophoresis sample-loading buffer From ancient cooking vessel state；

Protein standards Marker is purchased from Fermentas companies；

The two of the goat-anti rabbit of HRP marks are anti-purchased from Santa Cruz Bioisystech Co., Ltd；

GFP antibody is purchased from Abbkine；

ECL Plus luminescence reagents box is purchased from GE Healthcare companies；

Lipofectamine Tubofect is purchased from Thermo companies；

90% high glycoform DMEM culture mediums（Article No. 11995）, 10% hyclone（Article No. 10099-141）, trypsase It is purchased from GIBCO companies.

Embodiment 1

The UCOE controlling element fragments of the pig for strengthening exogenous gene expression provided by the present invention, its base sequence such as sequence Shown in list.Below its screening process is briefly discussed below.

Fig. 1 is the complete UCOE controlling element schematic diagrames of the pig of the present invention, and he is with the UCOE of people（hUCOE）Sequence is Basis comparison is obtained.The UCOE controlling element fragments of the claimed pig of the present invention are adjusted by the complete UCOE to pig Control element is obtained using the screening of different enzymes combinations, and concrete screening process is as follows.

（1）The clone of the UCOE fragments of pig and construction of recombinant plasmid

1. the extraction of pig genomic DNA

Pig liver tissue genomic DNA is extracted using animal tissue's genome extracts kit, solidifying by 0.8% agarose Gel electrophoresis detect the extraction quality of genomic DNA, and -20 °C save backup.The electrophoretogram of DNA is as shown in Figure 2.

2. design of primers and synthesis

Using Primer5.0 Software for Design purpose fragment primers, sUCOE is designed according to different enzymes combinations（Pig UCOE）Draw Thing sequence is as shown in the table, and primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

3. the structure of pGEM-T-sUCOE plasmids

With the pig genomic DNA as template of step 1. middle extraction, with the sUCOE-1F and sUCOE-1R of step 2. middle design For primer, sUCOE is expanded using LA Taq.

PCR amplification system is as follows：

sUCOE-1F（20 mol/L), 0.5 L；

sUCOE-1R（20 mol/L), 0.5 L；

LA Taq, 0.5 L；

2 × GCBuffer, 25 L；

DNTP Mixture, 8 L；

Step 1. middle genomicDNA, 100ng；

ddH₂O complements to 50 L.

Reaction condition：95 °C of denaturations 5min, 95 °C of denaturation 30s, 57 °C of annealing 30s, 72 °C of extension 4min30s, 35 Individual circulation, last 72 °C of extensions 10min.

Amplified production detected with 0.8% Ago-Gel, PCR amplifications such as Fig. 3（A）Shown.Glue reclaim is cut using DNA Kits are reclaimed.

The purpose fragment and carrier pGEM-T easy vector for cutting glue reclaim is attached, and linked system is as follows：

2 × Rapid ligation Buffer, 5 L；

T4 DNA ligase, 1 L；

PGEM-T easy vector, 1 L；

SUCOE, 3 L；

16 °C of connections are overnight.

Connection product is converted, picking white monoclonal bacterium colony extracts plasmid, using MluI restriction enzymes to restructuring Plasmid carries out single endonuclease digestion identification, digestion qualification result such as Fig. 3（B）Shown.To identify that correct plasmid is named as pGEM-T- sUCOE.

Digestion identification system is as follows：

MluI, 1 L；

10 × H Buffer, 2 L；

PGEM-T-sUCOE, 200ng；

ddH₂O complements to 20 L.

4. the recombinant plasmid comprising difference sUCOE fragments is built

The structure of p1 plasmids

Single endonuclease digestion, digestion are carried out to pGEM-T-sUCOE and pDrive5-GFP-2 respectively using NsiI restriction enzymes Product through 1.0% agarose gel electrophoresis（As a result see Fig. 4（A）, Fig. 4（B））, glue purification is cut, purpose fragment is reclaimed, then right PDrive5-GFP-2 dephosphorylations, the pGEM-T-sUCOE after recovery are connected structure p1 with dephosphorylized pDrive5-GFP-2 Number recombinant plasmid.Connection product is converted, EcoRI digestions are identified（As a result see Fig. 4（C））, identify that correct plasmid is named as p1 Number plasmid.

