CN104513309A - Protein function structural domain hinge peptide and applications thereof - Google Patents

Abstract

The invention provides a protein function structural domain hinge peptide amino acid sequence, an amino acid sequence and expression gene of a multifunctional structural domain recombinant protein, which is composed of the hinge peptide connection protein functional structural domains, and an expression preparation method and applications thereof. The designed and prepared multifunctional structural domain recombinant protein has the advantage that each functional structural domain has high function efficiency.

Description

A kind of protein function structural domain hinge peptide and uses thereof

Technical field

The invention belongs to bioengineering field, be specifically related to a kind of hinge peptide connecting protein function structural domain, and connected aminoacid sequence, the expressing gene of the multifunction structure territory recombinant protein that protein function structural domain forms by this hinge peptide, and express Preparation method and use.

Background technology

Functional domain is the region in biomacromolecule with specific structure and standalone feature.Between the functional domain of native protein, hinge area peptide section varying length, can not ensure that in some purposes structural domain efficiently plays biological function.As a kind of cell wall protein that albumin A is A type streptococcus aureus (Staphylococcus aureus), can specifically in conjunction with people and mammalian antibody (mainly IgG).Contained by native protein A, 5 functional domains can independent binding antibody Fc district in theory.But each native protein A on average can only in conjunction with 2.1 antibody molecules (measuring with ITC200 calorimetric titration) in the solution, being equivalent to each structural domain can only in conjunction with 0.4 antibody molecule, and when albumin A is fixed on agarose ball, the antibody that average each structural domain combines is reduced to 0.12 molecule; Hinge peptide between analyzing proteins A topology discovery native protein A structural domain is the longest only has 13 amino acid (aminoacid sequence between structural domain E-D agent structure: APKADAQQNNFNK), and the N-C of most extended conformation holds distance to only have the main body geometric properties of each binding domain of albumin A is about length diameter about cylinder; Even if when stretching most, the interval of Protein A molecules binding domain is about (be equivalent to the length of binding domain add stretching, extension hinge length sum).And antibody molecule Fc and the three-dimensional arrangement of two Fab structural domains are equivalent to being about together with 3 bolts diameter ovoid.Also have even if antibody molecule arranges thickness in most close-packed arrays mode obviously beyond Protein A molecules structural domain interval any one structural domain combine antibody molecule take up space and all can hinder adjacent two structural domains binding antibody molecule again, reduce the efficiency of Protein A molecules binding antibody.Japanese Patent JP2009/066553 and US Patent No. 2006019495 etc. enhance resistance to alkali ability and purification performance with biotechnology engineered protein A.Between four domain protein A structural domains in US Patent No. 2006019495, the N-C end distance of most band andgudgeon chain peptide (aminoacid sequence: APKQAPKVDAKFTVDNK) conformation all exists between; Most band andgudgeon chain peptide (aminoacid sequence: APTGSSGTATAQQNNF) between the structural domain of four domain protein A in Japanese Patent JP2009/066553, the N-C end distance of conformation all exists between, length is greater than above probability accounts for 1/4, see conversely be exactly 3/4 Protein A molecules conformation in structural domain interval be less than any one structural domain combine antibody molecule take up space and all can hinder adjacent two structural domains binding antibody molecule again.So the efficiency of the Protein A molecules binding antibody of these patents still awaits improving, thus improve the core purification efficiency of antibody drug, reduce antibody drug production cost, enhancing antibody drug industries develops, and allows more patients afford to use antibody drug.

Summary of the invention

An object of the present invention is to provide the protein structure domain hinge peptide of a kind of engineer, for connecting multiple structural domain in albumen, makes each structural domain effectively can play biological function.In engineer's albumen functional domain size and when playing function decide the length of required structural domain hinge peptide in conjunction with the size of target protein.Main body geometric properties as structural domain each in Protein A molecules is about length diameter about cylinder; Be that antibody molecule is with the thinnest during binding antibody thickness dense arrangement, require that Protein A molecules structural domain interval is need the hinge peptide inserting certain length between protein A domain main body protein A domain main body spacing could be extended to the degree binding antibody while of adjacent domains not being had to disadvantageous effect.Research widely finds that the hinge peptide between antibody molecule Fab and Fc has more satisfactory function.Open source literature reports hinge peptide length between dissimilar and subclass antibodies molecule Fab and Fc, as 3x15 amino acid (EPKSCDTPPPCPRCP) 3, be rich in glycine and proline(Pro) [TAN, et.al., Proc.Natl.Acad.Sci.USA (1990), 87:162-166; Prorein Science (1997), 6:407415.; Roux, et.al., JImmunol1998; 161:4083-4090; Zhao, et.al., Proc.Natl.Acad.Sci.USA (2006), 103:12087-12092; Protein Structural Databank http://www.pdb.org/; Uniprot Protein Data Bank: http://www.uniprot.org/], common antibody hinge peptide is as shown in table 1, and the hinge peptide using these longer can make each structural domain of some albumen can complete independently biological function.