The structure of number plasmid

NotI restriction enzymes carry out single endonuclease digestion, digestion products to pGEM-T-sUCOE and pDrive5-GFP-2 respectively Through 1.0% agarose gel electrophoresis（Electrophoretogram result is shown in Fig. 5（A）, Fig. 5（B））, glue purification is cut, purpose fragment is reclaimed, then right PDrive5-GFP-2 dephosphorylations, the pGEM-T-sUCOE after recovery are connected structure p2 with dephosphorylized pDrive5-GFP-2 Number recombinant plasmid.Connection product is converted, PvuII digestions are identified（Digestion qualification result is shown in Fig. 5（C））, identify correct plasmid It is named as p2 plasmids.

The structure of number plasmid

Template is made with pGEM-T-sUCOE, the sUCOE-3F and sUCOE-3R of step 1. middle design are primer, using LA Taq expands sUCOE3 sequences.Amplified production is detected with 0.8% Ago-Gel（PCR amplifications rear electrophoresis result participates in Fig. 6（A））, Gel Extraction kit reclaims PCR primer.Recovery product is that sUCOE3 first carries out single endonuclease digestion with NsiI, then digestion products Using balance phenol（Phenol chloroform isoamyl alcohol（25:24:1））Extracting and purifying, reusing NotI after purification carries out single endonuclease digestion（Electrophoresis As a result see Fig. 6（B））.Double digestion is carried out to pDrive5-GFP-2 with NsiI and NotI（Electrophoresis result is shown in Fig. 6（C））.Will The respective double digestion products of sUCOE3 and pDrive5-GFP-2 purify recovery respectively, and connection builds p3 recombinant plasmids.XbaI reflects Determine recombinant plasmid（Qualification result is shown in Fig. 6（D））, identify that correct plasmid is named as p3 plasmids.

The structure of number plasmid

XbaI restriction enzymes carry out single endonuclease digestion to pGEM-T-sUCOE and pDrive5-GFP2 respectively（Electrophoresis result is shown in Fig. 7（A））, purifying reclaims purpose fragment, then to carrier pDrive5-GFP-2 dephosphorylations, the pGEM-T-sUCOE after recovery with Dephosphorylized pDrive5-GFP-2 connections build p4 recombinant plasmids.Recombinant plasmid is identified with restriction enzyme NotI（Mirror Determine result and see Fig. 7（B））, identify that correct plasmid is named as p4 plasmids.

The structure of number plasmid

Using NsiI with EcoRI restriction enzymes respectively to the sUCOE PCR primers after step 3. middle PCR amplification purifications And pDrive5-GFP-2 carries out double digestion（Digestion rear electrophoresis result is referring to Fig. 8（A））, purifying recovery purpose fragment, Ran Houlian Connect structure p5 recombinant plasmids.Recombinant plasmid is identified with restriction enzyme XbaI（Digestion qualification result participates in Fig. 8（B））, mirror Fixed correct plasmid is named as p5 plasmids.

The structure of number plasmid

The UCOE fragments of the pig employed in p6 plasmid construction processes are the claimed gene order of the present invention.

Respectively using NotI and XbaI restriction enzymes to the sUCOE PCR primers after step 3. middle PCR amplification purifications And pDrive5-GFP-2 carries out double digestion（Digestion rear electrophoresis result is shown in Fig. 9（A））, purifying recovery purpose fragment, structure p6 Recombinant plasmid.Recombinant plasmid is identified with restriction enzyme PvuII（Digestion qualification result is shown in Fig. 9（B））, identify correct plasmid It is named as p6 plasmids.

Comprise the following steps that：

First respectively the sUCOE products after step 3. middle PCR amplification purifications and pDrive5-GFP-2 are carried with NotI restriction endonucleases Body DNA carries out single endonuclease digestion.

NotI endonuclease digestion systems are as follows：

NotI, 1 L；

10 × H Buffer, 2 L；

0.1%BSA, 2 L；

0.1%Tritonx-100,2 L；

SUCOE/ pDrive5-GFP-2,1 g/2 g；

ddH₂O complements to 20 L；

37 °C of digestion 2h.

Digestion products are cut glue purification, reclaim purpose fragment through 1.0% agarose gel electrophoresis.

Reusing XbaI restriction enzymes carries out single endonuclease digestion to the purpose fragment for reclaiming respectively.

Digestion system：

XbaI, 0.5 L；

Cutsmart, 2 L；

Recovery product, 1-2 g；

ddH₂O complements to 20 L.

Digestion products are cut glue purification and reclaim purpose fragment through 1.0% agarose gel electrophoresis.

The sUCOE products fragment of recovery and the carrier pDrive5-GFP-2 fragments for reclaiming are attached structure p6 matter Grain carrier.