The hinge peptide amino acid sequence of table 1 antibody sources

Another object of the present invention is to provide the recombinant protein of described hinge peptide linkage function structural domain, and the Functional domains connected by described hinge peptide can the binding ability of significantly enhancement function structural domain and substrate molecule.One of Functional domains kind of the present invention is the B1 structural domain for A, B, C, D, E, Z structural domain of the albumin A of binding domain-immunoglobulin or B1, B2 structural domain of Protein G or albumen L, and these Functional domains all have the ability be combined with antibody molecule.In recombinant protein, one or more of Functional domains can carry out arbitrary combination, the hinge peptide connected between these Functional domains can be selected from arbitrarily in albumen hinge peptide of the present invention one or more arbitrary combination.In addition, the N-end of recombinant protein and C-terminal can comprise albumen hinge peptide of the present invention respectively, increase the extensibility of recombinant protein structure, and simultaneously containing at least 1 Methionin or halfcystine, for fixing a point, reaction is fixedly coupled to chromatography media, make the recombinant protein part be coupled on medium have the space structure more stretched, be conducive to recombinant protein ligand binding antibody molecule.

Another object of the present invention is to provide a kind of method of antibody purification, comprises and uses affinity media using recombinant protein of the present invention as aglucon, by the antibody molecule in the method purified mammalian serum of affinity chromatography or other body fluid and structural constituent.Accompanying drawing explanation

Fig. 1 shows column diagram (X-coordinate mark 1: the native protein A (SPA) in figure of the antibodies ratio of the monomer of Multidomain albumin A, dimer, tripolymer, the tetramer, pentamer, six aggressiveness and the native protein A (SPA) that artifical hinge's peptide connects; 2: monomer; 3: dimer; 4: tripolymer; 5: the tetramer; 6: pentamer; 7: six aggressiveness; ), combining ratio is represented with the ratio of the amount (mol) of the binding domains in recombinant protein or native protein A by the antibody amount (mol) of reaction.The monomer of Multidomain albumin A, dimer, tripolymer, the tetramer, pentamer, six aggressiveness that wherein artifical hinge's peptide connects demonstrate the character being significantly higher than native protein A antibodies ratio.

The invention provides a kind of hinge peptide, for connecting multiple structural domain in albumen, making each structural domain can play biological function efficiently.The length of described hinge peptide extended conformation be greater than structural domain geometrical length and its performance function in conjunction with the difference of target protein geometric widths, make each in conjunction with remarkable minimizing sterically hindered between target protein and binding domains, add in conjunction with the combination between target protein and binding domains.

All Science and Technology terms used herein have and common implication known for biology, biotechnology and bioengineering field technician.But for the sake of clarity, following term defines as follows especially:

" hinge peptide " used in the present invention refers to a part for the hinge area of animal's antibody molecule, single copy (single hinge area) or multiple copied (multiple hinge area) and combination thereof.

" Functional domains " used in the present invention or " structural domain " refer to the protein structure domain with binding domain-immunoglobulin molecule or other similar functions.

" immunoglobulin (Ig) " used in the present invention refers to the protein molecular with antibody activity.

" recombinant protein " used in the present invention refers to the technology applying recombinant DNA or recombinant RNA, obtain the recombinant vectors of gene fragment containing target protein can be translated into, proceeded to the host cell that can express target protein afterwards thus express specific protein.

The aminoacid sequence of hinge peptide used in the present invention is specifically as shown in table 1.In some embodiments, the aminoacid sequence of hinge peptide is selected from the list copy of people or amouse antibody molecule.In some embodiments, described hinge peptide is the hinge area of the antibody of people or mouse.In order to reduce because amino acid residue side causes steric hindrance or other unexpected detrimentally affects, the cysteine residues aminoacid replacement with little side chain in described hinge peptide, the amino acid with little side chain is selected from glycine, L-Ala, Serine, Threonine and aspartic acid, in some embodiments, cysteine residues L-Ala, Serine or Threonine in hinge peptide replace.

Should be understood that, the aminoacid sequence of described hinge peptide comprises the simple modification for amino-acid residue in hinge peptide amino acid sequence, comprise the increase of one or several amino-acid residue, deletion or replacement, this modification can not produce significant impact to hinge peptide structure and function, or in hinge peptide, use amino acid whose analog well-known to those skilled in the art, derivative or its arbitrary combination.

The recombinant protein providing described hinge peptide linkage function structural domain in addition of the present invention, described recombinant protein is made up of with the hinge peptide being connected these structural domains Functional domains, wherein, functional type structure be selected from the A (SEQ ID NO:48) of albumin A, B, C, D (SEQ ID NO:49), E, Z (SEQID NO:47) or the B1 (SEQ ID NO:50) of Protein G, B1 (SEQID NO:52) structural domain of B2 (SEQID NO:51) or albumen L or its derivative, analogue or its arbitrary combination in the art.In some embodiments, described functional type structure and A, D or Z structural domain being albumin A.The hinge peptide connecting these structural domains is arbitrary protein structure domain hinge peptide of the present invention or its combination.The N-end of recombinant protein and C-terminal can comprise arbitrary albumen hinge peptide or derivatives thereof of the present invention, analogue or its arbitrary combination respectively.Should be understood that, the aminoacid sequence of described Functional domains comprises the simple modification to amino-acid residue in aminoacid sequence, comprise the increase of one or more amino-acid residue, deletion or replacement, this modification can not produce significant impact to hinge peptide structure and function, or in hinge peptide, use amino acid whose analog well-known to those skilled in the art, derivative or its arbitrary combination.In some embodiments, described hinge peptide from Mammals, preferred people or mouse.In other embodiment, cysteine portion or all replace with glycine in described hinge peptide.In addition, the N-end of recombinant protein and C-terminal can contain at least 1 halfcystine or Methionin, and in some embodiments, the N-end of recombinant protein and C-terminal can contain 1 halfcystine or Methionin.Recombinant protein of the present invention is polymer, comprises multiple functional domain and hinge peptide.In some embodiments, described recombinant protein presents with dimer, tripolymer, the tetramer, pentamer or six aggressiveness, preferred tripolymer, the tetramer, pentamer and six aggressiveness.Described recombinant protein has the ability of good bound substrates molecule, and the structural domain compared in native protein increases significantly.In certain embodiment, in recombinant protein A molecule, adopt structural domain hinge peptide provided by the invention can improve the efficiency more than 1 times of structural domain binding antibody.

Another object of the present invention is to provide the expression vector of recombinant protein A, and described expression vector comprises the plasmid of the polynucleotide can expressing recombinant protein A, and described plasmid is selected from prokaryotic expression plasmid or eukaryon expression plasmid.In some embodiments, described plasmid is pET28a.

Another object of the present invention is to provide the preparation method of recombinant protein A, and described method comprises: (1) cultivates host cell of the present invention; (2) abduction delivering recombinant protein A; (3) separation and purification obtains recombinant protein A.Wherein, described host cell is eukaryotic cell or prokaryotic cell prokaryocyte, preferred prokaryotic cell prokaryocyte, and in some embodiments, described host cell is intestinal bacteria.The method of described separation and purification comprise ion chromatography, molecular sieve, affinity chromatography and other be the method for separation purification method well known to those skilled in the art or its combination, in some embodiments, described separation purification method is affinity chromatography.