Linked system：

The sUCOE fragments of recovery, 5.5 L；

PDrive5-GFP-2,1 L；

T4 DNA ligases, 1 L；

10 × T4 DNA Ligase Buffer, 2.5 L；

Digestion identification is carried out to constructed p6 plasmids using PvuII restriction enzymes.

Identification system：

PvuII, 1 L；

10 × M Buffer, 2 L；

No. 6 plasmids, 200ng；

ddH₂O complements to 20 L.

The structure of number plasmid

NotI is with EcoRI restriction enzymes to the sUCOE products after step 3. middle PCR amplification purifications, pDrive-GFP- 2 carry out double digestion with NsiI and NotI（Digestion products electrophoresis result is shown in Figure 10（A））, purifying recovery purpose fragment, structure p7 Recombinant plasmid.PvuII restriction enzymes carry out digestion identification to the p7 recombinant plasmids for building（Digestion qualification result is shown in Figure 10 （B））.

The structure of number plasmid

Template is made with pGEM-T-sUCOE, the sUCOE-8F and sUCOE-8R of step 1. middle design are primer, using LA Taq expands sUCOE8 sequences, and amplified production is detected with 0.8% Ago-Gel（Pcr amplification product electrophoresis result is shown in Figure 11（A））, Gel Extraction kit reclaims PCR primer.

To the PCR primer double digestion of recovery and digestion products are reclaimed with NotI restriction enzymes with NsiI, will reclaim enzyme Cut product to be connected with recovery product after NsiI and NotI double digestion pDrive5-GFP-2（Related digestion products electrophoresis result is shown in figure 11（B））, build p8 recombinant plasmids.Recombinant plasmid is identified with Restriction enzyme Sma I（Digestion qualification result is shown in Figure 11 （C））, identify that correct plasmid is named as p8 plasmids.

The structure of number plasmid

Template is made with pGEM-T-sUCOE, the sUCOE-9F and sUCOE-9R of step 1. middle design are primer, using LA Taq expands sUCOE9 sequences.Amplified production is detected with 0.8% Ago-Gel（Pcr amplification product electrophoresis result is shown in Figure 12（A））, The PCR primer that purifying is reclaimed.

EcoRI restriction enzymes carry out single endonuclease digestion to pDrive5-GFP-2 carriers（Digestion products electrophoresis result is shown in Figure 12 （B））, purifying recovery purpose fragment.

Non-enzymatic connection kit (ExnaseTM II) is attached, and builds p9 recombinant plasmids.

Restriction enzyme HindIII identifies recombinant plasmid（Digestion qualification result is shown in Figure 12（C））, identify correct plasmid It is named as p9 plasmids.

The structure of number plasmid

Template is made with pGEM-T-sUCOE, the sUCOE-10F and sUCOE-10R of step 1. middle design are primer, using LA Taq expands sUCOE10 sequences.Amplified production is detected with 0.8% Ago-Gel（Pcr amplification product electrophoresis result is shown in Figure 13 （A））, purify the PCR primer for reclaiming.

Single endonuclease digestion is carried out with EcoRI restriction enzymes to pDrive5-GFP-2 carriers, and purifying reclaims purpose fragment.

It is attached using non-enzymatic connection kit, builds p10 recombinant plasmids.

Recombinant plasmid is identified with Restriction enzyme Sma I（Digestion qualification result is shown in Figure 13（B））, identify correct plasmid It is named as p10 plasmids.

The structure of number plasmid

Template is made with pGEM-T-sUCOE, the sUCOE-11F and sUCOE-11R of step 1. middle design are primer, using LA Taq expands sUCOE11 sequences.Amplified production is detected with 0.8% Ago-Gel（Pcr amplification product electrophoresis result is shown in Figure 14 （A））.The PCR primer that purifying is reclaimed.

XbaI carries out double enzymes with PCR primer and pDrive5-GFP-2 that EcoRI restriction enzymes are reclaimed to purifying respectively Cut（Digestion products electrophoresis result is shown in Figure 14（B））, purifying recovery purpose fragment, connection build p11 recombinant plasmids.With restriction Property restriction endonuclease XbaI and EcoRI recombinant plasmid double digestion is identified（Digestion qualification result is shown in Figure 14（C））, identify correct plasmid It is named as p11 plasmids.

The structure of number plasmid

Template is made with pGEM-T-sUCOE, the sUCOE-12F and sUCOE-12R of step 1. middle design are primer, using LA Taq expands sUCOE12 sequences.Amplified production is detected with 0.8% Ago-Gel（Pcr amplification product electrophoresis result is shown in Figure 15 （A））, purify the PCR primer for reclaiming.