Another object of the present invention is to provide the medium of affinity chromatography, and it comprises can the recombinant protein A part of binding domain-immunoglobulin and chromatography media carrier.Described chromatography media carrier is selected from sepharose, dextran, Mierocrystalline cellulose, silica gel or the high molecular polymer with hydroxyl.In some embodiments, described chromatography media carrier is sepharose.The preparation method of described affinity chromatography medium comprises: (1) activation chromatography medium carrier; (2) recombinant protein of the present invention and chromatography media carrier conjugation.Wherein, described coupling condition is, temperature is 30-50 DEG C, preferred 35-40 DEG C, most preferably 37 DEG C, the time is 8-25 hour, preferred 10-20 hour, most preferably 16 hours, sodium sulfate concentration was 0.05-0.37g/ml medium, preferred 0.05-0.18g/ml medium, most preferably 0.1g/ml medium, in some embodiments, described coupling condition is 37 DEG C, 16 hours, sodium sulfate concentration 0.1g/ml medium.

In sum, the invention provides a kind of new protein structure domain hinge peptide and uses thereof, the recombinant protein containing hinge peptide of the present invention can be used for producing purifying and obtains antibody drug or product, such as pure immunoglobulin components.The carrying capacity of enhancing and higher adsorptive power is presented using recombinant protein of the present invention as the medium of part.

Embodiment

The present invention is described in further detail by the following examples, should be understood that, these embodiments do not limit the scope of the invention.

Embodiment 1

The Multidomain albumin A carrier of mouse antibody molecule hinge area 1 and Z structural domain

Z_DR-LK_ml1-DNNKEGSK (SEQID NO:53) polynucleotide passage of synthetic, the halfcystine in the sequence of wherein hinge peptide (SEQ ID NO:2) all replaces with L-Ala or Threonine (P ad tg tkP ai atVP) (SEQ ID NO:59), with e. coli plasmid vector pET-28a restriction enzyme NdeI and SpeI double digestion (Sai Mo flies company), 37 DEG C, 8 hours, electrophoresis is tapped rubber, AXYGEN gel cleaning agents box (AXYGEN company) is used to reclaim fragment, then the fragment reclaimed and carrier T4 ligase enzyme (Sai Mo flies company) are connected into recombinant vectors, 22 DEG C, 8 hours, the connection product of 5 μ l is added in 50 μ l Escherichia.coli DH5a (Tian Gen biochemical technology company limited) competent cells and mix gently, ice bath proceeds to 42 DEG C of water-baths 90 seconds for 20 minutes again, ice bath 2 minutes again, add 900 μ l37 DEG C of preheating LB liquid nutrient mediums, recover 1 hour in 37 DEG C of shaking table 150rpm, getting 200 μ l, to coat LB containing kantlex dull and stereotyped, cultivate 20 hours for 37 DEG C, a progressive evaluation and screening transformant.Picking mono-clonal, contains in the LB liquid nutrient medium of kantlex in 3ml, 37 DEG C, 180rpm, cultivates 1 hour, and bacterium liquid order-checking qualification (Jin Sirui company), obtains monomer recombinant protein A carrier pET28a/Z_DR-LK_ml1-DNNKEGSK.

Then by the polynucleotide passage of SEQ ID NO:53, with monomer recombinant protein A carrier restriction enzyme NdeI and SpeI double digestion, 37 DEG C, 8 hours, electrophoresis is tapped rubber, AXYGEN gel cleaning agents box is used to reclaim fragment, then the fragment of recovery and carrier T4 ligase enzyme are connected into recombinant vectors, 22 DEG C, 8 hours, the connection product of 5 μ l is added in 50ul Escherichia.coli DH5a competent cell and mix gently, ice bath proceeds to 42 DEG C of water-baths 90 seconds for 20 minutes again, ice bath 2 minutes again, add 900 μ l37 DEG C of preheating LB liquid nutrient mediums, recover 1 hour in 37 DEG C of shaking table 150rpm, getting 200 μ l, to coat LB containing kantlex dull and stereotyped, cultivate 20 hours for 37 DEG C, a progressive evaluation and screening transformant.Picking mono-clonal, contains in the LB liquid nutrient medium of kantlex in 3ml, 37 DEG C, 180rpm, cultivates 10 hours, and order-checking qualification, iterative cycles successively, obtains dimer, tripolymer, the tetramer, pentamer and six aggressiveness recombinant protein A carriers respectively.

The following examples adopt the method in embodiment 1 to build the carrier of the recombinant protein of Z structural domain and the hinge peptide obtained containing albumin A, and horizontal line represents the sequence of replacement.

Embodiment 4

The Multidomain albumin A carrier of mouse antibody molecule hinge area 1 and D structural domain and A structural domain

D_DR-A_DR--LK_mIl-DNNKEGSK (SEQID NO:56) polynucleotide passage of synthetic, the halfcystine in the sequence of wherein hinge peptide (SEQID NO:2) all replaces with L-Ala or Threonine (P ad tg tkP ai atVP) (SEQID NO:59), with e. coli plasmid vector pET-28a restriction enzyme NdeI and SpeI double digestion, 37 DEG C, 8 hours, electrophoresis is tapped rubber, AXYGEN gel cleaning agents box is used to reclaim fragment, then the fragment of recovery and carrier T4 ligase enzyme are connected into recombinant vectors, 22 DEG C, 8 hours, the connection product of 5 μ l is added in 50ulEscherichia.coli DH5a competent cell and mixes gently, ice bath proceeds to 42 DEG C of water-baths 90 seconds for 20 minutes again, ice bath 2 minutes again, add 900 μ l37 DEG C of preheating LB liquid nutrient mediums, recover 1 hour in 37 DEG C of shaking table 150rpm, getting 200 μ l, to coat LB containing kantlex dull and stereotyped, cultivate 20 hours for 37 DEG C, a progressive evaluation and screening transformant.Picking mono-clonal, contains in the LB liquid nutrient medium of kantlex in 3ml, 37 DEG C, 180rpm, cultivates 1 hour, and bacterium liquid order-checking qualification, obtains dimer recombinant protein A carrier pET28a/D_DR-A_DR-LK_ml1-DNNKEGSK.

Then by the polynucleotide passage of SEQ ID NO:56, with monomer recombinant protein A carrier restriction enzyme NdeI and SpeI double digestion, 37 DEG C, 8 hours, electrophoresis is tapped rubber, AXYGEN gel cleaning agents box is used to reclaim fragment, then the fragment of recovery and carrier T4 ligase enzyme are connected into recombinant vectors, 22 DEG C, 8 hours, the connection product of 5 μ l is added in 50 μ l Escherichia.coli DH5a competent cells and mix gently, ice bath proceeds to 42 DEG C of water-baths 90 seconds for 20 minutes again, ice bath 2 minutes again, add 900 μ l37 DEG C of preheating LB liquid nutrient mediums, recover 1 hour in 37 DEG C of shaking table 150rpm, getting 200 μ l, to coat LB containing kantlex dull and stereotyped, cultivate 20 hours for 37 DEG C, a progressive evaluation and screening transformant.Picking mono-clonal, contains in the LB liquid nutrient medium of kantlex in 3ml, 37 DEG C, 180rpm, cultivates 10 hours, and order-checking qualification, iterative cycles successively, obtains the tetramer and six aggressiveness recombinant protein A carriers respectively.

The following examples adopt the method in embodiment 4 to build the carrier of the recombinant protein of the D structural domain, A structural domain and the hinge peptide that obtain containing albumin A.

Embodiment sequence number	Hinge peptide	Fragment name
			Embodiment 5	PKS TDKTHT APP APAPELLGGP	D_DR-A_DR-LK_hl-DNNKEGSK

Embodiment 6

The C-end of the Multidomain albumin A of human antibody molecules hinge area and Z structural domain adds the carrier of 1 halfcystine

Design and synthesis sense primer: GACAACAACAAAGAAGGTTCTAAATGCTAAGGATCCGAATTCGAGCTC; Antisense primer: GAGCTCGAATTCGGATCCTTAGCATTTAGAACCTTCTTTGTTGTTGTC.The carrier obtained with embodiment 2 is template, PCR reaction is carried out with the two ends primer of synthesis, the carrier containing insertion halfcystine obtained, configuration reaction mixture (10 × NEB buffer5 μ l, DPnI (20U/ μ l) 1 μ l, the PCR primer 44 μ l of recovery), the order of reaction: 1, reaction 60 minutes at 37 DEG C, 2, reaction 60 minutes at 37 DEG C, reacts 40 minutes at 3,80 DEG C, reacts 10 minutes at 4,10 DEG C.Liquid-transfering gun is drawn the product 5 μ l obtained and is added in 50 μ l Escherichia.coli TOP10 competent cells (Tian Gen biochemical technology company limited) and mix gently, ice bath proceeds to 42 DEG C of water-baths 90 seconds for 20 minutes again, ice bath 2 minutes again, add 900 μ l37 DEG C of preheating LB liquid nutrient mediums, recover 1 hour in 37 DEG C of shaking table 150rpm, getting 200 μ l, to coat LB containing kantlex dull and stereotyped, cultivates 20 hours for 37 DEG C, a progressive evaluation and screening transformant.Picking mono-clonal, contains in the LB liquid nutrient medium of kantlex in 3ml, 37 DEG C, 180rpm, cultivates 10 hours, and order-checking qualification, obtains the carrier adding 1 halfcystine at the C-end of recombinant protein.