EcoRI carries out double enzymes with PCR primer and pDrive5-GFP-2 that NotI restriction enzymes are reclaimed to purifying respectively Cut（Related digestion products electrophoresis result is shown in Figure 15（B）, Figure 15（C））, purifying recovery purpose fragment, connection build No. p12 restructuring Plasmid.Restriction enzyme EcoRI and NotI is identified to recombinant plasmid double digestion（Digestion qualification result is shown in Figure 15（D））, identification Correct plasmid is named as p12 plasmids.

The structure of number plasmid

Template is made with pGEM-T-sUCOE, the sUCOE-13F and sUCOE-13R of step 1. middle design are primer, using LA Taq expands sUCOE13 sequences.Amplified production is detected with 0.8% Ago-Gel（Pcr amplification product electrophoresis result is shown in Figure 16 （A））, purify the PCR primer for reclaiming.

Single endonuclease digestion is carried out with EcoRI restriction enzymes to pDrive5-GFP-2 carriers, and purifying reclaims purpose fragment.

It is attached using non-enzymatic connection kit, builds p13 recombinant plasmids.

Recombinant plasmid is identified with Restriction enzyme Sma I（Digestion qualification result is shown in Figure 16（B））, identify correct plasmid It is named as p13 plasmids.

The structure of number plasmid

NotI is with XbaI restriction enzymes respectively to the sUCOE products and pDrive- after step 3. middle PCR amplification purifications GFP-2 carries out double digestion（Related digestion products electrophoresis result is shown in Figure 17（A））, purifying recovery purpose fragment, connection build p14 Number recombinant plasmid.

Restriction enzyme EcoRI identifies recombinant plasmid（Digestion qualification result is shown in Figure 17（B））, identify correct plasmid life Entitled p14 plasmids.

（2）By step（1）Middle screening, 14 plasmids for building carry out cell transfecting

Cell culture and transfection process are described as follows.

Cell type：Human embryonic kidney epithelial cells（HEK293T）, purchased from Shanghai Chuan Xiang bio tech ltd.

Cell culture fluid composition：90% high glycoform DMEM culture mediums, 10% hyclone, penicillin（100 IU/ml）, chain Mycin（100mg/ml）.

Cell culture condition：37 °C, 5%CO₂Cultivate in incubator.

Passage：Outwell nutrient solution in cell bottle first, discard after adding the cleaning of 10mL PBS solutions, add After 1mL0.25% pancreatin digestion 2min, take 9mL cell culture fluids and add piping and druming mixing in cell bottle to put after forming cell suspending liquid Enter CO₂In incubator.

Transfection process：Before transfection 8h by the HEK293T cells in exponential phase with 10⁵The density in/hole is inoculated in 6 holes Plate, when cell fusion degree is up to 80% ~ 85%, by specification requires to be transfected using lipofectamine turbofect.With GFP2-hUCOE plasmids（It is built-up that the UCOE of people is that hUCOE DNA fragmentations are connected with pDrive5-GFP-2 plasmids）As right According to group, 14 plasmids using the pig of structure are used as test group.Renew fresh cell culture fluid after transfection 12h.Use after transfection 24h PBS once collects cell afterwards.

（3）The mRNA relative expression levels of real time fluorescent quantitative examining report gene GFP

1. the extraction of the total serum IgE of HEK293T cells

Step（2）After 24 h of middle HEK293T cell transfectings culture, cleaned with PBS liquid, 1mL Trizol are added per hole, quiet 5min is put, is blown and beaten with pipette tips repeatedly until Trizol clarifications are bright.200 L chloroforms are added, acutely 15s is shaken, is stored at room temperature 5min.4 °C, there is lamination in 12000rpm, centrifugation 15min.Supernatant is transferred in new centrifuge tube, is added isopyknic Isopropanol, mixing 5-10 time of turning upside down, is stored at room temperature 10min.4 °C, 12000rpm is centrifuged 10min, and supernatant discarded is added 75% ethanol of 1mL, resuspended precipitation.4 °C, 12000rpm is centrifuged 5min, and supernatant discarded adds 30 LDEPC water dissolves, with band The pipette tips of filter core are blown and beaten 20 times up and down, 58 °C of incubation 10min.

Micro-spectrophotometer is carried out purity check and measures concentration to the RNA for extracting, and as a result finds to extract RNA concentration models It is trapped among in the range of 1000-2000ng/uL, it is 2.13 that 260/280 average of relatives is 1.80,260/230 average of relatives, Pass Test Require.