Embodiment 7

The C-end of the Multidomain albumin A of human antibody molecules hinge area and Z structural domain adds the carrier of 1 Methionin

Adopt the method in embodiment 6 to build the carrier of the recombinant protein of Z structural domain and the hinge peptide obtained containing albumin A, the C-end of wherein said recombinant protein adds 1 Methionin.

Embodiment 8

The Multidomain albumin A expression host cell of mouse antibody molecule hinge area 1 and Z structural domain

By the recombinant vectors transformation of E. coli BL21 (DE3) of mouse antibody molecule hinge area 1 with the Multidomain albumin A of Z structural domain, screening has the recombinant bacterial strain of kalamycin resistance according to a conventional method.

The following examples adopt the method in embodiment 8 to build the expression host cell obtained containing recombined protein carrier.

Embodiment sequence number	Functional domains	Hinge peptide
			Embodiment 9	The Z structural domain of albumin A	PKSCDKTHTCPPCPAPELLGGP
Embodiment 10	A and the D structural domain of albumin A	PRDCGCKPCICTVP

Embodiment 11

The purifying be separated of human antibody molecules hinge area and the Multidomain albumin A of Z structural domain

Get the human antibody molecules hinge area of glycerine pipe preservation and the Multidomain albumin A expression host cell bacterial strain 50 μ l of Z structural domain, be inoculated in the LB liquid nutrient medium of the 50ml containing kantlex, 37 DEG C, 180rpm, 12 hours, as primary seed solution.Get primary seed solution 10ml, be inoculated in the LB liquid nutrient medium of the 1000ml containing kantlex, 37 DEG C, 150rpm, 3 hours, add IPTG when 0D600 reaches 0.6 ~ 0.8 to final concentration 1mM, 37 DEG C, 150rpm, 5 hours.Centrifugal 30 minutes of 4000rpm, supernatant discarded fermented liquid, retains bacterial sediment, weighs and obtains thalline 3g.

Thalline is resuspended with 60ml sample-loading buffer (PBS, 0.14M NaCl), ultrasonication 5 minutes; Centrifugal 30 minutes of 15000rpm, collects supernatant as sample solution.Get His post (5ml column volume), with sample-loading buffer (PBS, 0.14M NaCl) balance, flow velocity 2ml/ minute, supernatant loading, flow velocity 1.5ml/ minute, collect stream during ultraviolet absorption peak to appear and wear liquid, with lavation buffer solution (PBS after completion of the sample, 0.14M NaCl) wash impurity off, flow velocity 2ml/ minute, when uv-absorbing baseline to 0, start gradient elution, elution buffer (PBS, 0.14M NaCl, 500mM imidazoles) wash-out object egg, continuous gradient wash-out (0-100%, 100ml), elutriant is collected when ultraviolet absorption peak occurs, 4ml/ manages.The each pipe eluate concentration of SDS-PAGE electrophoresis detection.

According to electrophoresis detection result, take the elutriant pipe that purity higher concentration is larger, load the dialysis tubing of 3500Da, BCA method protein quantification, packing in-80 DEG C of preservations after glycerol adding to final concentration 10%.

The following examples adopt the method in embodiment 11 to build and obtain recombinant protein.