2. reverse transcription synthesizes cDNA

Using PrimeScript II 1st Strand cDNA Synthesis Kit kits RNA reverse transcriptions into cDNA.

3. design of primers and synthesis

According to the mRNA sequence of people GAPDH genes and jellyfish GFP genes in Genbank, 3.0 softwares of EXPRESS are applied Design real-time fluorescence quantitative PCR primer, primer sequence design are as shown in the table（The primer of design gives birth to work bioengineering skill by Shanghai Art Services Co., Ltd synthesizes）, then compare on NCBI, the higher primer of specificity is chosen as real time fluorescent quantitative PCR primer.

4. quantitative fluorescent PCR

After different cDNA samples in test group are mixed with primer, SYRB Mix respectively, enterprising in quantitative real time PCR Instrument Row reaction.

Reaction system is：5 L of 1.25 L of cDNA, SYRB Mix, each 0.5 L of upstream and downstream primer.Each sample repeats three Secondary.PCR response parameters：95 °C of denaturations 2min, 95 °C of denaturation 15s, 60 °C of annealing 20s, 72 °C of extension 20s, totally 40 circulations.

According to the specificity that melting curve judges product.The CT value standards that target gene GFP is made with the CT values of internal reference GAPDH Change, calculate mRNA relative expression's abundance of target gene GFP.

5. the calculating of mRNA relative expression quantities

With GAPDH house-keeping genes as internal reference, with the mrna expression amount of GFP2-hUCOE plasmids as a control group, by formula The genes of interest mRNA relative expression quantities of 14 plasmids are calculated：

Ratio=Etarget△Ct target(control-sample)/GEOMEAN(Ereference△Ct ref (control-sample),

Wherein Ratio：MRNA relative expression quantities；Etarget：Purpose mRNA amplification efficiency；Ereference：Internal reference mRNA Amplification efficiency；Ct control：The Ct values of control group；Ct sample：The Ct values of sample sets.Relative expression quantity data are adopted GraphPad Prism6.0 statistical softwares are arranged and are counted mapping.Group difference is checked using one-way analysis of variance F.p <0.05 is have notable significant difference, p<0.01 indicates extremely notable significant difference.

After 14 Transfected Recombinant Plasmid HEK293T cells of pig, the relative mRNA expression levels figure result of GFP genes is shown in figure 18.It can be seen that mRNA relative expression's abundance highests of the GFP of p6 plasmids, are 1.6 times of control group（p< 0.05）.

（4）The relative expression quantity of Western blot method examining report gene GFP

1. protein extraction and protein quantification

By step（2）HEK293T cells after 24 h of middle transfection, after being cleaned with PBS liquid, add RIPA per hole（The green skies, PMSF containing final concentration of 2mmol）Lysate 350uL.30min is cracked on ice.4 °C, 12000g is centrifuged 30min, takes supernatant extremely One new EP pipes.Using BCA determination of protein concentration kit measurement sample concentrations.First by protein standard substance according to 0,1,2,4, 6,8,10 L add 96 orifice plates, three repetitions.Each sample take 10 L add 96 orifice plates, 2 ~ 3 repeat parallel.To sample and mark 200 L BCA working solutions are added to mix in quasi- sample wells.37 °C, 30min is incubated, room temperature is cooled to, surveyed with ELIASA 562nm wavelength Determine sample absorbance.Calibration curve is made using CurveExpert, sample concentration is obtained.According to the demand of applied sample amount, take appropriate Sample adds isopyknic 2 × SDS loading Buffer, mixes, 99 °C of 5 ~ 10min of incubation, and sample is inserted ice rapidly In, ice bath 10min.Packing, -20 °C save backup.

2. electrophoresis

Glue：

Offset plate is assembled according to specification, 14% separation gel is first prepared.Fill a prescription and be：Pure water, 1.8mL；1.5M Tris-cl (pH8.8), 2.5mL；10%SDS, 0.1mL；50%Glycerol, 2mL；40%Arcy:Bis(37.5:1), 3.5mL；10%APS, 80µL；TEMED, 15 L.

Above-mentioned solution is mixed, the alcohol of 6.5 ~ 6.6mL 75% is added in offset plate, cover one layer, drive bubble, room temperature away 30min is placed, after gelling is solid, alcohol is poured out, alcohol is blotted as far as possible.Then concentration glue is prepared by formula as below：Ultra-pure water, 3.25mL；0.5M Tris-cl (pH6.8), 1.25mL；10%SDS, 0.05mL； 40%Arcy:Bis (37.5:1), 0.375mL；10%APS, 50 L；TEMED, 10.

Concentration glue is rapidly added, comb is plugged, it is to avoid bubble is produced, room temperature places 1h or so, treats that glue solidifies completely, will Glue plate is installed in electrophoresis tank.1 × SDS PAGE electrophoretic buffers are filled as far as possible in water jacket in electrophoresis, vertically pull up comb.

Loading and electrophoresis：

The sample that equal protein content is drawn with microsyringe（About 6 g）, loading.Switch on power, concentration glue is with 120V electricity Swimming, adjusts voltage to 180V, when bromophenol blue indicator enters separation gel until bromophenol blue indicator is apart from the bottom of glue about 0.5- 1cm, stops electrophoresis.

Transferring film：

In advance NC films and filter paper pads are immersed in brand-new 1 × Transfer Buffer, are treated fully to soak, is carried out transferring film. In the box for filling transferring film liquid, according to filter paper-NC films（It is speeded）The order of-separation gel-filter paper is fixed.It is put into transferring film electrophoresis Groove, adds 1 × Transfer Buffer, notes glue in negative pole, and film is in positive pole.Transferring film condition：4 °C, 100V, 70min.

Closing：

Transferring film terminates, and takes out ProBloot membrane, prunes film edge redundance with scissors, then is cleaned once with TBST.Plus Enter the defatted milk of confining liquid 5%, close 1h.

Immune response：

Addition confining liquid dilutes after closing one resists.GFP mono- resists（Rabbit source, Abbkine, article No. #A02020）Dilution factor For 1:5000, beta-actin mono- resist（Rabbit source, Bo Aosen, article No. bs-0061）Dilution factor is 1:3000,4 °C, horizontal shaker mistake Night.Incubation terminates, and fully cleans 3 times, 5min/ time with TBST.The two of HRP mark goat antirabbits is added to resist, dilution factor is 1: 3000, room temperature horizontal shaker is incubated 2h.

Luminous, development, exposure：

After two anti-incubations terminate, TBST washes 3 × 5mins of film.In darkroom, the ProBloot membrane of TBST is drained, added appropriate The ECL luminous substrates of mixing, are covered with whole blotting membrane.Luminous substrate acts on 2min, draws unnecessary luminous substrate with blotting paper, will Film is quickly put into magazine, is put into X-ray film（It is speeded）, expose 30s.It is then placed in developer solution（DG companies）, develop 1min.Certainly Wash in water, be put into fixing solution（DG companies）, about 2min is fixed, until the transparent end of film, film running water is put into In wash.Film dries.

Western blot results are as shown in figure 19, it can be seen that using rabbit-anti GFP monoclonal antibody and HRP The goat anti-rabbit igg two of mark is anti-to be identified to expression product, and detected swimming lane specific band occurs at 26.4kD, Its size is consistent with expected.Anti- to expression product with the goat anti-rabbit igg two that rabbit-anti β-actin monoclonal antibodies and HRP are marked Identified, detected swimming lane specific band occurs at 42kD, and its size is consistent with expected.By Gel-Pro Analyzer software analysis, as a result think the protein versus expression highest of p6 plasmid GFP.

Embodiment 2

By checking the technique effect of the optimal UCOE fragments of the pig that embodiment 1 is screened, inventor to do further experiment Checking, is described as follows.

（1）The structure of pCpG-Mini-GFP-UCOE plasmids

1. pCpG-Mini-GFP plasmid constructions

PCpG-GFP plasmid is built first

Respectively pDrive5-GFP-2 carriers are carried out with pCpGfree-mcs using restriction enzyme NheI and NcoI double Digestion, digestion products are cut glue purification, reclaim purpose fragment through 1.0% agarose gel electrophoresis.Two purpose pieces after recovery Section is attached, and converts, and builds pCpG-GFP plasmids.Single endonuclease digestion mirror is carried out to recombinant plasmid using restriction enzyme PacI Fixed, identify that correct plasmid is named as pCpG-GFP.

The double digestion system of pDrive5-GFP-2 and pCpGfree-mcs is as follows：

NheI, 1 L；

NcoI, 1 L；

2,4 L of NEBuffer；

PDrive5-GFP-2 or pCpGfree-mcs, 4 g；

ddH₂O complements to 40 L.

Linked system is as follows：

PCpGfree-mcs, 1 L；

PDrive5-GFP-2,5.5 L；

T4 DNA ligases, 1 L；

10 × T4 DNA Ligase Buffer, 2.5 L.