Embodiment sequence number	Functional domains	Hinge peptide
			Embodiment 12	The Z structural domain of albumin A	PRDCGCKPCICTVP

Embodiment 13

The preparation of the Multidomain protein A affinity chromatography medium of human antibody molecules hinge area and Z structural domain

Take 840g Sepharose4FF medium and put into funnel, drain with vacuum pump using circulatory water, the deionized water adding 3 times of volumes is poured into, leave standstill 5 minutes after glass stick stirs, drain, repeat this step 3 time, last to neutral, for subsequent use after washing twice respectively with 30%, 50% and 100%DMSO.The DMSO of the medium after washing and the sodium hydroxide of 84ml0.8mol/L, 336ml epoxy chloropropane and 756ml to be loaded in large plastic reaction bottle 40rpm in 55 DEG C of rotary ovens and react 3-4 hour, when reaction solution is to stopped reaction after neutral.Take out reactant, in stink cupboard, reclaim washing medium with DMSO, after draining, at every turn with 3 times of volume of deionized water media 10 times, till pH value no longer changes, finally pump moisture, 4 DEG C of airtight preservations of refrigerator lucifuge.

Measure the medium activated and be about 5ml, centrifugal 10 minutes of 3000rpm, removes the ethanol conserving liquid on upper strata by 4 DEG C, add the 0.2M sodium hydrogen carbonate solution of 4ml, lucifuge overnight stand 12 hours in 4 DEG C of refrigerators, takes out the volume after measuring media sufficient standing precipitation, then removes 0.2M sodium bicarbonate, add isopyknic 0.2M sodium bicarbonate with medium, abundant resuspended mixing, add in the reaction tubes of 2ml 200 μ l resuspended after liquid, to ensure that the medium volume in every pipe is 100 μ l.

By the super filter tube of Multidomain Protein A solution 3kD and 10kD of each human antibody molecules hinge area and Z structural domain, 6000rpm, 4 DEG C, concentrated 10 minutes, and constantly add 0.2M sodium hydrogen carbonate solution mixes, and 5 times repeatedly, the protein solution that the BCA standard measure that the system of obtaining is replaced into 0.2M sodium hydrogen carbonate solution obtains, final reaction density is as shown in table 2.

The Multidomain albumin A linked reaction concentration of table 2 human antibody molecules hinge area and Z structural domain

	Monomer	Dimer	Tripolymer	The tetramer	Pentamer	Six aggressiveness
							Reaction density	5.43	9.09	10.44	10.31	12.82	12.33

[0063]

(mg／ml)

Often add 0.4ml in pipe medium and contain the polymeric 0.1M of albumin A, and add the anhydrous sodium sulphate of 0.1g respectively, mixing.Put into 37 DEG C of constant incubators to rotate, 45rmp/ minute, 16 hours.Take out medium, dress gravity post, with PBS cleaning twice, each 1ml, connects scavenging solution.Clean pillar with the 0.1M NaAc-HAc pH3.0 of 1ml, then use the 0.2M Gly-NaOHph11 wash-out pillar of 1ml, finally clean twice with the water of 1ml, 20% ethanol is preserved.

It take recombinant protein as the affinity chromatography medium of aglucon that the following examples adopt the method in embodiment 13 to build to obtain.

Embodiment sequence number	Functional domains	Hinge peptide
			Embodiment 14	The Z structural domain of albumin A	PRDCGCKPCICTVP

Embodiment 15

Mouse antibody molecule hinge area 1 measures with the static carrying capacity of the albumin A tetramer affinity chromatography medium of Z structural domain

Measure mouse antibody molecule hinge area 1 and the Multidomain protein A affinity chromatography medium 0.1ml of Z structural domain, put into 5ml reaction tubes, add the PBS damping fluid that 2ml contains Serum Antibodies, Serum Antibodies concentration 8mg/ml.Rotate under room temperature, 45rmp/ minute, 12 hours.Dress gravity post, cleans 3 times with PBS, each 1ml, collects scavenging solution.BCA standard measure Serum Antibodies damping fluid.

Calculating the final static carrying capacity of gained is 50.94mg people Ig6/ml medium, higher than the static carrying capacity 40-50mg human IgG/m medium of commercially available albumin A affinity media.