Secondly PCR expands Minicircle correlated serieses

According to the primer that Minicircle protokaryons part is designed in attP the and attB sites of Minicircle plasmids, primer sequence Row：

Upstream F:GCGATATCGAGCTCGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGG；

Downstream R:CCTTAATTAAGTCGCGCCCGGGGAGCCCAAGGGCACGCCCTGGCA.

With minicircle plasmids as template, LA Taq enter performing PCR amplification.

Amplified production is cut glue purification, reclaims purpose fragment through 0.8% agarose gel electrophoresis.

PCR amplification system is：

Upstream primer F (20 M/L), 0.5 L；

Downstream primer R (20 M/L), 0.5 L；

LA Taq, 0.5 L；

2xGCBuffer, 25 L；

DNTP Mixture, 8 L；

Minicircle plasmids, 1-2ng；

ddH₂O complements to 50 L.

PCpG-Mini-GFP plasmid is finally built

The purpose fragment for reclaiming is expanded to plasmid pCpG-GFP and PCR respectively using PacI and SacI restriction enzymes to enter Row double digestion, reclaims endonuclease bamhi and is attached, convert, build plasmid pCpG-Mini-GFP.Using restriction enzyme EcoRI identifies recombinant plasmid, identifies that correct plasmid is named as pCpG-Mini-GFP.

The double digestion system of the purpose fragment that pCpG-GFP plasmids and PCR amplifications are reclaimed is as follows：

PacI, 1 L；

SacI, 1 L；

NEBuffer Isosorbide-5-Nitrae L；

The purpose fragment that pCpG-GFP or PCR amplifications are reclaimed, 4 g；

ddH₂O complements to 40 L.

Linked system is as follows：

PCpG-GFP after digestion, 1 L；

PCR primer after digestion, 5.5 L；

T4 DNA ligases, 1 L；

10 × T4 DNA Ligase Buffer, 2.5 L.

2. design of primers

According to Clontech websites Photographing On-line non-enzymatic connection primer,

The upstream sequence of primer is, F：AAAGGAATTCCTGCAGGCCGCTAGGGGCGGGGG；

Downstream sequence is, R：CCATTGACTCCTGCAAACCTTCCCCCCGACTAA.

Amplification

The p6 plasmids built with embodiment 1 expand sUCOE6 as template using LA Taq.

PCR reaction systems and reaction condition are as follows：

Upstream primer F (20 M/L), 0.5 L；

Downstream primer R (20 M/L), 0.5 L；

LA Taq, 0.5 L；

2xGCBuffer, 25 L；

DNTP Mixture, 8 L；

P6 plasmids, 1-2ng；

ddH₂O complements to 50 L.

Amplified production is detected with 1% Ago-Gel（The electrophoresis result of PCR amplification sUCOE6 sequence products is shown in Figure 20（A））, Purifying reclaims sUCOE6.

3. connect, construction recombination plasmid pCpG-Mini-GFP-UCOE, digestion is identified

SdaI restriction enzymes carry out single endonuclease digestion to pCpG-Mini-GFP carriers（Digestion products electrophoresis result such as Figure 20 （B）Shown）, purifying recovery.

The digestion system of pCpG-Mini-GFP plasmids is as follows：

PstI, 1 L；

10 × HBuffer, 2 L；

PCpG-Mini-GFP, 200ng；

ddH₂O complements to 20 L.

Connection is attached using non-enzymatic connection kit, and digestion is identified（Digestion qualification result such as Figure 20（C）Shown）.

Linked system is：

PCpG-Mini-GFP, 1 L；

SUCOE6,5.5 L；

T4 DNA ligases, 1 L；

10 × T4 DNA Ligase Buffer, 2.5 L.

（2）Recombinant plasmid pCpG-Mini-GFP-UCOE conversions, L-arabinosep abduction deliverings

By step（1）The correct pCpG-Mini-GFP-UCOE and pCpG-Mini-GFP plasmids of middle identification are converted respectively Enter Escherichia coli ZYCY10P3S2T competent cells, coat 37 °C of perseverances on the LB flat boards containing kanamycins (50 g/mL of concentration) Temperature culture 12-16h.

Picking monoclonal colony inoculation is in 2mL LB（50 g/mL containing kanamycins）In test tube, 30 °C of lower 250rpm water-baths Vibration 1-2h, surveys its OD value.

According to inoculation bacterium solution volume=（10^-2×50mLTB）/ OD value formula take bacterium solution and are inoculated in 50mL TB（Contain kanamycins 50µg/mL）In conical flask, 30 °C of lower 250rpm vibrations reach 4-5 up to OD values, and pH is more than 6.5.

By the induction agent composition for mixing in advance（Containing the normal temperature LB culture mediums of 50mL antibiotic-frees, 0.2mL 10N NaOH, 50µL 20% L-arabinose）Add in above-mentioned conical flask, 250 rpm vibrations 5.5h under 30 °C.

Parental plasmid pCpG-Mini-GFP and pCpG-Mini-GFP-UCOE respectively obtain micro- through L-arabinose inductions Ring plasmid pCpG-Mini-GFP and pCpG-Mini-GFP-UCOE.After BglII single endonuclease digestions, 1% agarose gel electrophoresis detection parent There is a specific band at 6485bp in this plasmid pCpG-Mini-GFP, through micro-loop plasmid pCpG-Mini- obtained by induction Only there is a specific band at 2441bp in GFP（Figure 21 A）, illustrate to induce successfully.Similarly for plasmid pCpG-Mini- After GFP-UCOE is through BglII single endonuclease digestions, there is a specific band at 7442bp, through micro-loop plasmid pCpG- obtained by induction Only there is a specific band at 3398bp in Mini-GFP-UCOE（Figure 21 B）, illustrate to induce successfully.

（3）The mRNA relative expression levels of real time fluorescent quantitative examining report gene GFP

Micro-loop plasmid pCpG-Mini-GFP after with induction as a control group, micro-loop plasmid pCpG-Mini-GFP-UCOE 293T cells are transfected as test group, processing method is with the real-time fluorescence quantitative PCR program in embodiment 1.

The relative mRNA expression levels result of GFP genes is as shown in figure 22.It can be seen that micro-loop plasmid pCpG- Relative expression's abundance of the GFP of Mini-GFP-UCOE is 2.37 times of control group pCpG-Mini-GFP（p 0.05）, this result Show, sUCOE6 fragments, i.e., claimed gene order of the invention can significantly increase the expression of foreign gene.

SEQUENCE LISTING

<110>Agricultural University Of He'nan

<120>A kind of UCOE controlling element fragments of the pig for strengthening exogenous gene expression

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 957

<212> DNA

<213> Pig UCOE

<400> 1

gggccgctag gggcgggggt gagcgcgcgc cccgcggggg ggaggggccg cgcgccgcgc 60

tttgcccgcc gggagcccga gcccgagccc gagccgaagg gtgggtgggg gaaggagggg 120

gtggtgacac cggcactcac cgttcggggc gtagcggctg gtggtcccca aaggggaggg 180

aaagagaggg aggagcgggg actgtgaccg gagtctcctc ggcggaggcg ttcctgcttt 240

gcagcagctg cactggcgcc aaaacaggac tccgcccact tcctagtccc tggggttggg 300

tgcctccaaa tgctggtggt gggtgtaaaa cttgggtggg aggactcaat taggaactaa 360

gagttagatt accctgtcca aagacctcct gaacccgaga ggttgacccc aaaagcgttg 420

tccaaggtta ggtaggtgag gcgtgaaatg taacttgttg accacaagtc gcttcgggtg 480

tttccggaag aggccgagtc tgtcctcaat tcagggagga ggagggaaag cgctgtagag 540

aaggctacaa agattttttt ttttagagac ggggggcggt gggtattggg attatcaaag 600

cgttgctcta aggaccacct tccgggttga ggggctggac ctgaaagctg aggattaagc 660

tcctccccac agtgttaatt tcaaactgcg cgaccgtttc tcacctgccc tgcgctaaag 720

ctgggcgggg ggcggggact ggacttaatt ccgagagaga aatacgcagg gctcgagcct 780

tccgcaattc acagagccct tttacgcaag tgacgtcaag caccactgtt ggctgcgagg 840

agggaggggc acgtacttgg cgcaaggagg tcgtagagcg ttcccgccat tggcggcggt 900

tagggcgttt acgcaacggc ctgacgtagg gcaggacgcg ttagtcgggg ggaaggt 957

Claims (3)

1. a kind of strengthen exogenous gene expression pig UCOE controlling element fragments, it is characterised in that the controlling element fragment Length is 957bp, and its base sequence is as shown in SEQ ID NO.1.

2. application of the UCOE controlling elements fragment in terms of exogenous protein expression described in claim 1, it is characterised in that Ke Yizeng The expression of strong foreign protein.

3. application of the UCOE controlling element fragments in terms of exogenous protein expression as claimed in claim 2, it is characterised in that described Strengthen exogenous protein expression, be by construction recombination plasmid expression vector pCpG-Mini-GFP-UCOE, transfect HEK293T thin Born of the same parents, enhanced GFP express.