Embodiment 16

The static carrying capacity of the Multidomain protein A affinity chromatography medium of human antibody molecules hinge area and Z structural domain measures

Measure the Multidomain protein A affinity chromatography medium 0.1ml of human antibody molecules hinge area and Z structural domain, put into 5ml reaction tubes, add the PBS damping fluid that 2ml contains Serum Antibodies, Serum Antibodies concentration 8mg/ml.Rotate under room temperature, 45rmp/ minute, 12 hours.Dress gravity post, cleans 3 times with PBS, each 1ml, collects scavenging solution.BCA standard measure Serum Antibodies damping fluid.Calculate the final static carrying capacity of gained as shown in table 3.

The static carrying capacity of table 3 immobilization recombinant protein affinity chromatography medium

The static carrying capacity of dimer, tripolymer, the tetramer, pentamer and six aggressiveness in the Multidomain protein A affinity chromatography medium of human antibody molecules hinge area and Z structural domain is all apparently higher than the static carrying capacity 40-50mg human IgG/m medium of commercially available albumin A affinity media.

Embodiment 17

Human antibody molecules hinge area and the Multidomain protein A antibody binding constant of Z structural domain and the mensuration in conjunction with ratio

Carry out quantitatively to the Multidomain albumin A of Z structural domain, native protein A and IgG respectively with BCA protein quantification test kit (Sai Mo flies company), according to quantitative result, with 1 × PBS, to be diluted to final concentration be the concentration of 0.1mg/ml, IgG is 13mg/ml.

Setting temperature of reaction is 25 DEG C, the antibody of sample introduction needle aspirate 40ul, the sample solution of 280ul is added in reaction tank, carry out the isothermal titration reaction of 20, finally obtain the curve of energy variation, matched curve, the parameter of the amount of setting sample and antibody materials, finally obtains the thermodynamical coordinate such as binding constant Ka, combining ratio of reacting.The binding constant Ka of gained is as shown in table 4, and combining ratio as shown in Figure 1.

The Multidomain protein A antibody binding constant Ka of table 4 human antibody molecules hinge area and Z structural domain

The Multidomain albumin A of human antibody molecules hinge area and Z structural domain and the binding constant Ka of native protein A maintain 10 substantially ⁷m ^-1near, the Multidomain albumin A of human antibody molecules hinge area and Z structural domain is suitable with the avidity of native protein A antagonist.And the Multidomain albumin A of human antibody molecules hinge area and Z structural domain is compared with native protein A, its combining ratio significantly improves, and the ability of the Multidomain albumin A binding antibody of human antibody molecules hinge area and Z structural domain strengthens.

。

Claims (10)

1. one kind connects the hinge peptide of protein function structural domain, the length of described hinge peptide extended conformation be greater than structural domain in conjunction with the difference of target protein geometric widths and structural domain geometrical length, it is characterized in that described hinge peptide amino acid sequence is selected from the part in animal's antibody molecular hinge district, single copy and multiple copied and combination thereof.

2. hinge peptide as claimed in claim 1, is characterized in that described hinge peptide amino acid sequence is selected from SEQ IDNO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46.

3. hinge peptide as claimed in claim 2, it is characterized in that in described hinge peptide, the little side chain amino acid of cysteine residues replaces, little side chain amino acid is selected from glycine, L-Ala, Serine, Threonine and aspartic acid.

4. hinge peptide described in a claim 3 forms, its functional domain number forms by 2-6 and has the recombinant protein of binding antibody function, it is characterized in that described functional domain is selected from native protein A structural domain A, B, C, D, E of staphylococcus aureus protein A and engineered structural domain Z, B1, B2 of Protein G and the B1 structural domain of albumen L and derivative, analogue or its arbitrary combination.

5. recombinant protein as claimed in claim 4, is characterized in that the N-end of described recombinant protein adds hinge peptide described in one section of claim 1 and is connected with Methionin and/or halfcystine.

6. recombinant protein as claimed in claim 5, is characterized in that the C-end of described recombinant protein adds hinge peptide described in one section of claim 1 and is connected with Methionin and/or halfcystine.

7. the immobilized affinity media of recombinant protein described in claim 6, is characterized in that, described affinity media is used for the abstraction and purification of immunoglobulin (Ig).

8. polynucleotide, is characterized in that, described polynucleotide encoding recombinant protein A according to claim 4.

9. an expression vector, is characterized in that, described expression vector contains polynucleotide according to claim 8.

10. a host cell, is characterized in that, described host cell contains expression vector according to claim 9, or in genome, be integrated with polynucleotide according to claim 8.